Non-transgenic herbicide-resistant new brassica juncea germplasm breeding method and application thereof

Abstract

The application discloses a non-transgenic herbicide-resistant mustard new germplasm cultivation method and application thereof, and comprises the following steps: taking non-transgenic herbicide-resistant Brassica napus as a male parent, taking mustard as a female parent, performing artificial pollination distant hybridization, and harvesting hybrid F1 seeds; the hybrid F1 seeds are sowed one by one, and after cultivation to the three-leaf stage, the resistant F1 single plants are screened by combining herbicide spraying identification and molecular identification, specific primer amplification of gene fragments is performed, and sequencing is carried out; the resistant F1 single plants are taken as female parents, and the mustard is taken as a male parent to perform backcrossing, and the resistant single plants are screened through repeated backcrossing; the single plants with mutation genes and consistent phenotypes are screened through selfing and sowing, and the non-transgenic herbicide-resistant mustard new germplasm with genetic stability is screened after seed setting through open pollination. Further, the new germplasm is used for hybridization with other mustard varieties, and the herbicide-resistant traits are transformed, so that the new mustard variety can obtain the non-transgenic herbicide-resistant characteristics, and the actual industrial demand can be better met.

Description

Technical Field

[0001] This invention relates to the field of crop germplasm innovation and breeding technology, specifically to a method for cultivating new non-GMO herbicide-resistant mustard germplasm and its application. Background Technology

[0002] Mustard greens (Brassica juncea L., 2n = 36, AABB) are allotetraploids formed by the doubling of the cross between Chinese cabbage (Brassica rapa L., 2n = 20, AA) and black mustard (Brassica nigra L., 2n = 16, BB). They are also one of the constituent species of the "Yu's Triangle" of the Brassica genus in the Brassicaceae family. Over its long cultivation history, it has evolved into a variety of functional cultivars and is a multi-purpose crop with wide industrial coverage and high economic value. As an oilseed crop, mustard greens, also known as mustard-type rapeseed, are one of the world's three major rapeseed cultivation varieties. my country's annual rapeseed planting area is about 100 million mu (of which mustard-type rapeseed accounts for about 5 million mu), with an annual rapeseed production of about 15 million tons. Rapeseed oil accounts for more than 20% of the domestic edible vegetable oil consumption, and domestically produced rapeseed oil accounts for 40-50% of the total domestic vegetable oil production, playing a crucial role in ensuring the safety and supply of agricultural products. Mustard-type rapeseed originated in western and northwestern my country and has rich genetic diversity. Although its yield is slightly lower than that of Brassica napus, it has excellent traits such as drought resistance, tolerance to poor soil, resistance to pod cracking, and pure yellow seeds. Moreover, because it belongs to the same Brassica genus of the Brassicaceae family and is a species constituting the "Yu's triangle" as Brassica napus, it has natural hybridization affinity. Its superior traits (genes) can be used for genetic improvement of Brassica napus through distant hybridization. As a vegetable crop, mustard greens have diversified into four major categories and 16 varieties, including leaf mustard, stem mustard, root mustard, and bud mustard, encompassing multiple subtypes such as sauerkraut, Fuling pickled mustard, large-headed mustard, and bud mustard, making it an important vegetable category worldwide. Simultaneously, mustard greens are also widely cultivated as a condiment crop in Europe, America, and Asia. In my country, the planting area of ​​various types of mustard greens exceeds 20 million mu (approximately 1.3 million hectares), with an output value exceeding 60 billion yuan. Weeds are one of the major biological disasters threatening crop production. Chemical weeding, due to its cost-effectiveness and high efficiency, has become an objective requirement and development trend in modern agricultural production. However, as a broadleaf plant of the cruciferous family, mustard greens are highly sensitive to herbicides. Even the two broadleaf herbicides commonly used in closely related crops, dichloropyridine and glyphosate, cannot be applied to mustard greens. Currently, no herbicides are registered for use on mustard greens, making weed control in mustard green fields difficult to solve through modern methods and urgently requiring technological breakthroughs. Currently, efficient weed control in fields is mainly achieved through the "planting of genetically modified herbicide-resistant crops + spraying of herbicides" model. This model has become one of the main measures to enhance the international competitiveness of agricultural products. However, genetically modified herbicide-resistant crops have not yet been produced on a large scale. Domestically, non-genetically modified rapeseed germplasm resources resistant to acetolactate synthase (AHAS) inhibitors have been successfully developed, and the herbicide-resistant rapeseed varieties cultivated are widely favored by the market. A new weed control model of "non-genetically modified herbicide-resistant varieties + chemical weeding" has been successfully established, providing a demonstration model for the modernization of crop production in my country.In production practice, both mustard-type rapeseed and vegetable mustard face serious weed threats. Creating new non-GMO herbicide-resistant mustard germplasm and breeding new non-GMO herbicide-resistant mustard varieties are prerequisites for establishing a new weed control model for mustard fields. This invention is proposed to solve this problem, achieve efficient weed control in mustard fields, and help growers save costs, increase efficiency, and increase income. Summary of the Invention

[0003] This invention aims to solve the long-standing problem of weed control in mustard production. Through distant hybridization technology, a non-transgenic herbicide resistance trait controlled by endogenous genes from the closely related species Brassica napus (Brassica napus) is precisely introduced into the mustard genome, enabling the mustard to acquire stable resistance to specific herbicides. After obtaining genetically stable, non-transgenic herbicide-resistant mustard germplasm, it can be used as an excellent donor for hybridization breeding with various mustard varieties, achieving efficient transfer of herbicide resistance traits in mustard germplasm resources, thereby cultivating new varieties suitable for different production uses.

[0004] When these non-GMO herbicide-resistant mustard varieties are applied to field production, the corresponding herbicides can be sprayed directionally in the early stages of seedling growth (such as the two-leaf to three-leaf stage) to effectively kill associated weeds in the field, completely solving the technical bottleneck of weed control in mustard fields. This not only ensures that mustard crops receive sufficient light, temperature, and soil nutrients, eliminating growth inhibition caused by weed competition and achieving healthy and rapid plant growth, but also significantly reduces labor and material inputs in the production process, significantly improving the economic benefits and modernization level of the mustard industry.

[0005] To achieve the above objectives, the technical solution provided by the present invention is as follows: The first aspect of this application provides a new non-GMO herbicide-resistant mustard germplasm, its breeding method, and its application, including the following steps: S1: Using non-GMO herbicide-resistant rapeseed as the male parent and mustard as the female parent, artificial pollination and distant hybridization were carried out to harvest hybrid F1 seeds; S2: Single-seed hybrid F1 plants were sown and cultured to the three-leaf stage. Resistant F1 plants were screened using a combination of herbicide spraying identification and molecular identification. The molecular identification involved amplifying the Bn.A1.AHAS3 gene fragment using specific primers and sequencing the sequence. The specific primer sequences are as follows: Forward primer AAAGCTCGAGGCGTTTGCG, Reverse primer CCAAATTACCACACAAAAGAAACTGA; S3: Backcross with resistant F1 plants as the female parent and mustard as the male parent to harvest BC1 seeds; repeat backcrossing to the BC5 generation, and use the method in step S2 to screen for resistant plants in each generation. S4: The BC5 generation resistant single plants were bagged and self-crossed to harvest BC5F2 seeds. After sowing, the seeds were identified by herbicide spraying and molecular identification. Single plants with the Bn.A1.AHAS3 mutant gene and consistent phenotype were screened. After open pollination and fruit setting, genetically stable non-transgenic herbicide-resistant new mustard germplasm was obtained.

[0006] To optimize the above technical solution, the specific measures also include: In steps S1 and S3, artificial pollination involves repeated pollination with the same recipient stigma and pruning of excess branches and inflorescences to improve the hybridization seed setting rate; the mustard pods are harvested promptly after turning yellow to avoid seed loss due to pod splitting.

[0007] Preferably, in step S2, the spraying concentration of the herbicide is 40-60% of the field recommended concentration.

[0008] In step S2, the herbicide is bensulfuron-methyl; the criteria for herbicide spraying identification are as follows: one week after spraying bensulfuron-methyl, mark the single plant whose central leaves turn obviously yellow; if the central leaves wither after two weeks, it is determined to be a non-resistant single plant; if the central leaves recover and turn green, it is determined to be a resistant single plant.

[0009] The second aspect of this application provides a new non-GMO herbicide-resistant mustard germplasm, which is cultivated using the above-mentioned cultivation method. The new non-GMO herbicide-resistant mustard germplasm is rapeseed seed 47072 (Brassicajuncea L), which is deposited at the China Center for Type Culture Collection (CCTCC) on March 3, 2026, with accession number CCTCC NO: P202604.

[0010] The genome of the non-transgenic herbicide-resistant mustard germplasm integrates the Brassica napus Bn.A1.AHAS3 mutant gene. A single base mutation from G to T occurs at the +1667 base position in the CDS region of this gene, resulting in the Trp-556-Leu mutation in the encoded Bn.A1.AHAS3 protein.

[0011] The new non-GMO herbicide-resistant mustard germplasm is resistant to AHAS inhibitor herbicides.

[0012] Furthermore, the AHAS inhibitor herbicides include sulfonylureas, imidazolinones, triazolopyrimidines, pyrimidine oxy(thio)benzoates, and sulfonamide carbonyl diazolinones.

[0013] The third aspect of this application provides an application of a new non-GMO herbicide-resistant mustard germplasm, characterized in that the new non-GMO herbicide-resistant mustard germplasm obtained by the above-mentioned breeding method is used as a herbicide resistance trait donor, and is hybridized, backcrossed or self-crossed with high-yielding mustard varieties used in production. Through herbicide spraying identification and molecular identification screening, a new non-GMO herbicide-resistant mustard variety is bred.

[0014] The mustard varieties used in the production include any one of vegetable mustard, mustard-type rapeseed, and seasoning mustard; the vegetable mustard includes any one of leaf mustard, stem mustard, root mustard, and bud mustard.

[0015] Compared with the prior art, the beneficial effects of the present invention are: The method of this invention can obtain non-GMO herbicide-resistant mustard greens. These mustard greens possess specific non-GMO herbicide resistance and can be used as high-quality mustard germplasm resources for the breeding of new non-GMO herbicide-resistant mustard varieties. When the bred non-GMO herbicide-resistant mustard varieties are applied to actual production, they exhibit significant advantages compared to similar mustard varieties without herbicide resistance, and the core invention is highlighted: Firstly, this invention pioneered a technology for creating non-GMO herbicide-resistant mustard mediated by distant hybridization, significantly overcoming the challenge of cross-species hybridization using species with fewer chromosomes as the female parent and species with more chromosomes as the male parent. While hybridization with species having more chromosomes is generally more successful, this method uses mustard (with fewer chromosomes) as the female parent and rapeseed (with more chromosomes) as the male parent, making this hybridization combination extremely difficult. By optimizing the pollination method, this invention successfully overcomes the technical bottleneck of poor hybridization compatibility and low seed setting rate between the two species, providing a replicable paradigm for the non-GMO resistance trait transfer among closely related species in the Brassica genus. Simultaneously, applying appropriate doses of specific herbicides during the seedling stage of new mustard varieties effectively kills accompanying weeds in the field. Compared to traditional varieties, this significantly reduces the cost of manual weeding, and the method is low-cost, fast-acting, and highly effective.

[0016] Secondly, this invention addresses the challenge of accurate molecular identification under homologous gene interference. The primer design presented two major difficulties: first, the Brassica napus BnAHAS gene family has numerous members with extremely high homology, and also shares high sequence homology with the BjAHAS gene in mustard, easily leading to non-specific amplification and identification interference; second, it requires precise differentiation between the target gene carrying the resistance mutation and other homologous genes to avoid misidentification of endogenous homologous genes in mustard. This invention, through sequence alignment screening of differential sites and extensive primer combination testing, ultimately developed specific primers that specifically amplify the target mutant gene. Combined with a dual phenotypic and molecular identification system, this completely solves the homologous gene interference problem, enabling the screening of herbicide-resistant genes, avoiding screening misidentification, and significantly improving breeding efficiency. Simultaneously, timely weed removal allows mustard seedlings to more fully absorb light, temperature, and soil nutrients, escaping weed competition and achieving healthy and rapid growth.

[0017] Thirdly, the establishment of a stable germplasm creation pathway of "backcrossing + self-pollination homozygosity" effectively solves the industry pain points of easy segregation of traits and poor genetic stability in distant hybrid offspring, successfully obtaining a new genetically stable non-GMO herbicide-resistant mustard germplasm. This scheme gradually restores the original genetic background of mustard through multiple generations of continuous backcrossing, effectively eliminating interference from non-target genes in rapeseed. Then, through dual screening of bagged self-pollination and open pollination, single plants carrying herbicide-resistant mutant genes with consistent phenotypes were identified, clearly confirming that the resistance trait is controlled by a single dominant gene, which can be stably inherited and bred, completely filling the industry gap in non-GMO herbicide-resistant mustard germplasm resources. At the same time, the resistance of this new mustard variety originates from endogenous genes and does not involve any transgenic technology or related components, fundamentally eliminating concerns about ecological safety and fully complying with domestic agricultural production policies and ecological safety requirements.

[0018] Fourth, the system clearly defines the herbicide resistance spectrum of the new germplasm and formulates a weeding program suitable for large-scale field production, completely breaking through the technical bottleneck of the lack of registered herbicides available in mustard fields and the difficulty in controlling broadleaf weeds. Through targeted experiments, this program clarifies that this non-GMO herbicide-resistant new mustard germplasm is resistant to multiple AHAS inhibitor herbicides, making it suitable for different field weed scenarios. Combined with seedling spraying programs, it can effectively kill associated weeds in the field (especially difficult-to-control broadleaf weeds) without adversely affecting the growth of mustard seedlings. Compared with traditional manual weeding methods, it not only significantly reduces weeding costs and improves weeding efficiency but also avoids damage to mustard seedlings caused by manual weeding. This provides key technical support for large-scale, modernized mustard production in the field and effectively solves the long-standing problem of weed control in the mustard industry.

[0019] Fifth, a complete breeding and application system will be constructed. After the successful creation of a new non-GMO herbicide-resistant mustard germplasm, this application can use the new germplasm as a donor of herbicide resistance traits and continue to hybridize and backcross with high-yielding mustard varieties used in production. Through screening and breeding, new herbicide-resistant high-yielding mustard varieties controlled by a single dominant gene and genetically stable can be obtained. This not only meets domestic policy and ecological safety requirements, but also fills the gap in herbicide-resistant high-yielding mustard varieties. At the same time, such new mustard varieties with novel resistance can provide seed companies that operate this variety with a distinct product selling point, significantly enhance their market competitiveness, and help the high-quality and efficient development of the mustard industry. Attached Figure Description

[0020] Picture 1 The siliques on a single female plant after a distant hybridization of rapeseed (male parent) and mustard (female parent).

[0021] Picture 2 Herbicide resistance screening of parent plants and F1 generation. Figure 1 shows the growth of parent seedlings without bensulfuron-methyl spray; Figure 2 shows the growth of parent seedlings 2 weeks after bensulfuron-methyl spray; Figures 3 and 4 show the growth of F1 seedlings 2 weeks after bensulfuron-methyl spray.

[0022] Picture 3 : CDS region sequence alignment of the acetolactate synthase BnAHAS1 and BnAHAS3 genes in Brassica napus. The boxes indicate the base mutation positions of the BnAHAS1 and BnAHAS3 genes that can induce resistance to SU herbicides in rapeseed (calculated using the corresponding amino acid sequence of AHAS in the model plant Arabidopsis thaliana, referred to as the 574th position, hereinafter the same).

[0023] Picture 4 CDS sequence alignment of the genes BnAHAS1 and BnAHAS3, acetolactate synthases from Brassica napus, and the two functional genes BjAHAS1 and BjAHAS3, acetolactate synthases, from the genome of Mustard greens.

[0024] Picture 5 : Representative sequencing (forward sequencing) peaks of materials with different genotypes at the 574 site. The dashed line in the figure represents the 574 mutation site.

[0025] Picture 6 Herbicide resistance screening of seedlings from the BC1 generation segregating population. Red boxes represent the phenotype of non-resistant individual plants, and white boxes represent the phenotype of resistant individual plants.

[0026] Picture 7 Phenotypic characteristics of herbicide-sensitive parent plants, Liyang bitter lettuce, and herbicide-resistant mustard 47072, at the two-leaf stage after two weeks of treatment with five different subclasses of AHAS inhibitor herbicides.

[0027] Picture 8Phenotype of non-GMO herbicide-resistant F1 hybrid mustard seedlings after two weeks of treatment with 1X bensulfuron-methyl (a subclass of AHAS inhibitor herbicides) for weed control in field production. Detailed Implementation

[0028] The present invention will be further described in detail below through specific embodiments, but it should not be construed as limiting the scope of the subject matter of the present invention to the following embodiments. All technologies implemented based on the above content of the present invention fall within the scope of the present invention.

[0029] This invention addresses the prominent challenges of difficult weed control and high weeding costs in the production of all mustard cultivars containing the AABB genome (including various types of vegetable mustard, mustard-type rapeseed, and seasoning mustard). Through intraspecific hybridization within the Brassica genus, this invention precisely introduces non-transgenic herbicide resistance traits controlled by endogenous genes from closely related species into the mustard genome, successfully obtaining genetically stable non-transgenic herbicide-resistant mustard germplasm. Based on this, the newly created germplasm is used as a donor for the herbicide resistance trait and crossbred with various widely used mustard varieties to cultivate new mustard varieties with stable resistance to specific herbicides. When applied to actual production, these new non-transgenic herbicide-resistant mustard varieties allow for the early application of specific herbicides to the seedlings. This effectively kills associated weeds (especially difficult-to-control broadleaf weeds) without adversely affecting the growth of the mustard itself, thus completely solving the pain points of weed control in the mustard industry, effectively reducing planting costs, and contributing to the high-quality and efficient development of the mustard industry.

[0030] The specific implementation steps of this plan are as follows: I. Acquisition of new non-GMO herbicide-resistant mustard germplasm In 2018, my country's first non-GMO herbicide-resistant rapeseed variety, Ning R101 (variety registration number: GPD rapeseed (2018) 320256), was registered and began demonstration planting in rapeseed producing areas of Jiangsu Province. The herbicide resistance of Ning R101 originates from its endogenous genes. Bn.C1.AHAS1 and Bn.A1.AHAS3 One point mutation occurred, specifically a single-base mutation from G to T at both the +1676 and +1667 base positions in the CDS region, resulting in the Trp-559-Leu mutation in the Bn.C1.AHAS1 protein and the Trp-556-Leu mutation in the Bn.A1.AHAS3 protein. Both mutations can induce resistance to sulfonylurea herbicides, and the simultaneous presence of both mutant genes can achieve a resistance strength of 6 times or more of the recommended herbicide concentration.

[0031] In the spring of 2018, during the rapeseed flowering period, artificial pollination and hybridization were conducted using the non-GMO herbicide-resistant rapeseed variety Ning R101 as the male parent and the mustard cultivar Liyang bitter lettuce as the female parent. Based on previous understanding of the hybridization compatibility between rapeseed and mustard, it was expected that both would have very poor seed setting but produce a very small number of seeds. The applicant employed various methods, including repeated pollination with the same recipient stigma, pruning of excess branches and inflorescences, and maximizing hybridization of individual parent plants. The results showed that the hybridization of the two had relatively poor seed setting, averaging approximately one seed per silique (see...). Picture 1 Harvest the mustard pods promptly at maturity to obtain F1 seeds from a distant hybrid of rapeseed and mustard. Mustard pods exhibit strong pod-opening behavior upon maturity, and are ready for harvest when they turn yellow. In the autumn of 2018, the recipient parent, *Liyang bitter lettuce*, and the hybrid F1 seeds were sown individually in 50-cell seed trays filled with nutrient soil. After germination, the hybrid F1 seeds were carefully managed and continued to grow until the three-leaf stage. Hybrid authenticity was then determined using two methods.

[0032] The first method involves determining survival after application of a specific herbicide. Bensulfuron-methyl (a common sulfonylurea herbicide, such as Kuanxing®, 10% bensulfuron-methyl wettable powder, produced by Jiangsu Kuida Agrochemical Co., Ltd.) was used as a resistance screening agent. A working solution was prepared at half the recommended concentration and then sprayed onto hybrid seedlings at the three-leaf stage. The phenotypes of the mustard parent plants after spraying or not spraying were used as controls (see...). Picture 2 The method for visually observing seedling damage is as follows: Approximately one week after herbicide spraying, check the seedling phenotype. Using untreated mustard parent seedlings as a control, mark any seedlings with noticeably yellowed central leaves with a bamboo stick. Observe again two weeks after herbicide spraying. If the central leaves of the seedlings marked with bamboo sticks have withered, they are considered non-resistant and can be removed. If the previously yellowed central leaves have recovered and turned green, it is considered minor herbicide damage and can be identified as resistant. At this time, resistant F1 seedlings can be transplanted with soil into 30 cm diameter pots to continue growing.

[0033] The second method involves molecular identification of individual plants initially identified as resistant. This involves further determining whether the individual plant's genome contains resistance genes to avoid phenotypic misjudgments caused by missed herbicide application. The prerequisite for molecular identification is the design of a correctly designed gene targeting only the endogenous genes of Brassica napus. Bn.C1.AHAS1 and Bn.A1.AHAS3 The specific primers. There are two main challenges with these primers: firstly, they need to target specific primers... Bn.C1.AHAS1 and Bn.A1.AHAS The design was based on mutation sites of 3 genes, while also considering the mutation sites of Brassica napus. BnAHAS It is also quite complex; secondly, it is necessary to avoid [the following] within the mustard genome. BjAHAS Interference from homologous genes.

[0034] Regarding the first challenge, the Brassica napus genome contains five homologous genes. BnAHAS Genes, among which BnAHAS2- 4 Located in subgenome A, while BnAHAS1 and BnAHAS5 It is located in the C subgenome. From a gene function perspective, BnAHAS4 and BnAHAS5 It is a pseudogene. Bn.C1.AHAS1 (C1 chromosome) and Bn.A1.AHAS3 (Chromosome A1) contains constitutively expressed highly homologous (98%) genes. BnAHAS2 (Chromosome A5) is a flower bud-specific gene, and... Bn.C1.AHAS1 and Bn.A1.AHAS3 The homology is low. Therefore, it can be concluded that... Bn.C1.AHAS1 (C1 chromosome) and Bn.A1.AHAS3 (Chromosome A1) The two genes showed high homology. Sequence alignment revealed that the main differences between the two homologous gene DNA sequences (downloaded from NCBI, gene numbers Z11524 and Z11526) were: 39 SNP differences, one consecutive two-base difference, and one difference in the presence or absence of a 9-base pair (see [link to relevant documentation]). Picture 3 Since the mutation sites of these two genes are also SNP mutations, it can be predicted that designing a method targeting the differences in SNP mutation sites will be very difficult.

[0035] Regarding the second challenge, there are four homologous genes in the mustard genome. BjAHAS Genes. The mustard reference genome was downloaded from http: / / brassicadb.cn / # / BjAHAS Gene sequencing revealed that mustard (AABB, 2n=36) has 4 genes. BjAHAS The genes are located on chromosomes A1, A6, B2, and B5, respectively. Two genes are located on chromosomes A6 and B2. BjAHAS These genes are non-functional due to incomplete functional domains (lacking the large subunit of acetolactate synthase). These two genes share very low homology (approximately 77%) with two other functional genes. [The following sentence appears unrelated and likely refers to a different gene:] The genes located on chromosome A1... Bj.A1.AHAS3 and located on chromosome B5 Bj. B5 .AHAS1 Comparison of the CDS sequences of two fully functional homologous genes revealed that the former had a 9bp deletion (CCTTCCCCT) at 180bp. Sequence alignment revealed... Bj.A1.AHAS3 and Bn.A1.AHAS3 More of the same origin, and Bj.B5.AHAS1 Genes and Bn.C1.AHAS1 More of the same origin (see Picture 4 ).

[0036] The following approaches were adopted in the primer design process.

[0037] One approach involves designing primers based on the base differences at the SNP mutation site. The SNP is used as the 3' end of the designed primer for amplification. However, because there is only one base difference at the 3' end, even with adjustments to parameters such as annealing temperature, template concentration, and extension time, specific amplification cannot be achieved during PCR amplification. Bn.C1.AHAS1 and Bn.A1.AHAS3 The gene fragment was not found, therefore this approach failed.

[0038] Second, CAPS primers were designed to differentiate the mutation site by incorporating it into the restriction enzyme cleavage site. Specific sequences of restriction endonucleases were searched for around the mutation site, and it was found that the sequence containing the mutated base, "GCAATG," is precisely the recognition site of the restriction endonuclease BsrDI. However, comparison... Bn.C1.AHAS1 and Bn.A1.AHAS3 Gene sequencing revealed that the two genes had identical base sequences within the first 100 bp and last 150 bp surrounding the mutated base. This meant that even if the mutation site could be recognized by restriction endonucleases, the identical sequences of the two homologous genes prevented them from being separated, thus rendering the proposed approach ineffective.

[0039] Third, the homologous gene fragments containing mutated bases were first separated, and then the mutated bases were identified. Based on this idea, the mutated bases were first targeted, and the sequences were expanded forward and backward from the mutated bases. Primers were designed to identify the differences between the two homologous genes upstream and downstream, hoping to obtain fragments containing the mutated bases of each gene through PCR amplification. The applicant designed primers using SNPs from upstream and downstream sequences, using the difference SNP between the two homologous genes as the last base at the 3' end of the primer, and also attempted to artificially change the penultimate base at the 3' end to create stronger PCR amplification differences. After testing hundreds of upstream and downstream primer combinations and sequencing the amplification products, the primers that could amplify the mutated bases were finally selected. Bn.C1.AHAS1 and Bn.A1.AHAS3 Specific primers for gene fragments are used, with the mutation sites of interest contained within the amplified specific fragment. The two primers are: 0531-4-F: AAAGCTCGAGGCGTTTGCG; 0531-6-R: CCAAATTACCACACAAAAGAAACTGA. Using this pair of primers, specific amplification can be achieved. BnAHAS3 The target gene fragment is then analyzed using Sanger sequencing to determine whether the mutation site contains the sensitive wild-type G (reverse sequencing shows C), the resistant homozygous mutant T (reverse sequencing shows A), or the resistant heterozygous mutant G / T (reverse sequencing shows C / A). (See...) Picture 5 This successful primer pair involved a significant amount of work and a substantial investment of effort from the applicant.

[0040] In 2019, during the flowering period, artificial pollination and backcrossing were continued using the resistant F1 variety as the female parent and the mustard parent as the male parent. Seed setting remained relatively poor, with approximately 1-2 seeds per silique. Seeds from the backcross BC1 variety were harvested promptly at maturity. BC1 seeds were then sown individually in 50-cell seed trays filled with nutrient soil. Each BC1 progeny group was planted with at least 50 plants. After germination, when the seedlings reached the 3-leaf stage, the aforementioned herbicide was applied (see...). Picture 6 The resistant BC1 plants were identified using both herbicide application and molecular identification methods. The selected resistant BC1 plants were carefully managed and backcrossed with the original mustard parent after flowering to obtain BC2 generation seeds. The same two methods (herbicide application and molecular identification) were used for identification. Backcrossing continued from BC2 generation to BC5 generation. After selecting resistant BC5 generation plants, they were self-pollinated individually at flowering time, and self-pollinated siliques were harvested. BC5 generation plants showed significantly better silique setting, with approximately 10-12 seeds per plant. The following year, BC5F2 generation seeds were harvested individually. These BC5F2 generation seeds were then sown individually and identified using both herbicide application phenotypic and molecular identification methods. Plants exhibiting herbicide application characteristics were then selected. Bn.A1.AHAS3 Single plants with the mutated gene were transplanted, along with several plants that showed the closest phenotype, into the breeding field for close proximity to planting. During the flowering period, these plants were covered with tents and assisted with pollination by bumblebees. A large quantity of seeds were harvested at maturity, and in 2022, eight seeds carrying the mutated gene were obtained. Bn.A1.AHAS3 A mustard line with a mutated gene and a genetic background of Liyang bitter mustard.

[0041] II. Identification of the genetic stability of non-GMO herbicide-resistant mustard germplasm The above 8 with BnAHAS3 New mustard green lines with mutated genes and a genetic background of Liyang bitter lettuce (hereinafter referred to as "new mustard green lines") were numbered. Seeds of each number were sown individually in 50-cell trays, with at least 100 plants per number. The original parent, Liyang bitter lettuce, was sown in the same manner and carefully managed until the three-leaf stage for herbicide resistance identification. The two identification methods described above were used for identification.

[0042] From this point onward, the phenotype of each numbered plant was carefully observed, and growth uniformity and characteristics were recorded. During the flowering period, at least five individual plants of each number were bagged and self-pollinated. After flowering, during the pod-opening stage, samples were taken from the pods, the number of seeds per pod was counted, and the self-pollination fertility of each number was compared (see Table 1). For the other unbagged individual plants within each number, which underwent open pollination and fertilization under natural conditions, samples were also taken from the pods during the pod-opening stage, the number of seeds per pod was counted, and the natural fertility of each number was compared (see Table 1).

[0043] Table 1. Statistics on seed setting of new mustard green strains and their parent, Liyang bitter lettuce.

[0044] During the flowering period, a resistance conversion test was also conducted, namely the hybridization fruit set and the herbicide resistance of the hybrid offspring. Using bagged single plants of each line as one of the parents, the vegetable mustard varieties Ningbo Fine Leaf Yellow Seed Snow Cabbage and Golden Silk Mustard (Zhejiang Agricultural Sciences, 2019, 60 (10): 1816-1817) and two mustard-type rapeseed varieties Qingjie Oil No. 1 (registration number: GPD Rapeseed (2024) 630306) and Chuanyou 56 (registration number: GPD Rapeseed (2018) 510080) were used as the second parents for pairwise reciprocal hybridization. After hybridization and pollination, the plants were covered with non-woven bags. After 3 weeks, the bags were removed, and the pods were cut off when they turned yellow. The number of seeds in each pod was counted to obtain the F1 seeds of each pair of hybrids. The following year, each F1 seed was planted individually in 50-cell trays, with at least 10 seedlings planted for each number. The resistant parents (i.e., the new mustard lines) and non-resistant parents of each combination served as controls. Herbicide resistance was tested at the three-leaf stage using the same method described above, with all parents and F1 seedlings sprayed. Seedling growth was checked after 3 weeks, and the resistance percentages of all parents and F1 seedlings were recorded.

[0045] Based on the comprehensive analysis of data on self-pollination settling, natural settling, and resistance of F1 hybrids, strain number 47072 was selected as the optimal strain. After harvesting its seeds, they were sent to the China Center for Type Culture Collection (CCTCC, Wuhan University) for preservation, with the preservation number CCTCC NO: P202604.

[0046] Molecular tests were performed on strain 47072, including the following aspects: (1) Detection of mustard's own BjAHAS The presence of genes. This was determined by downloading the mustard reference genome from http: / / brassicadb.cn / # / and utilizing... BnAHAS The gene sequence was BLASTed on the mustard reference genome to obtain the mustard seed. BjAHAS The sequences of the four homologous genes. BjAHAS Gene sequence and rapeseed BnAHAS1 and BnAHAS3 Gene sequences were compared and designed BjAHAS Gene sequence-specific primers. As for Brassica napus... BnAHAS1 and BnAHAS3 The gene sequence has been described in detail in other patents (application numbers CN201911014516 and 201310111739.5). PCR amplification was performed using genomic DNA from strain 47072 as a template. The results showed that... BjAHAS Gene sequence-specific primers and rapeseed BnAHAS Gene sequence-specific primers produce varying amplification results, but the results show that they can amplify the gene sequence. BnAHAS3 and Bj.B5.AHAS1 The gene sequence failed to be amplified. BnAHAS1 Genes and mustard greens Bj.A1.AHAS3 The sequence indicates that through distant hybridization, Brassica napus... Bn.A1.AHAS3 The chromosomal segment containing the gene has a high homology with mustard. Bj.A1.AHAS3 Homologous recombination occurred in the gene fragment. (2) Whole-genome resequencing was performed on 47072 strains, and the sequencing reads were compared with the reference genome (dwarf yellow) to generate a BAM format alignment file. Subsequently, SNP detection was performed using the GATK process to extract homozygous variant genotype (1 / 1) loci and draw a heatmap of SNP density distribution. Analysis revealed that the A1 chromosome of mustard originally had Bj.A1.AHAS3 The region integrates a 7Mb segment of the Brassica napus genome (including...) BnAHAS3 (Mutated gene). Furthermore, in mustard greens... Bj.AHAS The chromosomal regions (A1 and A4) where the line was located also showed infiltration of genomic fragments from the parental Brassica napus. This indicates that line 47072 was based on the Mustard genome, with several Brassica napus genomic fragments infiltrating through distant hybridization, but the infiltrated genomic fragments accounted for only 1.9% of the entire genome. Therefore, line 47072 remains phenotypically and genetically consistent with Mustard, retaining the genetic characteristics of Mustard.

[0047] Resistance identification of non-GMO herbicide-resistant new mustard germplasm to specific herbicides: Given that the herbicide resistance of 47072 is based on mutations BnAHAS Genetically produced, AHAS enzymes are the target enzymes of plant AHAS inhibitor herbicides. This class of herbicides has five subclasses: in addition to sulfonylureas (SU), there are imidazolinones (IMI), triazolidinediones (TP), pyrimidine oxybenzoates (PTB), and sulfonamide carbonyl diazolinones (SCTs). Representative commercial herbicides from each of the five subclasses were selected: bensulfuron-methyl (Kuanxing®, 10% bensulfuron-methyl wettable powder, produced by Jiangsu Kuida Agrochemical Co., Ltd.) as the SU class representative; imidacloprid (5% imidacloprid aqueous solution, produced by Shandong Xianda Agrochemical Co., Ltd.) as the IMI class representative; diflubenzuron (50g / L suspension concentrate, produced by Shandong Lvba Chemical Co., Ltd.) as the TP class representative; bispyribac-sodium (10% suspension concentrate, produced by Hunan Nongda Haite Agrochemical Co., Ltd.) as the PTB class representative; and flufensulfuron-methyl (70% water-dispersible granules, produced by Jiangsu Ruibang Agrochemical Co., Ltd.) as the SCT class representative. 47072 plant lines were treated with the field recommended concentration (1X) of each commercial herbicide at the two-leaf stage, with the recipient parent *Sonchus oleraceus* (Liyang sow thistle) as a control. Phenotypic results were observed two weeks after herbicide application. Picture 6 .

[0048] The parental *Sonchus oleraceus* var. *liyangensis* all turned yellow and died after treatment with the above five herbicides. However, strain 47072 maintained green functional leaves two weeks after treatment with the five herbicides (see...). Picture 7 Among them, the plants treated with SU, IMI and SCT herbicides were completely unaffected and maintained normal growth; the plants treated with PTB and TP herbicides suffered from necrosis of the central leaves and slight chlorosis of the functional leaves, indicating that the resistance of strain 47072 to some (3 / 5) AHAS inhibitor herbicides has reached the level of practical application.

[0049] III. Resistance Transformation of Non-GMO Herbicide-Resistant Mustard Germplasm To verify the heritability of the resistance trait in strain 47072, two vegetable mustard varieties, Ningbo Fine-Leaf Yellow Mustard and Golden Silk Mustard (Zhejiang Agricultural Sciences, 2019, 60 (10): 1816-1817), and two mustard-type rapeseed varieties, Qingjieyou No. 1 (registration number: GPD Rapeseed (2024) 630306) and Chuanyou 56 (registration number: GPD Rapeseed (2018) 510080), were selected. Two varieties were used as non-resistance recipients, and line 47072 was used as the resistance donor for hybridization, resulting in four F1 hybrids. After harvesting F1 seeds, F1 plants were sown individually in 50-cell trays. Once they reached the three-leaf stage, resistance was assessed using the two herbicide resistance identification methods described above. The results showed that all F1 plants were resistant to at least one times the recommended concentration of bensulfuron-methyl herbicide (Kuanxing®, 10% bensulfuron-methyl wettable powder, produced by Jiangsu Kuida Agrochemical Co., Ltd.). The four resistant F1 seedlings were transplanted to the field and carefully managed. The following year, during the flowering period, they were backcrossed with the four non-resistance parents, and the BC1 backcross seeds of each combination were harvested at maturity. Simultaneously, individual F1 plants were bagged and self-pollinated during the flowering period, and F2 seeds were harvested at maturity. Seeds from the segregating generations (BC1 and F2) of each combination were sown individually in 50-cell trays. Herbicide resistance was assessed at the three-leaf stage using the aforementioned method. The results showed that all BC1 generations exhibited a 1:1 segregation of herbicide resistance, and all F2 generations showed a 3:1 segregation (see Table 2). This indicates that the resistance trait conforms to a dominant gene inheritance pattern, consistent with actual genetics. The results of this section demonstrate that the herbicide resistance trait of line 47072 is heritable, and its inheritance pattern conforms to a dominant gene inheritance pattern, allowing for the transfer of resistance according to classical genetics. Furthermore, the herbicide resistance trait of line 47072 can be utilized for breeding using traditional methods.

[0050] Table 2 Resistance performance of different generations of hybrids

[0051] IV. Field Weed Control Models for New Non-GMO Herbicide-Resistant Mustard Varieties Research revealed that all crops grown in open fields face a serious threat from weeds. In mustard production fields, the weed composition is closely related to the production area, water and drought conditions, previous crop species, and soil moisture. In terms of weed species, grassy weeds mainly include *Alopecurus aequalis*, *Poa annuus*, *Miscanthus sinensis*, *Gnaphalium affine*, *Hemiberlesia lataniae*, *Hypericum perforatum*, and wild oats, while broadleaf weeds mainly include *Stellaria media*, *Capsella bursa-pastoris*, *Galium affine*, *Veronica persica*, wild mustard, *Oxalis corniculata*, *Capsella bursa-pastoris*, *Alternanthera philoxeroides*, *Caulis Chicorydalis*, *Humulus scandens*, and *Brucea javanica*. For most plots, grassy and broadleaf weeds usually coexist, but the dominant groups differ. For chemical control, grassy weeds are relatively easy to control, with available herbicides including quizalofop-P-ethyl, quizalofop-P-ethyl, clethodim, quizalofop-P-ethyl, and propargite / isopropylate. However, there are very few herbicides available for broadleaf weeds, such as glyphosate and dichloropyridine, and these two broadleaf herbicides are highly likely to cause phytotoxicity. Therefore, it can be said that in mustard production practice, there is a severe lack of herbicides for broadleaf weeds, making broadleaf weed control a significant production challenge.

[0052] The preceding experiments yielded a weed control model for broadleaf weeds in the production of mustard greens or rapeseed, combining "planting resistant varieties with spraying specific herbicides." Specifically, in production, the main producers plant resistant varieties, while sowing and field management continue in the traditional manner. After the target crop emerges and reaches the three-leaf stage, the corresponding herbicide is sprayed. This kills weeds where they are present and prevents weed germination if they are absent. Simultaneously, the seedlings of the mustard greens or rapeseed are largely unharmed, allowing the resistant crop seedlings to grow healthily without the adverse effects of weeds. The obtained F1 seeds were planted in the production field, and bensulfuron-methyl (Kuanxing®, 10% bensulfuron-methyl wettable powder, produced by Jiangsu Kuida Agricultural Chemical Co., Ltd.) was sprayed at the three-leaf stage. Two weeks later, the field was virtually weed-free, and the crop seedlings were growing well. Picture 8 .

[0053] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, equivalent substitutions, and improvements made by those skilled in the art to the above embodiments without departing from the scope of the technical solution of the present invention, based on the technical essence of the present invention, shall still fall within the protection scope of the technical solution of the present invention.

Claims

1. A method for cultivating a new non-GMO herbicide-resistant mustard germplasm, characterized in that, Includes the following steps: S1: Using non-GMO herbicide-resistant rapeseed as the male parent and mustard as the female parent, artificial pollination and distant hybridization were carried out to harvest hybrid F1 seeds; S2: Single-seed hybrid F1 plants were sown and cultured to the three-leaf stage. Resistant F1 plants were screened using a combination of herbicide spraying identification and molecular identification. The molecular identification involved amplifying the Bn.A1.AHAS3 gene fragment using specific primers and sequencing the sequence. The specific primer sequences are as follows: Forward primer AAAGCTCGAGGCGTTTGCG, Reverse primer CCAAATTACCACACAAAAGAAACTGA; S3: Backcross with resistant F1 plants as the female parent and mustard as the male parent to harvest BC1 seeds; repeat backcrossing to the BC5 generation, and use the method in step S2 to screen for resistant plants in each generation. S4: The BC5 generation resistant single plants were bagged and self-crossed to harvest BC5F2 seeds. After sowing, the seeds were identified by herbicide spraying and molecular identification. Single plants with the Bn.A1.AHAS3 mutant gene and consistent phenotype were screened. After open pollination and fruit setting, genetically stable non-transgenic herbicide-resistant new mustard germplasm was obtained.

2. The method for cultivating non-GMO herbicide-resistant mustard germplasm according to claim 1, characterized in that, In steps S1 and S3, artificial pollination involves repeated pollination with the same recipient stigma and pruning of excess branches and inflorescences to improve the hybridization seed setting rate; the mustard pods are harvested promptly after turning yellow to avoid seed loss due to pod splitting.

3. The non-GMO herbicide-resistant mustard germplasm, its breeding method, and its application according to claim 1, characterized in that, In step S2, the spraying concentration of the herbicide is 40-60% of the field recommended concentration.

4. The method for cultivating non-GMO herbicide-resistant mustard germplasm according to claim 1, characterized in that, In step S2, the herbicide is bensulfuron-methyl; the criteria for herbicide spraying identification are as follows: one week after spraying bensulfuron-methyl, mark the single plant whose central leaves turn obviously yellow; if the central leaves wither after two weeks, it is determined to be a non-resistant single plant; if the central leaves recover and turn green, it is determined to be a resistant single plant.

5. A new non-GMO herbicide-resistant mustard germplasm, characterized in that, The non-GMO herbicide-resistant new germplasm of rapeseed, obtained by the cultivation method described in any one of claims 1 to 4, is rapeseed seed 47072 of the rapeseed type. Its seeds are deposited at the China Center for Type Culture Collection (CCTCC) on March 3, 2026, with accession number CCTCC NO: P202604.

6. The non-GMO herbicide-resistant mustard germplasm according to claim 5, characterized in that, The genome of the non-transgenic herbicide-resistant mustard germplasm integrates the Brassica napus Bn.A1.AHAS3 mutant gene. A single base mutation from G to T occurs at the +1667 base position in the CDS region of this gene, resulting in the Trp-556-Leu mutation in the encoded Bn.A1.AHAS3 protein.

7. The non-GMO herbicide-resistant mustard germplasm according to claim 5, characterized in that, The new non-GMO herbicide-resistant mustard germplasm is resistant to AHAS inhibitor herbicides.

8. The non-GMO herbicide-resistant mustard germplasm according to claim 7, characterized in that, The AHAS inhibitor herbicides include sulfonylureas, imidazolinones, triazolopyrimidines, pyrimidine oxy(thio)benzoates, and sulfonamide carbonyl diazolinones.

9. The application of a new non-GMO herbicide-resistant mustard germplasm, characterized in that, Using the non-GMO herbicide-resistant mustard germplasm obtained by the breeding method described in any one of claims 1 to 4 as the herbicide resistance trait donor, it is hybridized, backcrossed, or self-crossed with mustard varieties used in production. Through herbicide spraying identification and molecular identification screening, a non-GMO herbicide-resistant mustard variety is bred.

10. The application of the non-GMO herbicide-resistant mustard germplasm according to claim 9, characterized in that, The mustard varieties used in the production include any one of vegetable mustard, mustard-type rapeseed, and seasoning mustard; the vegetable mustard includes any one of leaf mustard, stem mustard, root mustard, and bud mustard.

Images