SNP molecular marker related to cashmere fineness trait and application thereof

Abstract

The application discloses a SNP molecular marker related to a cashmere fineness trait of a goat, and the SNP molecular marker is a C>T base mutation located at 93908315 bp of a chromosome No. 10 in a goat genome ARS1.0 version. The molecular marker can be applied to the fields of breeding of the cashmere fineness trait of the goat, cultivation of a fine cashmere type goat strain, improvement of the cashmere fineness trait of a goat population, evaluation or screening of a cashmere production performance of the goat and the like. Therefore, the cashmere fineness quality of the goat can be improved, the genetic breeding progress of the cashmere fineness performance of the goat can be accelerated, and the cashmere use value and production benefit of the goat can be effectively improved.

Description

Technical Field

[0001] This invention relates to the field of molecular markers and genetic breeding, and in particular to an SNP molecular marker related to the fineness trait of cashmere and its application. Background Technology

[0002] Cashmere is a precious textile raw material. Cashmere products, renowned for their softness, warmth, and comfort, are often referred to as "soft gold" and are a crucial raw material for the high-end textile industry both domestically and internationally. my country ranks first in the world in both cashmere goat population and cashmere production, accounting for over 70% of global cashmere output. In the cashmere quality evaluation system, the average diameter of cashmere fibers is the core indicator for classifying cashmere grades and determining its market value. Fineer cashmere fibers offer higher textile processing performance and greater economic premium. Therefore, continuously reducing the average diameter of cashmere fibers is one of the core objectives of cashmere goat breeding. However, cashmere fineness has moderate heritability, influenced by a synergistic regulation of multiple genes with minor effects, as well as environmental factors, nutritional levels, and genetics. Under traditional breeding models, improving cashmere fineness primarily involves estimating individual breeding values ​​using quantitative genetics methods, selecting superior individuals for breeding, and improving the breed's production performance. Alternatively, it can be achieved by creating genetic variations and improving genetic characteristics, relying on individual phenotypic testing and family selection. However, this approach suffers from long generation intervals and limited genetic progress, making it difficult to meet the urgent demand for high-quality raw cashmere in the modern cashmere industry.

[0003] Marker-assisted selection (MAG) is a breeding method that combines modern molecular biology techniques with classical genetic breeding theories. Its core principle is to utilize DNA molecular markers closely linked to or functionally related to the target trait, allowing for early genotyping after birth. This is not limited by sex, trait expression period, or environmental factors, thus significantly shortening the breeding cycle and improving selection accuracy. MAG is suitable for improving cashmere fineness. Therefore, there is an urgent need to find new SNP molecular markers related to cashmere goat fineness and apply them to the genetic improvement of this trait. Summary of the Invention

[0004] The purpose of this invention is to provide an SNP molecular marker related to the fineness trait of cashmere and to apply it to the selection and genetic improvement of the fineness trait of cashmere.

[0005] According to a first aspect of the present invention, a SNP molecular marker associated with the fineness trait of cashmere is provided, wherein the SNP molecular marker is a C>T base mutation located at 93908315 bp on chromosome 10 of the goat genome ARS1.0 version. The dominant allele of this SNP molecular marker is C, and the dominant genotype is CC. Applying this marker to molecular breeding practices in goats, selecting for and retaining the CC dominant genotype, can significantly accelerate the genetic selection progress of cashmere fineness performance, effectively improving the production efficiency of fine-cashmere goats and the market competitiveness of cashmere products.

[0006] According to a second aspect of the present invention, an application of the aforementioned SNP molecular marker in the breeding of cashmere fineness traits is provided. Thus, when this SNP molecular marker is applied to the breeding of cashmere fineness traits, breeders can complete the assessment of an individual's genetic potential at the lamb stage, without waiting for the lamb to grow and develop into adulthood for phenotypic testing, greatly shortening the generation interval, effectively improving breeding efficiency, and reducing breeding costs.

[0007] According to a third aspect of the present invention, there is provided an application of the aforementioned SNP molecular marker in reducing the fineness trait of cashmere, the application comprising the following steps: S1: Detect the SNP molecular markers in replacement goats; S2: Individuals with the CC genotype detected in step S1 are selected as breeding goats, while individuals with the CT and TT genotypes are culled, effectively reducing the fineness of the cashmere. Therefore, by screening the genotypes of replacement goats, individuals with the dominant CC genotype can be obtained in the offspring, effectively reducing the fineness of the cashmere.

[0008] According to a fourth aspect of the present invention, there is an application of a product for detecting the SNP molecular marker in reducing the fineness trait of cashmere, the application comprising the following steps: S1: Detect the SNP molecular markers in replacement goats; S2: Individuals with the CC genotype detected in step S1 are selected as breeding goats, while individuals with the CT and TT genotypes are culled, effectively reducing the fineness of the cashmere. Therefore, by screening the genotypes of replacement goats, individuals with the dominant CC genotype can be obtained in the offspring, effectively reducing the fineness of the cashmere.

[0009] According to a fifth aspect of the present invention, there is provided an application of the aforementioned SNP molecular marker in the breeding of fine cashmere goat breeds, the application comprising the following steps: S1: Detect the SNP molecular markers in replacement goats; S2: Select individuals with the CC genotype detected in step S1 as breeding goats and breed them. S3: Detect the SNP molecular markers in the offspring born from mating in step S2, retain individuals with the CC genotype, and discard individuals with the CT or TT genotypes. Further breeding can then produce a fine-cash goat breed. Therefore, when applying this SNP molecular marker to breed fine-cash goats, only a one-time genotyping of replacement goats is required, selecting individuals with the CC genotype for mating and breeding. The operation process is simple, efficient, and easy to promote and apply in grassroots farms and breeding units.

[0010] According to a sixth aspect of the present invention, there is an application of a product for detecting the SNP molecular marker in the breeding of fine cashmere goat breeds, the application comprising the following steps: S1: Detect the SNP molecular markers in replacement goats; S2: Select individuals with the CC genotype detected in step S1 as breeding goats and breed them. S3: Detect the SNP molecular markers in the offspring born from mating in step S2, retain individuals with the CC genotype, and cull individuals with the CT or TT genotypes. Further breeding can then produce a fine-cash goat breed. Therefore, when using the product containing this SNP molecular marker to breed fine-cash goats, only a single genotyping test is needed on replacement goats. Individuals with the CC genotype are selected for mating and breeding. The process is simple, efficient, and easy to promote and apply in grassroots farms and breeding units.

[0011] According to a seventh aspect of the present invention, there is provided an application of the aforementioned SNP molecular marker in improving the fineness trait of cashmere, the application comprising the following steps: S1: Detect the SNP molecular markers in replacement goats; S2: Select individuals with the CC genotype detected in step S1 as breeding goats and breed them. S3: Detect the SNP molecular marker in the offspring born from mating in step S2. Retain individuals with the CC genotype and breed them again, selecting and breeding offspring with the CC genotype while eliminating CT and TT genotypes. This process gradually increases the frequency of the dominant allele C, thereby improving the fineness of the goat population's downy fibers and ultimately enhancing the downy fiber quality of future generations. Therefore, when this SNP molecular marker is applied to improve the downy fiber fineness trait in goat populations, it can directionally improve the fineness of downy fibers while maintaining other desirable traits. This method differs from transgenic or gene editing; it optimizes the population's genetic structure solely through genotype screening and selective breeding. It is simple to operate and easy to implement in grassroots farms.

[0012] According to an eighth aspect of the present invention, there is provided an application of a product for detecting the SNP molecular marker in improving the fineness trait of cashmere, the application comprising the following steps: S1: Detect the SNP molecular markers in replacement goats; S2: Select individuals with the CC genotype detected in step S1 as breeding goats and breed them. S3: Detect the SNP molecular marker in the offspring born from mating in step S2. Retain individuals with the CC genotype and breed them again, selecting and mating them to retain offspring with the CC genotype while eliminating CT and TT genotypes. This process gradually increases the frequency of the dominant allele C, thereby improving the fineness of the goat population's downy fibers and ultimately enhancing the downy fiber quality of future generations. Therefore, when the product containing this SNP molecular marker is applied to improve the downy fiber fineness of a goat population, it can selectively improve the fineness of the downy fibers while maintaining other desirable traits. This method differs from transgenic or gene editing; it optimizes the population's genetic structure solely through genotype screening and selective breeding. It is simple to operate and easy to implement in grassroots farms.

[0013] According to a ninth aspect of the present invention, there is an application of the aforementioned SNP molecular marker in evaluating or screening cashmere fineness traits, or an application of products detecting the aforementioned SNP molecular marker in evaluating or screening cashmere fineness traits. Therefore, when the SNP molecular marker or products detecting the aforementioned SNP molecular marker are applied to evaluate and screen cashmere production performance, compared to the current KASP genotyping method, for non-diagnostic evaluation of cashmere fineness performance, this method only requires detecting the genotype of the goat at the SNP locus to quickly determine its genetic potential for cashmere fineness. This method has significant advantages such as low sample volume, short detection cycle, high sensitivity, and good specificity, making it suitable for large-scale population screening scenarios.

[0014] According to a tenth aspect of the present invention, a product for detecting the SNP molecular marker is provided, the product comprising primers for detecting the SNP molecular marker or a kit prepared from the primers. Thus, by using the product for detecting the SNP molecular marker, the genotype of goats can be rapidly determined, and the fineness trait of goats' wool can be screened or selected based on the genotype.

[0015] According to an eleventh aspect of the present invention, a nucleotide sequence containing an SNP site associated with cashmere fineness is provided for use in the preparation of products for detecting cashmere fineness, wherein the nucleotide sequence is shown in SEQ ID No:1, and the SNP site is a C>T base mutation represented by Y at the 801st base of the nucleotide sequence. Therefore, based on this nucleotide sequence, those skilled in the art can flexibly design various detection schemes, including but not limited to PCR sequencing, KASP competitive allele typing, TaqMan fluorescent probe method, high-resolution melting curve method, etc., greatly improving the flexibility and accessibility of the technology application.

[0016] In some embodiments, the product for detecting the fineness trait of cashmere includes primers for detecting the SNP sites or a kit prepared from the primers.

[0017] In some embodiments, the sequences of the primers are shown in SEQ ID No:2 and SEQ ID No:3.

[0018] The beneficial effects of this invention are: 1. A SNP molecular marker associated with cashmere fineness is provided. This SNP molecular marker is located at position 93908315 on chromosome 10 of goats, with the dominant allele being C. Applying this marker to molecular breeding practices in goats can significantly accelerate the genetic selection process for cashmere fineness, effectively improving the production efficiency of fine-cashmere goats and the market competitiveness of cashmere products.

[0019] 2. When this SNP molecular marker is applied to the selection of cashmere fineness traits, breeders can complete the assessment of individual genetic potential at the lamb stage, without waiting for the lamb to grow and develop into adulthood for phenotypic determination, which greatly shortens the generation interval, effectively improves breeding efficiency, and reduces breeding costs.

[0020] 3. When this SNP molecular marker is applied to the breeding of fine cashmere goat breeds, only a one-time genotyping test is required on the replacement goats, and individuals with the CC genotype are selected for breeding. The operation process is simple and efficient, and it is easy to promote and apply in grassroots farms and breeding units.

[0021] 4. When this SNP molecular marker is applied to improve the fineness of cashmere in goat populations, the fineness of cashmere fibers can be improved in a targeted manner while maintaining other desirable traits of the population. This method differs from transgenic or gene editing; it optimizes the genetic structure of the population solely through genotyping and selective breeding. It is simple to operate and easy to promote and implement in grassroots farms.

[0022] 5. When applying this SNP molecular marker to evaluate and screen cashmere production performance in goats, compared to the current KASP genotyping method, for non-diagnostic evaluation of cashmere fineness, this method only requires detecting the genotype of the goat at this SNP locus to quickly determine its genetic potential for cashmere fineness. This method has significant advantages such as small sample volume, short detection cycle, high sensitivity, and good specificity, making it suitable for large-scale population screening scenarios.

[0023] 6. The nucleotide sequence containing SNP molecular markers provided by this invention allows those skilled in the art to flexibly design various detection schemes, including but not limited to PCR sequencing, KASP competitive allele typing, TaqMan fluorescent probe method, and high-resolution melting curve method, which greatly improves the flexibility and accessibility of the technology application.

[0024] 7. Primers for detecting SNP molecular markers can be used for rapid, efficient and accurate detection of goat genotypes when used for breeding fine traits in cashmere, so as to screen out dominant genotypes. Attached Figure Description

[0025] Figure 1 Scatter plot of KASP genotyping markers for the molecular marker g.93908315C>T. Detailed Implementation

[0026] The present invention will now be described in detail with reference to specific embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make various changes and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention.

[0027] Unless otherwise specified, all chemical substances, proteins, enzymes, or reagent kits used in this invention are commercially available.

[0028] Unless otherwise stated, the methods used in this invention, such as PCR amplification and RNA extraction, employ conventional experimental procedures in the field. These procedures can be performed with reference to commonly used experimental technical manuals or the operating instructions for commercially available reagent kits and instruments.

[0029] Example 1: Correlation analysis between cashmere fineness traits and SNPs.

[0030] The experimental animals in this study were 202 Hanshan white cashmere goats from the core group of the Hanshan white cashmere goat breeding farm in Bairin Right Banner, Chifeng City. Ear tip tissue samples were taken from the goats and DNA was extracted for subsequent research.

[0031] 1.1 Screening of SNP molecular markers related to cashmere fineness.

[0032] The whole genome of the Hanshan white cashmere goat was resequencing, and the resequencing data were then subjected to GATK variant detection. After quality control filtering (MAF < 0.05, deletion rate > 20%, heterozygosity > 50%, non-diallelic sites), a target SNP was identified at a C>T base mutation at 93908315 bp on chromosome 10 of the ARS1.0 reference genome (hereinafter referred to as g.93908315C>T). This site was significantly associated with the target trait (P = 3.06 × 10⁻⁶). -6 This can explain 9.91% of the phenotypic variation (marker R² = 0.09908).

[0033] 1.2 PCR amplification.

[0034] The PCR amplification reaction system consisted of 20 μL of DNA template, 0.5 μL each of forward and reverse primers, 10 μL of 2×Taq PCR Master Mix, and 8 μL of DDH2O. The PCR amplification conditions were as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 30 s, annealing for 30 s (annealing temperature 49.2℃), extension at 72℃ for 1 min, for a total of 34 cycles; and a final extension at 72℃ for 5 min, followed by storage at 4℃.

[0035] 1.3 Primer design.

[0036] Primers were designed based on the publicly available goat genome ARS1.0 reference sequence and the upstream and downstream sequences of the chromosomal location of the g.93908315C>TSNP site in the NCBI database. Specific amplification primers were designed using Primer Premier 5.0 (Table 1). Primer design followed these standards: product length 150-250 bp, annealing temperature (Tm) 50±5℃, GC content 40%-60%, avoiding hairpin structures, primer dimers, and non-specific amplification. Software analysis showed that the primers designed in this study had no hairpin structures, no primer dimers, and good specificity. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and their sequence information is as follows (Table 1).

[0037] Table 1 Primer sequence listing

[0038] 1.4 Genotyping.

[0039] Primers were designed for genotyping based on the upstream and downstream sequences of the chromosomal location of the g.93908315C>T SNP locus. Competitive allele-specific PCR (KASP) was used for genotyping in this study. KASP genotyping was performed by Sichuan Jielaimei Technology Co., Ltd. using a BIO-RAD instrument. Primers were synthesized by Guangzhou GOOD Biotechnology Co., Ltd. Specific primer information is shown in Table 2. Table 2. KASP primer information for SNP sites.

[0040] Prerequisites for genotyping: The DNA concentration of the sample was homogenized. Standard PCR was performed to determine the optimal temperature for primer selection before proceeding to the next step. The KASP genotyping reaction system (10 μL) consisted of: 3 μL DNA template, 5 μL FLU-ARMS 2×Mix, 0.5 μL forward and reverse primers, and 1.5 μL DDH2O. KASP amplification employed a two-step falling PCR method: first, pre-denaturation at 94℃ for 15 min; then, falling PCR was performed with a program of 94℃ denaturation for 20 s and 65℃ annealing for 60 s, for a total of 10 cycles (from the second cycle onwards, the temperature was decreased by 0.6℃ per cycle); followed by standard PCR with a program of 94℃ denaturation for 20 s and 49.2℃ annealing for 60 s, for a total of 30 cycles; finally, storage at 4℃ was performed.

[0041] The scatter plot results of KASP genotyping markers are as follows: Figure 1 As shown: This is a scatter plot of the g.93908315C>T molecular marker, where blue squares represent the CC genotype, yellow triangles represent the CT genotype, green circles represent the TT genotype, and black diamonds represent the blank control group.

[0042] The fineness trait records of the obtained Hanshan white cashmere goats were correlated with the above SNP locus genotyping results. The basalt frequency, allele frequency, heterozygosity (He), polymorphism information content (PIC), and effective allele number (Ne) of the SNP loci of Hanshan white cashmere goats were calculated using Microsoft Excel 2021 software. The Hardy-Weinberg equilibrium status of the SNP loci in the population was detected by chi-square test. A P>0.05 was considered to be in Hardy-Weinberg equilibrium.

[0043] 1.5 Population genetics analysis.

[0044] The results of population genetic analysis of SNP loci are shown in Table 3. The results show that the g.93908315C>T locus has three genotypes in the Hanshan white cashmere goat population: CC, CT, and TT. The heterozygosity distribution of SNP loci is 0.431, and the g.93908315C>T locus has a high heterozygosity in the Hanshan white cashmere goat population, indicating that the above locus has high genetic variation and great selection potential. The effective allele count is 1.758, indicating that the alleles are relatively evenly distributed in the population (1...).<NeS2)。g.93908315C> The T locus showed high polymorphism in the Hanshan white cashmere goat population (P>0.05). Furthermore, the g.93908315C>T locus was in Hardy-Weinberg equilibrium in the Hanshan white cashmere goat population (P>0.05), allowing for further correlation analysis with cashmere fineness.

[0045] Table 3 Population genetic parameters of SNP loci

[0046] 1.6 Correlation analysis with cashmere fineness.

[0047] Association analysis between SNPs and fineness in Hanshan White Cashmere Goats was conducted using a one-way linear model in SPSS 19. The model for the fineness trait is as follows: Yi jk = u + LSi + Gj + ei jk, where Yi jk is the phenotypic value of fineness, u is the population mean, LSi is the fixed effect of fineness, Gj is the fixed effect of genotype, and ei jk represents the random residual. Data are expressed as mean ± standard error. The results are shown in Table 4. The results show that the differences between the genotypes of the g.93908315C>T marker and the fineness trait are extremely significant (P<0.01). The fineness of the CC genotype is significantly lower than that of the TT and CT genotypes (P<0.01). Specifically, the fineness of the CC genotype is 1.387 µm lower than that of the CT genotype and 2.676 µm lower than that of the TT genotype. This indicates that the C allele at this locus is the dominant allele for reducing fineness, and the CC genotype is the dominant genotype. Therefore, the g.93908315C>T marker can be used for subsequent breeding of fineness traits.

[0048] Table 4. Results of the correlation analysis between SNPs and fineness of the fibers

[0049] Note: Different letters on the data indicate significant differences (P<0.01).

[0050] In summary, based on the association analysis results of SNPs and down fineness traits in Table 4, it is shown that the three genotypes of the g.93908315C>T marker showed significant differences in down fineness trait association analysis (P<0.01), which can be used for subsequent breeding research.

[0051] Example 2: Upstream and downstream nucleotide sequences of the g.93908315C>T molecular marker in the goat genome.

[0052] Based on the location of the g.93908315C>T molecular marker in the goat genome (at position 93908315 bp on chromosome 10), primers were designed for PCR amplification to obtain the upstream and downstream nucleotide sequences of the g.93908315C>T molecular marker in the goat genome (SEQ ID No:1): AGCTGGAACATGAATCTACAGGCTGTGATCATTAGATGCTAGAGTTAAACAAACCTTGCTTTACAATGTGGACAACAGAAGGAACTTTCATCTGTGCCATATAAATGCCCCATTGATATGATACAGTTACTCTACCAACATGATTTTATAAATAAAGACATGCTGTCAAACTGATTTGGTTCATCTCTACATTCCCACTTAACCAGTAGTCCAGATATATTGTTTAATAGACAACTTACTATTCTTAAAAAGTACTGTGGCCTTCCAGCCAAGATGGCATTTACAACAGGGATTTGGATTTATCTTCCCATCGAAATAATGATAACAACAAAAAAACCCAGACCAAATATACGAAAAAGCTGTTTTGAAGACACTGAATACTAGACAACAAAGGACAGAGATCCTGGTGGTAAAAAAAATCAAATGTGATGAGTCCTATGACTGCTTCTACCTTGCTGCCTGGAGAGTTTCTAAGCTGTGATGTAGGGAGGGAAAATGCAGGTGATACCCAGCAGACATCTTGAATTGAGGAGACACTGCTTAGAATTCAAGAAGACCAAAGAGACTACACTTTGCAGGATAGAGTCCCAGAGAGGAGAATGCTGTTCAGGGAGAGAACTGTAGAAATCTACTCAGGAATCCCCTCAAGGACTCAGCTGAGTACTGGTCACGACATGCACTGGAGGCTGGGAAAGGAACCACCTGAGAGGATTAGAGGTAACAGTACCTGAAGCTCACACAGCACGTAGAACAAAGCTGGTTCCGACAGGCCAGAGTGGAAACCCCCATGATTCGTGGGA Y[C / T]。

[0053] As shown in SEQ ID No:1, the Y at position 801 indicates a C>T base mutation. Primers can be designed using this nucleotide sequence to detect the genotype of the g.93908315C>T molecular marker, and then further selection can be made for cashmere fineness traits based on the detection results; alternatively, primers can be designed using this nucleotide sequence to create corresponding detection kits for direct detection of the g.93908315C>T molecular marker in goats, and then selection can be made for cashmere fineness traits based on the detected genotype.

[0054] Example 3: Application of the g.93908315C>T molecular marker in improving the fineness of cashmere.

[0055] 1) Detection of the g.93908315C>T molecular marker in replacement goats; 2) Select individuals with the CC genotype obtained in step 1) as breeding goats and mate them; 3) Test the individuals born from mating in step 2) for the molecular marker g.93908315C>T, retain the CC genotype individuals, and eliminate the CT or TT genotype individuals. Then breed them to cultivate the fine cashmere goat breed.

[0056] Example 4: Application of the g.93908315C>T molecular marker in improving the fineness of cashmere.

[0057] 1) Detection of the g.93908315C>T molecular marker in replacement goats; 2) Select individuals with the CC genotype obtained in step 1) as breeding goats and breed them. 3) Detect the g.93908315C>T molecular marker in the individuals born from mating in step 2), retain the CC genotype individuals, and breed and select the CC genotype individuals again to retain the CC genotype individuals in the offspring goats, and eliminate the CT and TT genotypes, so as to increase the frequency of the dominant allele C in each generation, thereby improving the fineness of the cashmere of the goat population and improving the fineness of the cashmere of the offspring goat population.

[0058] Example 5: Application of the g.93908315C>T molecular marker in evaluating the fineness of cashmere. When the g.93908315C>T molecular marker was detected in the goats to be evaluated, the goats to be evaluated had fine down properties when the detected genotype was CC; when the genotypes were CT and TT, the fine down properties of the goats to be evaluated were not high.

[0059] Example 6: Application of the g.93908315C>T molecular marker in screening cashmere fineness traits.

[0060] When testing goats for selection using the molecular marker g.93908315C>T, if the detected genotype is CC, the goat to be selected has good cashmere fineness and is retained as a reserve breeding goat; if the genotype is CT or TT, the goat to be selected has poor cashmere fineness and is culled.

[0061] The above descriptions are merely some embodiments of the present invention. For those skilled in the art, various modifications and improvements can be made without departing from the inventive concept of the present invention, and all such modifications and improvements fall within the scope of protection of the invention.

Claims

1. The application of products containing SNP molecular markers in the breeding of fine cashmere goat breeds, among which, The SNP molecular marker is a C>T base mutation located at 93908315 bp on chromosome 10 of the goat genome ARS1.0 version. The goat is the Hanshan White Cashmere Goat. The application includes the following steps: S1: Detect the SNP molecular markers in replacement goats; S2: Select individuals with the CC genotype detected in step S1 as breeding goats and breed them. S3: Test the SNP molecular markers of the individuals born from mating in step S2, retain the CC genotype individuals, and eliminate the CT or TT genotype individuals. Then, breed them to cultivate the fine cashmere goat breed.

2. Application of products containing SNP molecular markers in improving the fineness of cashmere, among which, The SNP molecular marker is a C>T base mutation located at 93908315 bp on chromosome 10 of the goat genome ARS1.0 version. The goat is the Hanshan White Cashmere Goat. The application includes the following steps: S1: Detect the SNP molecular markers in replacement goats; S2: Select individuals with the CC genotype detected in step S1 as breeding goats and breed them. S3: Detect the SNP molecular markers of the individuals born from mating in step S2, retain the CC genotype individuals, and breed and select the CC genotype individuals again to retain the CC genotype individuals in the offspring goats, while eliminating the CT and TT genotypes, so as to increase the frequency of the dominant allele C in each generation, thereby improving the fineness of the cashmere in the goat population and improving the fineness of the cashmere in the offspring goat population.

3. The application of products containing SNP molecular markers in evaluating or screening cashmere fineness traits, among which, The SNP molecular marker is a C>T base mutation located at 93908315bp on chromosome 10 of the goat genome ARS1.0 version. The goat is the Hanshan White Cashmere Goat. The application includes the following steps: detecting the SNP molecular marker in the goats to be evaluated or screened. If the allele is CC, the goat has the low cashmere fineness trait and is retained; otherwise, it is culled.

Images