Preparation and application of auricularia polyinositol hydrogel

By preparing a polysaccharide hydrogel of Auricularia auricula-judae loaded with gold nanorods and combining it with near-infrared light irradiation, the problem of drugs being unable to penetrate the stratum corneum to reach the dermis was solved, achieving efficient drug delivery and photothermal therapy, with significant anti-tumor effects and good biocompatibility.

CN122376526APending Publication Date: 2026-07-14CHANGCHUN UNIV OF CHINESE MEDICINE +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
CHANGCHUN UNIV OF CHINESE MEDICINE
Filing Date
2026-06-08
Publication Date
2026-07-14

AI Technical Summary

Technical Problem

In existing technologies, transdermal drug delivery systems have difficulty reaching melanoma lesions in the dermis due to the stratum corneum barrier. Traditional therapies have poor targeting and significant toxic side effects. Photothermal therapy using gold nanorods has poor stability and low targeting efficiency, making it difficult to achieve effective drug delivery.

Method used

A hydrogel of polysaccharide from Auricularia auricula-judae was prepared. By loading gold nanorods and irradiating them with 808 nm near-infrared light, the three-dimensional network structure of the hydrogel was utilized to enhance the adhesion and retention of the drug on the skin surface, thereby achieving effective drug penetration and photothermal conversion and synergistically inhibiting tumor growth.

Benefits of technology

It significantly improves drug penetration and retention rates in the skin, enabling drug delivery to the dermis. It possesses highly efficient photothermal conversion properties, synergistic anti-tumor effects, good biocompatibility and safety, and is suitable for long-term treatment needs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122376526A_ABST
    Figure CN122376526A_ABST
Patent Text Reader

Abstract

This invention relates to the preparation and application of a *Auricularia auricula-judae* polysaccharide hydrogel, belonging to the field of hydrogel preparation technology. To address the problem in existing transdermal drug delivery systems where the stratum corneum barrier hinders drug delivery to melanoma lesions in the dermis, this invention provides a *Auricularia auricula-judae* polysaccharide hydrogel. Using *Auricularia auricula-judae* polysaccharide as the backbone material, its active groups are cross-linked with carboxymethyl chitosan to form a three-dimensional network structure, uniformly encapsulating gold nanorods. The *Auricularia auricula-judae* polysaccharide hydrogel provided by this invention exhibits excellent skin permeability and retention, effectively overcoming the stratum corneum barrier and achieving drug delivery to the dermis. The raw materials are widely available, and the preparation process is simple, providing a safe and efficient formulation strategy for local photothermal therapy of melanoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of hydrogel preparation technology, and in particular relates to the preparation and application of a polysaccharide hydrogel from Auricularia auricula-judae. Background Technology

[0002] Cutaneous melanoma originates from melanocytes, with a global incidence increasing by 5% annually and accounting for over 75% of skin cancer-related deaths, highlighting the urgent need for treatment. Early surgical excision can be curative (5-year survival rate >90%), but approximately 20% of patients progress to advanced stages. Traditional therapies have significant limitations: chemotherapy (such as dacarbazine) has poor targeting, with an objective response rate of only 10%-15% and significant toxic side effects; immune checkpoint inhibitors (such as PD-1 antibodies) have a response rate of only 30% and involve immune-related adverse reactions. Local treatment can reduce systemic exposure, and transdermal drug delivery systems (TDDS) can avoid the first-pass effect, maintain local concentration, and improve compliance, theoretically making them suitable for treating the primary site of melanoma. However, the stratum corneum (SC), composed of keratinocytes and a lipid bilayer, only allows small-molecule lipid-soluble drugs to penetrate in small amounts, while large molecules or nanocarriers struggle to reach lesions in the dermis (50-300 μm), becoming a core bottleneck.

[0003] Photothermal therapy (PTT) can precisely and controllably generate heat (inducing apoptosis at 42-45℃, and causing coagulative necrosis at >45℃), while simultaneously disrupting the stratum corneum structure and promoting drug penetration. Gold nanorods (AuNRs) with LSPR wavelengths tunable to the near-infrared region (650-1300 nm, penetration 1-3 mm) are effective in photothermal therapy for melanoma, but when used alone, they exhibit poor stability, tendency to aggregate, low targeting efficiency, and short-lived photothermal effects. Hydrogels possess a three-dimensional network structure, good biocompatibility, and controllable release, enabling them to encapsulate photothermal agents and drugs, preventing aggregation and reducing formulation loss. Natural polysaccharide hydrogels, due to their excellent biocompatibility, biodegradability, and rich content of active groups such as hydroxyl / carboxyl groups, can form a three-dimensional network, soften the stratum corneum, and reduce inflammation, making them ideal carriers. Auricularia auricula polysaccharide (ACP) is a water-soluble polysaccharide that is both food and medicine. It has active hydroxyl / carboxyl groups, good compatibility, biodegradability, and significant antioxidant and anti-inflammatory activities. Moreover, it has a wide range of raw material sources and low cost, and has significant potential in the field of transdermal photothermal therapy carriers. Summary of the Invention

[0004] To address the problem in existing transdermal drug delivery systems where drugs have difficulty reaching melanoma lesions in the dermis due to the stratum corneum barrier, this invention provides a method for preparing and applying a polysaccharide hydrogel from Auricularia auricula-judae.

[0005] One objective of this invention is to provide a method for preparing polysaccharide hydrogel from Auricularia auricula-judae, the method comprising the following steps: S1: Weigh CTAB and dissolve it in deionized water. Stir until the solution is completely transparent. Add HAuCl4 solution and mix well to obtain a mixed solution. Place the mixed solution in an ice bath to cool to 0℃. Then add NaBH4 solution and stir immediately for 30 s. When the solution color changes from light yellow to dark brown, the reaction is complete, and the gold nano-seed solution is obtained. Seal the gold nano-seed solution and let it stand at room temperature for ≥2 h. S2: Weigh CTAB and dissolve it in deionized water. Stir until the solution is completely transparent. Add HAuCl4 solution and AgNO3 solution in sequence, stir for 30 seconds, mix well, and then add L-AA solution to obtain the growth solution. S3: Using a pipette, slowly and evenly add the gold nano-seed solution obtained in S1 to the growth solution obtained in S2. Immediately after the addition is complete, stir at 700 rpm for 30 s. Seal the mixed solution and place it in a static environment for ≥6 h. When the solution turns pink, the reaction is complete. Centrifuge at 12000 rpm for 15 min, discard the supernatant, and resuspend the precipitate with deionized water. Repeat the washing 2-3 times to obtain the gold nanorod solution. S4: Weigh out the polysaccharide of Auricularia auricula-judae and dissolve it in an alcohol-water solution. Add NaIO4 solution and react in the dark for 6 h. Add ethylene glycol to stop the reaction. Stir for 30 min. Add ethanol and stir for 5 min. Let stand for 2 h. Filter and purify by dialysis with distilled water for 3 days. Freeze dry to obtain oxidized Auricularia auricula-judae polysaccharide. S5: Weigh carboxymethyl chitosan and dissolve it in phosphate buffer, stir well to obtain solution A; weigh sodium periodate and mix it with the oxidized auricularia polysaccharide obtained in S4 to obtain a mixture; dissolve the mixture in phosphate buffer and stir well to obtain solution B; S6: Mix solution A obtained in S5 with the gold nanorod solution obtained in S3 until homogeneous. Slowly add solution B obtained in S5 under continuous stirring and continue stirring to mix thoroughly. Allow the mixture to stand at room temperature to react and obtain a hydrogel of Auricularia auricula-judae loaded with gold nanorods.

[0006] In a preferred embodiment of the present invention, the mixed mass-volume ratio of CTAB, deionized water, HAuCl4 solution and NaBH4 solution in S1 is 0.364 g: 10 mL: 0.25 mL: 0.6 mL; the concentration of HAuCl4 solution is 0.025 M and the concentration of NaBH4 solution is 0.01 M.

[0007] In a preferred embodiment of the present invention, the mixed mass-to-volume ratio of CTAB, deionized water, HAuCl4 solution and AgNO3 solution in S2 is 0.728 g: 40 mL: 2.0 mL: 0.4 mL; the concentration of HAuCl4 solution is 0.025 M and the concentration of AgNO3 solution is 0.01 M.

[0008] In a preferred embodiment of the present invention, the mixing volume ratio of the growth solution and the gold nanoseed solution in S3 is 42.72 mL: 0.08 mL.

[0009] In a preferred embodiment of the present invention, the mass-volume ratio of the oxidized auricularia auricula polysaccharide, the alcohol-water solution, and the NaIO4 solution in S4 is 2.0 g: 25 mL: 25 mL; the volume ratio of alcohol to water in the alcohol-water solution is 1:1; the concentration of the NaIO4 solution is 8%; the amount of ethylene glycol added is 10 mL; and the amount of ethanol added is 2 mL.

[0010] In a preferred embodiment of the present invention, the mass-volume concentration of carboxymethyl chitosan in solution A in S5 is 3.5%; the mass-volume concentration of sodium periodate in the mixture is 8%; and the mass-volume concentration of the mixture in solution B is 3.5%.

[0011] In a preferred embodiment of the present invention, the mixing volume ratio of solution A, gold nanorod solution and solution B in S6 is 1.5 mL: 100 μL: 1.5 mL.

[0012] The second objective of this invention is to provide a polysaccharide hydrogel of Auricularia auricula-judae, which is obtained by the above-mentioned preparation method.

[0013] The third objective of this invention is to provide the application of the above-mentioned Auricularia auricula polysaccharide hydrogel in the preparation of products for improving / treating melanoma.

[0014] In a preferred embodiment of the present invention, the application is achieved by combining the polysaccharide hydrogel of Auricularia auricula-judae with irradiation by 808 nm near-infrared light.

[0015] Compared with the prior art, the beneficial effects of the present invention are: the present invention provides a polysaccharide hydrogel of Auricularia auricula-judae, which has the following significant advantages; (1) Excellent skin permeability and retention: The *Auricularia auricula-judae* polysaccharide hydrogel (AuNRs-Hyd) provided by this invention encapsulates gold nanorods through a three-dimensional network structure of hydrogel. Combined with the natural moisturizing and keratin softening functions of *Auricularia auricula-judae* polysaccharide, it significantly enhances the adhesion and retention time of drugs on the skin surface. In vitro transdermal experiments show that, compared with free gold nanorods, AuNRs-Hyd significantly improves the skin permeability, retention rate, and total permeability within 48 hours, effectively overcoming the stratum corneum's penetration barrier to nanomedicines and achieving drug delivery to the dermis and even subcutaneous tissue.

[0016] (2) Highly efficient and stable photothermal conversion performance: Gold nanorods exhibit excellent photothermal conversion capabilities under 808 nm near-infrared light irradiation, enabling rapid local temperature increases to above 47°C, effectively inducing tumor cell apoptosis. The hydrogel encapsulation effectively prevents the aggregation of gold nanorods in the physiological environment, maintains the stability of their longitudinal surface plasmon resonance absorption peak, and maintains stable photothermal performance after 5 cycles of irradiation, ensuring the reliability and repeatability of the treatment.

[0017] (3) Synergistic enhancement of anti-tumor effect: In vitro cell experiments confirmed that AuNRs-Hyd has a significant killing effect on B16 melanoma cells under near-infrared light irradiation, and can effectively inhibit cell migration, promote cell apoptosis, induce reactive oxygen species generation and decrease mitochondrial membrane potential. Western blot and RT-qPCR results further showed that AuNRs-Hyd+NIR can upregulate the expression of copper death-related proteins FDX1 and DLAT, revealing that it synergistically inhibits tumor growth through multiple pathways.

[0018] (4) Good biocompatibility and safety: AuNRs-Hyd has no obvious toxicity to normal HaCaT cells, the hemolysis rate is less than 2%, and it did not cause weight loss or major organ damage in mice in in vivo experiments, showing excellent biocompatibility.

[0019] (5) Regulated drug release and long-term therapeutic potential: The three-dimensional network structure of hydrogel can regulate the pore size and degradation rate through cross-linking, thereby achieving the sustained release effect of gold nanorods, avoiding excessively high local drug concentration caused by burst release, prolonging the photothermal effect time, and adapting to the long-term treatment needs of melanoma.

[0020] (6) Wide range of raw material sources and simple preparation process: The present invention selects polysaccharides from Auricularia auricula-judae as the hydrogel matrix, not based on the existing technology inspiration of the anti-tumor activity of Auricularia auricula-judae, but based on the compatibility between the unique chemical structure of Auricularia auricula-judae polysaccharides and the technical solution of the present invention. Auricularia auricula-judae is a fungus that is both food and medicine, with wide sources and low cost. The hydrogel preparation process does not require complex chemical modification, is simple to operate, and has good industrialization prospects.

[0021] The method for preparing gold nanoseeds in this invention is based on the classic "seed-mediated growth method." Its principle involves constructing a precise chemical reaction system, through which "gold seeds" undergo controlled catalytic reduction growth in a growth solution with specific components, directly synthesizing gold nanorods with specific morphologies and sizes. Specifically, this invention precisely controls the proportions and reaction sequence of surfactant (CTAB), gold source (HAuCl4), reducing agent (L-AA), and directing agent (AgNO3) to first form gold seeds of uniform size. Then, through anisotropic growth in the growth solution, gold nanorods with the desired aspect ratio are obtained in a one-step process. This process directly determines the core physicochemical properties of the gold nanorods, such as size, morphology, and the position of the surface plasmon resonance absorption peak (808 nm in this invention).

[0022] The present invention provides a method for preparing gold nanorods, which utilizes the amide reaction between the carboxyl groups on the surface of the gold nanorods and polypeptide molecules. The self-assembly of the polypeptides is driven by the change in pH value during the reaction, thereby forming a gel layer on the surface of the synthesized gold nanorods. This method focuses on the post-modification of the formed gold nanorods.

[0023] This invention uses Auricularia auricula-judae polysaccharide as a hydrogel framework material. Its core function is to provide cross-linkable active groups, stably combine with carboxymethyl chitosan, and form a suitable three-dimensional network structure. These functions depend on the molecular structure of the polysaccharide, rather than its direct anti-tumor activity.

[0024] In summary, the polysaccharide hydrogel provided by this invention has multiple advantages, including high transdermal efficiency, stable photothermal effect, synergistic antitumor effect, and good biocompatibility, providing a novel, safe, and effective formulation strategy for local photothermal therapy of melanoma. Attached Figure Description

[0025] Figure 1 This is a flowchart illustrating the fabrication process of the gold nanorods in Example 1. Figure 2 The image shows a TEM image of the gold nanorods in Example 1. Figure 3 This is a particle size distribution diagram of the gold nanorods in Example 1; Figure 4 The image shows the UV-Vis spectrum of the gold nanorods in Example 1. Figure 5 The image shows the zeta potential of the gold nanorods in Example 1. Figure 6 This is a photothermal curve of gold nanorods and PBS under near-infrared irradiation in Example 1; Figure 7 The image shows the photothermal stability results of the gold nanorods in Example 1; Figure 8The infrared spectra of Auricularia auricula-judae polysaccharide and oxidized Auricularia auricula-judae polysaccharide in Example 2 are shown below. Figure 9 This is a diagram illustrating the gelation principle of the Auricularia auricula-judae polysaccharide hydrogel in Example 3; Figure 10 This is a scanning electron microscope image of the polysaccharide hydrogel from Auricularia auricula-judae in Example 3; Figure 11 Infrared spectra of different treatment groups in Example 3; Figure 12 The image shows the dynamic frequency scanning rheological properties of the Auricularia auricula-judae polysaccharide hydrogel in Example 3. Figure 13 This is an amplitude scan (strain scan) rheological property curve of the *Auricularia auricula-judae* polysaccharide hydrogel in Example 3; Figure 14 This is a field emission scanning electron microscope image of the polysaccharide hydrogel from Auricularia auricula-judae in Example 3; Figure 15 The image shows the temperature rise curves of the Auricularia auricula-judae polysaccharide hydrogels loaded with different concentrations of AuNRs in Example 3; A represents a concentration of 15 μg / mL, B represents a concentration of 25 μg / mL, and C represents a concentration of 50 μg / mL. Figure 16 This is a graph showing the photothermal stability results of the *Auricularia auricula-judae* polysaccharide hydrogel in Example 3; Figure 17 The graph shows the skin permeability, skin retention, and total permeability of different treatment groups in Example 4; A represents skin permeability, B represents skin retention, and C represents total permeability. Figure 18 The diagram shows the effect of AuNRs and AuNRs+NIR treatment groups on the cell viability of B16 cells in Example 4; A is the AuNRs 24 h treatment group, B is the AuNRs 48 h treatment group, C is the AuNRs+NIR 24 h treatment group, and D is the AuNRs+NIR 48 h treatment group. Figure 19 The diagram shows the effect of AuNRs-Hyd and AuNRs-Hyd+NIR treatment groups on the cell viability of B16 cells in Example 4; A is the AuNRs-Hyd 24 h treatment group, B is the AuNRs-Hyd 48 h treatment group, C is the AuNRs-Hyd+NIR 24 h treatment group, and D is the AuNRs-Hyd+NIR 48 h treatment group. Figure 20 This is a graph showing the effect of different treatment groups on the cell migration ability of B16 cells in Example 4; Figure 21 These are confocal images of live and dead cells stained in different treatment groups in Example 4; Figure 22 This is a statistical graph of live and dead cells in different treatment groups in Example 4; Figure 23 These are microscopic images of cell migration in different treatment groups in Example 4; Figure 24 This is a statistical graph showing the cell migration assessment of different treatment groups in Example 4; Figure 25 This is a diagram showing the apoptosis experiment in different treatment groups in Example 4; Figure 26 This is a statistical graph of cell apoptosis experiments in different treatment groups in Example 4; Figure 27 The figure shows the experimental results of reactive oxygen species in cells of different treatment groups in Example 4; Figure 28 These are confocal images of reactive oxygen species in cells from different treatment groups in Example 4; Figure 29 This is a statistical chart of the assessment of reactive oxygen species in cells from different treatment groups in Example 4; Figure 30 Mitochondrial membrane potential diagrams for different treatment groups in Example 4; Figure 31 This is a statistical graph of mitochondrial membrane potential in different treatment groups in Example 4; Figure 32 This is a diagram showing the effect of AuNRs on the viability of normal HaCaT cells in Example 4; A represents the 24-hour treatment group, and B represents the 48-hour treatment group. Figure 33 The figure shows the effect of AuNRs-Hyd on the viability of normal HaCaT cells in Example 4; A is the 24 h treatment group, and B is the 48 h treatment group. Figure 34 The graph shows the hemolysis test results for different treatment groups in Example 4; Figure 35 This is a statistical graph of the hemolysis experiment in the AuNRs-treated group in Example 4; Figure 36 This is a statistical chart of hemolysis experiments in the AuNRs-Hyd treatment group in Example 4; Figure 37 This is an immunofluorescence image of AuNRs-Hyd against normal HaCaT cells in Example 4; Figure 38 This is a graph showing the detection of copper death-related proteins in B16 cells by AuMRs+NIR in Example 4. Figure 39 This is a statistical graph showing the effect of AuMRs+NIR on FDX1 expression in B16 cells in Example 4. Figure 40 This is a statistical graph showing the effect of AuMRs+NIR on DLAT expression in B16 cells in Example 4. Figure 41Tumor growth curves for different treatment groups in Example 4; Figure 42 This is a graph showing the average tumor growth curves for different treatment groups in Example 4; Figure 43 This is a statistical chart of tumor weight in different treatment groups in Example 4; Figure 44 Tumor epigenetic images of different treatment groups in Example 4; Figure 45 This is a statistical chart of mouse weights in different treatment groups in Example 4; Figure 46 HE staining images of tumor tissues from different treatment groups in Example 4; Figure 47 HE staining images of mouse organs from different treatment groups in Example 4; Figure 48 Figure 1 shows the in vivo anti-tumor recurrence effect of AuNRs-Hyd; A is a schematic diagram of the tumor recurrence model construction and treatment process; B is a representative image of normal wounds without tumors and B16 tumor-bearing mice in each group; C is a graph showing the changes in wound area after tumor implantation, surgery and treatment; D is a graph showing the weight statistics of mice in each group; E is a graph showing the changes in tumor volume during treatment; F is a graph showing Ki67 immunohistochemical staining (brown) of wounds and normal wounds in each group on day 12; scale bar: 50 μm. Figure 49 The images show the in vivo evaluation of postoperative wound healing after AuNRs-Hyd treatment. A is a schematic diagram of the repair-promoting treatment process; B is the wound closure image at 0, 4, 8, and 12 days after the establishment of the full-thickness wound model; C is a comparison of wound healing in different groups at 4, 8, and 12 days; D is a microscopic image of H&E-stained tissue pathology sections at 4, 8, and 12 days after treatment (scale bar: 500 μm, 50 μm); E is a microscopic image of Masson-stained tissue pathology sections at 4, 8, and 12 days after treatment (scale bar: 500 μm, 50 μm). Detailed Implementation

[0026] Those skilled in the art can refer to the content of this document and appropriately improve the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments, and those skilled in the art can obviously make modifications or appropriate alterations and combinations to the methods and applications described herein without departing from the content and scope of this invention to implement and apply the technology of this invention.

[0027] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the materials, reagents, methods, and instruments used are all conventional materials, reagents, methods, and instruments in the art, and can be obtained commercially by those skilled in the art.

[0028] Example 1: Preparation of gold nanorods (AuNRs) S1: Weigh 0.364 g CTAB and dissolve it in 10 mL of deionized water. Stir until the solution is completely transparent. Add 0.25 mL of HAuCl4 solution (concentration 0.025 M) and mix well to obtain a mixed solution. Cool the mixed solution to 0℃ in an ice bath, then add 0.6 mL of NaBH4 solution (concentration 0.01 M) and stir immediately for 30 s. When the solution color changes from pale yellow to dark brown, the reaction is complete, and the gold nano-seed solution is obtained. Seal the gold nano-seed solution and let it stand at room temperature for ≥2 h. S2: Weigh 0.728 g CTAB and dissolve it in 40 mL of deionized water. Stir until the solution is completely transparent. Then add 2.0 mL of HAuCl4 solution (0.025 M concentration) and 0.4 mL of AgNO3 solution (0.01 M concentration) in sequence. Stir for 30 s and mix well. Then add L-AA solution to obtain the growth solution. S3: Using a pipette, slowly and evenly add 0.08 mL of the gold nanoparticle seed solution obtained in S1 to 42.72 mL of the growth solution obtained in S2. Immediately after the addition, stir at 700 rpm for 30 s. Seal the mixed solution and place it in a static environment for ≥6 h. The reaction is complete when the solution turns pink. Centrifuge at 12000 rpm for 15 min, discard the supernatant, and resuspend the precipitate with deionized water. Repeat the washing 2-3 times to obtain the gold nanorod solution, abbreviated as AuNRs. The above gold nanorod fabrication process is as follows: Figure 1 As shown.

[0029] Effect Experiment: 1. Structural and morphological analysis of gold nanorods (AuNRs) The structure and morphology of the prepared AuNRs were analyzed by transmission electron microscopy (TEM), ultraviolet-visible absorption spectroscopy, and zeta potential measurement.

[0030] like Figure 2 As shown in the TEM images, AuNRs exhibit a uniform rod-like shape with a length of 50-100 nm. Figure 3-4As shown in the particle size distribution map and UV-Vis spectrum, the surface plasmon resonance absorption band of AuNRs is approximately around 808 nm, which matches the optical window of biological tissues, making it suitable for photothermal therapy of deep tissues. Figure 5 As shown, the zeta potential of AuNRs was determined to be +50 mV, indicating that their surface carries a strong positive charge, which usually originates from the encapsulation by stabilizers such as CTAB. The most crucial implication of this value is its extremely excellent colloidal stability; the strong electrostatic repulsion between particles effectively prevents aggregation and precipitation, ensuring long-term solution stability. Simultaneously, this characteristic also means that the AuNRs prepared in this invention readily bind to negatively charged substances (such as DNA and cell membranes) through electrostatic adsorption. Furthermore, AuNRs, characterized by their cationic surfaces, exhibit significant antibacterial activity due to their ability to bind to negatively charged bacterial membranes; this interaction highlights their potential as effective antibacterial materials.

[0031] 2. Photothermal performance testing of gold nanorods (AuNRs) At a power density of 1.0 W / cm 2 The photothermal properties of the prepared AuNRs were assessed by monitoring temperature changes after laser irradiation for 20 minutes and 5 minutes after laser irradiation was stopped. Near-infrared spectroscopy (808 nm, 1.0 W / cm²) was used. 2 Irradiate 100 μL of AuNRs for 5 min, recording temperature changes every 30 s. Subsequently, AuNRs are used in the near-infrared (808 nm, 1.0 W / cm²) spectrum. 2 The photothermal stability of AuNRs was investigated under 5 on / off irradiation cycles, and the temperature during the heating and cooling processes was monitored.

[0032] like Figure 6 As shown, the corresponding temperature measurements of AuNRs are displayed, indicating that the temperature increases with irradiation time; notably, AuNRs achieved a temperature rise to 47.5°C from ambient conditions, while the photothermal effect of the PBS control group was weaker. Figure 7 As shown, after 5 NIR on / off cycles, no significant temperature change was observed in AuNRs, indicating that the AuNRs prepared in this invention have excellent photothermal stability.

[0033] Example 2: Preparation of Oxidized Auricularia auricula-judae polysaccharide (OACP) Weigh 2.0 g of Auricularia auricula polysaccharide (ACP) and dissolve it in 50 mL of ethanol-water solution (v:v=1:1). Add 1 mL of NaIO4 solution (concentration of 8%) and react in the dark for 6 h. Add 10 mL of ethylene glycol to stop the reaction, stir for 30 min, add 2 mL of ethanol, stir for 5 min, let stand for 2 h, filter, and purify by dialyzing with distilled water for 3 days. Freeze dry to obtain oxidized Auricularia auricula polysaccharide, abbreviated as: OACP.

[0034] Effect Experiment: 1. Fourier Transform Infrared Spectroscopy (FT-IR) Analysis Take 50 mg of ACP and 50 mg of the OACP prepared above and place them in a mortar, add 5 g of pure potassium bromide to each, and grind until there is no obvious particle feel. Take 100 mg of the sample to be tested and compress it into a tablet to obtain the sample tablet. Use the pure potassium bromide tablet as the background tablet and perform infrared spectroscopy detection, setting the scanning range to 400-4000 cm⁻¹. -1 .

[0035] like Figure 8 As shown, 3380 cm -1 The broad absorption peak is attributed to the OH stretching vibration, which is caused by intermolecular hydrogen bonding; 2920 cm⁻¹ -1 The peak at 1620 cm⁻¹ represents the methylene CH vibration, a characteristic peak for polysaccharides. -1 1420 cm -1 Corresponding to C=O and CO stretching vibrations respectively, confirming the presence of uronic acid; 1380 cm -1 The methyl CH bending vibration contributes to the characteristic absorption of the sugar ring. 1250 cm⁻¹ -1 For OH vibration, 1080 cm -1 The vibration is a CO stretching vibration, indicating the presence of a pyran ring, 895 cm. -1 The absorption peaks prove that Auricularia auricula polysaccharide (ACP) contains β-glycosidic bonds.

[0036] Furthermore, compared to ACP, the OACP provided by this invention has a lower tolerance of 1730 cm. -1 The presence of characteristic peaks typical of aldehyde groups confirms the successful preparation of OACP.

[0037] Example 3: Preparation of a polysaccharide hydrogel from Auricularia auricula-judae (AuNRs-Hyd) Carboxymethyl chitosan (CMCS) was weighed and dissolved in phosphate buffered saline (PBS), and stirred until homogeneous to obtain solution A (the mass-volume concentration of carboxymethyl chitosan in solution A is 3.5%). Sodium periodate was weighed and mixed with the oxidized auricularia auricula polysaccharide prepared in Example 2 to obtain a mixture (the mass-volume concentration of sodium periodate in the mixture is 8%). The mixture was dissolved in phosphate buffered saline and stirred until homogeneous to obtain solution B (the mass-volume concentration of the mixture in solution B is 3.5%). 1.5 mL of solution A was mixed evenly with 100 μL of the gold nanorod solution prepared in Example 1. Then, 1.5 mL of solution B was slowly added under continuous stirring, and the mixture was stirred until fully combined. The mixture was allowed to stand at room temperature to react, resulting in a gold nanorod-loaded *Auricularia auricula-judae* polysaccharide hydrogel, abbreviated as AuNRs-Hyd. The gelation principle of the *Auricularia auricula-judae* polysaccharide hydrogel is as follows: Figure 9 As shown.

[0038] Effect Experiment: 1. Scanning electron microscopy characterization The microstructure of the obtained Auricularia auricula polysaccharide hydrogel was observed and analyzed using scanning electron microscopy (SEM). Specifically, the Auricularia auricula polysaccharide hydrogel was freeze-dried and fractured. The freeze-dried sample was fixed on the sample platform with conductive adhesive, keeping the fracture surface facing upward. Gold was then vacuum-sputtered, and the sample was observed and images were acquired under an electron microscope.

[0039] like Figure 10 As shown, the surface and cross-sectional structure of the *Auricularia auricula-judae* polysaccharide hydrogel can be clearly revealed under a scanning electron microscope, demonstrating its uniform pore structure. Therefore, the *Auricularia auricula-judae* polysaccharide hydrogel provided by this invention has the significant advantage of controllable structure.

[0040] 2. Fourier Transform Infrared Spectroscopy (FT-IR) Analysis Take 50 mg each of oxidized auricularia auricula polysaccharide (OACP), carboxymethyl chitosan (CMCS), auricularia auricula polysaccharide hydrogel (Hyd), and a physical mixture of oxidized auricularia auricula polysaccharide and carboxymethyl chitosan (MIX) powders and place them in a mortar. Add 5 g of pure potassium bromide and grind until there is no obvious particle feel. Take an appropriate amount of 100 mg of the sample to be tested and press it into a mold to obtain the sample tablet. Use pure potassium bromide tablets as background tablets and perform infrared spectroscopy detection. Set the scanning range to 400-4000 cm⁻¹. -1 .

[0041] like Figure 11 As shown, OACP is at 1730 cm. -1 The decreased absorption at this point indicates that the aldehyde group of OACP reacted with the amino group of carboxymethyl chitosan; AuNRs-Hyd at 1630 cm⁻¹... -1The presence of the characteristic absorption peak of C=N imine demonstrates that the aldehyde group of the oxidized polysaccharide and the amino group of carboxymethyl chitosan react to form a Schiff base structure, which strongly proves the formation of the oxidized auricularia auricularia polysaccharide-carboxymethyl chitosan cross-linked structure in the auricularia auricularia polysaccharide hydrogel provided by this invention.

[0042] 3. Rheological characterization The rheological properties of the above-mentioned Auricularia auricula polysaccharide hydrogel (AuNRs-Hyd) were determined by rheometer at 25℃. The test temperature was set to 25℃, and the storage modulus (G') and loss modulus of the hydrogel were measured at a fixed angular frequency of 10 rad / s within a strain range of 0.1-1000%. The gel-sol transition point was also measured at a test temperature of 25℃, an angular frequency range of 0.1 rad / s to 100 rad / s for frequency scanning, and a fixed strain of 1%.

[0043] like Figure 12 As shown, G' of AuNRs-Hyd is always greater than G" in the angular frequency range of 1-100 rad / s, indicating that the network structure of AuNRs-Hyd is stable and has good elasticity characteristics. Figure 13 As shown, the critical point of AuNRs-Hyd is around 100%. When the strain increases to near the intersection point, G' is significantly less than G”. When approaching or at the intersection point, the value of G' decreases significantly and is lower than the value of G”. This indicates that after the critical point, the internal cross-linking degree of AuNRs-Hyd decreases significantly under increasing stress conditions, the network structure of AuNRs-Hyd is destroyed, and it gradually changes from a gel state to a sol state.

[0044] 4. Field emission scanning electron microscopy characterization The morphology of AuNRs-Hyd was observed using a Carl Zeiss LEOSUPRA 55 GENESIS 2000 field emission scanning electron microscope (FE-SEM) from Germany.

[0045] like Figure 14 As shown, compared with the original blank hydrogel (Hyd), the SEM image of AuNRs-Hyd shows that many AuNRs were successfully encapsulated in the three-dimensional network structure of the hydrogel.

[0046] 5. Verification of photothermal performance The sample was irradiated with an 808 nm laser, and temperature changes were recorded in real time using an infrared thermal imager to observe the effect of AuNRs concentration on the photothermal conversion performance of *Auricularia auricula-judae* polysaccharide hydrogel (AuNRs-Hyd). AuNRs-Hyd hydrogels loaded with different concentrations (0, 15, 25, 50 μg / mL) of AuNRs were prepared, and the temperature was recorded in real time using an infrared thermal imager. The photothermal conversion performance of the hydrogel was observed at 1 W / cm². 2The AuNRs were irradiated with 808 nm NIR light for 5 min, and the temperature change was recorded every 30 s to observe the effect of AuNRs concentration on the photothermal properties of AuNRs-Hyd. Subsequently, AuNRs were used in the near-infrared (808 nm, 1.0 W / cm²) light. 2 The photothermal stability of AuNRs-Hyd was investigated under 5 on / off irradiation cycles.

[0047] like Figure 15 As shown, the strong absorption of AuNRs-Hyd in the near-infrared region contributes to its photothermal properties; the temperature rise of AuNRs-Hyd under 808 nm laser irradiation was first measured, and the temperature increased with increasing AuNRs concentration, with a temperature as high as 47℃ at 50 μg / mL. Figure 16 As shown, after 5 NIR on / off cycles, the heating / cooling curves of each cycle have a high degree of overlap, indicating that AuNRs-Hyd maintains a stable photothermal conversion efficiency in multiple cycles.

[0048] Example 4: Application of Auricularia auricula-judae polysaccharide hydrogel in the preparation of products for improving / treating melanoma 1. Transdermal test The in vitro release rate was tested using the Franz diffusion cell method. The stratum corneum of isolated mouse skin was placed face up and the dermis face down between the drug supply cell (with PBS solution added) and the receiving cell, and then sealed with a sealing film.

[0049] The experimental groups were: AuNRs: Gold nanorod treatment group; AuNRs+NIR: Gold nanorods combined with 808 nm near-infrared light irradiation treatment group; AuNRs-Hyd: Auricularia auricula-judae polysaccharide hydrogel treatment group; AuNRs-Hyd+NIR: Auricularia auricula polysaccharide hydrogel combined with 808 nm near-infrared light irradiation treatment group.

[0050] In all experimental groups, the amount of AuNRs was kept at 5 mg, the drug loading dose of Hyd was 5 mg, and the water bath was maintained at 37℃ with a rotation speed of 300 r / min. 1 mL samples were taken at 0.5, 2, 4, 8, 12, 24, 36, and 48 h, and an isothermal and equal volume of receiving solution was added simultaneously. Each group was tested in triplicate. The AuNRs content was determined by ultraviolet spectrophotometry, and the skin permeability was calculated. At different sampling times, the skin was removed, cut into small pieces, and homogenized with PBS. The homogenate was centrifuged at 12000 r / min for 30 min, and the supernatant was used to calculate the skin retention rate.

[0051] like Figure 17As shown, compared with the AuNRs, AuNRs+NIR and AuNRs-Hyd treatment groups, the AuNRs-Hyd+NIR treatment group exhibited higher skin permeability, skin retention rate and total permeability at 48 h; indicating that the Auricularia auricula polysaccharide hydrogel combined with the 808 nm near-infrared light irradiation treatment system provided by the present invention has better performance in terms of drug delivery efficiency.

[0052] 2. Cell viability assay B16 cell viability was assessed using the CCK-8 assay. When cells reached 70% confluence, they were cultured for 24 and 48 h with different concentrations (0, 5, 10, 15, 20, 25, 50, 100, 150 μg / mL) of AuNRs and AuNRs + NIR. After incubation with CCK-8 reagent for 30 min, absorbance was measured at 450 nm. Cell viability was calculated with the untreated control as 100% to determine the optimal concentration.

[0053] like Figure 18 As shown, with the increase of AuNRs and AuNRs+NIR concentrations, the cell viability of B16 cells gradually decreased, and the decrease in cell viability was more significant after treatment with 808 nm near-infrared light irradiation, reaching the median lethal dose when the drug concentration was 50 μg / mL; it can be seen that AuNRs exert photothermal effects to kill B16 cells.

[0054] B16 cell viability was assessed using the CCK-8 assay. When cells reached 70% confluence, they were cultured for 24 and 48 h with different concentrations (0, 5, 10, 15, 20, 25, 50, 100, 150 μg / mL) of AuNRs-Hyd and AuNRs-Hyd+NIR, respectively. After incubation with CCK-8 reagent for 30 min, absorbance at 450 nm was measured. Cell viability was calculated with the untreated control as 100% to determine the optimal concentration.

[0055] like Figure 19 As shown, with the increase of AuNRs-Hyd and AuNRs-Hyd+NIR concentrations, the cell viability of B16 cells gradually decreased, and the decrease in cell viability was more significant after treatment with 808 nm near-infrared light. It can be seen that AuNRs-Hyd still exerts photothermal effects to kill B16 cells.

[0056] 3. Cell scratch assay B16 cells in logarithmic growth phase were seeded in 96-well plates (5 × 10⁶ cells / well). 5(each cell / well) were cultured until complete confluence (100%). Vertical incisions were made using a 200 μL sterile pipette tip, and the cells were washed with PBS and then added to drug-containing culture medium. The cells were observed under an optical microscope at 0, 12, 24, and 48 h.

[0057] The experimental groups were: Control: Blank control group; NIR: 808 nm near-infrared light irradiation treatment group; Hyd: Blank hydrogel treatment group; AuNRs: Gold nanorod treatment group; AuNRs+NIR: Gold nanorods combined with 808 nm near-infrared light irradiation treatment group; AuNRs-Hyd: Auricularia auricula-judae polysaccharide hydrogel treatment group; AuNRs-Hyd+NIR: Auricularia auricula polysaccharide hydrogel combined with 808 nm near-infrared light irradiation treatment group.

[0058] like Figure 20 As shown, changes in scratch area were monitored at 0, 24, and 48 h to assess B16 cell migration; AuNRs, AuNRs+NIR, AuNRs-Hyd, and AuNRs-Hyd+NIR all inhibited cell migration, with the AuNRs-Hyd+NIR group showing the most significant migration inhibition.

[0059] 4. Live and dead cell staining experiment Cell viability was verified by using Calcein-AM (green staining for live cells) and PI (red staining for dead cells) for live / dead cell staining. Experimental groups included: Control, NIR, Hyd, AuNRs, AuNRs+NIR, AuNRs-Hyd, and AuNRs-Hyd+NIR. After 24 h of treatment, cells in each group were washed with PBS, incubated with a Calcein-AM / PI mixture (2:1:1000) for 15 min at room temperature in the dark, and observed under a confocal microscope.

[0060] like Figure 21-22 As shown, the green fluorescence in the NIR and Hyd treatment groups was similar to that in the Control group, while the red fluorescence in the experimental groups gradually increased. Among them, the AuNRs+NIR and AuNRs-Hyd+NIR treatment groups showed more red fluorescence, indicating that AuNRs exerted a photothermal effect to kill cells.

[0061] 5. Cell migration experiment Cell migration was assessed using 8 μm pore size Transwell chambers, grouped as follows: Control, NIR, Hyd, AuNRs, AuNRs+NIR, AuNRs-Hyd, and AuNRs-Hyd+NIR. Serum-free culture medium containing the drug was placed in the lower chamber, and 4 × 10⁶ cells were seeded in the upper chamber. 5 Cells were cultured for 48 h, and then the lower membrane cells were fixed with 4% paraformaldehyde for 30 min, washed with PBS, stained with 0.1% crystal violet for 30 min, observed under an inverted microscope, and analyzed with ImageJ software.

[0062] like Figure 23-24 As shown, the AuNRs, AuNRs+NIR, AuNRs-Hyd, and AuNRs-Hyd+NIR treatment groups all inhibited cell migration, with the AuNRs-Hyd+NIR group showing the most significant reduction in migration. The number of cells passing through the transwell chamber was the lowest, indicating that AuNRs-Hyd+NIR treatment inhibited cell migration.

[0063] 6. Apoptosis detection Apoptosis was assessed using the FITC Annexin V apoptosis detection kit and flow cytometry. Cells were grouped as follows: Control, NIR, Hyd, AuNRs, AuNRs+NIR, AuNRs-Hyd, and AuNRs-Hyd+NIR. B16 cells were cultured at 5 × 10⁶ cells / year. 5 Cells / well were seeded in 96-well plates and cultured to 70% confluence. After treatment with each drug for 24 h, the cells were digested with EDTA-free trypsin, washed twice with pre-cooled PBS, stained with Annexin V, and analyzed by flow cytometry FITC channel.

[0064] like Figure 25-26 As shown, compared with the Control group, the number of apoptosis was significantly increased in the AuNRs, AuNRs+NIR and AuNRs-Hyd+NIR treatment groups; among them, the AuNRs-Hyd+NIR group had more apoptosis.

[0065] 7. Detection of reactive oxygen species in cells (flow cytometry) Intracellular reactive oxygen species (ROS) levels were detected using the DCFH-DA probe and flow cytometry. Cells were grouped as follows: Control, NIR, Hyd, AuNRs, AuNRs+NIR, AuNRs-Hyd, and AuNRs-Hyd+NIR. B16 cells were then cultured at 5 × 10⁻⁶ cells / cells. 5Inoculate each well with one probe per well into a 6-well plate. After culturing to 70% confluence, treat with the drug, discard the culture medium, digest with trypsin without EDTA, wash twice with pre-cooled PBS, add 1 mL of 10 μmol / L DCFH-DA probe, incubate at 37°C in the dark for 20 min, centrifuge, wash three times with PBS, and analyze using the FITC channel of flow cytometry.

[0066] like Figure 27 As shown, the DCFH-DA fluorescent probe was used to react with ROS, and the results showed that the fluorescence intensity of the drug-treated group was enhanced compared with the control group; the results indicate that AuNRs exert a photothermal effect to increase the ROS content of B16 cells.

[0067] 8. Cellular reactive oxygen species detection (confocal microscopy) Logarithmically grown B16 cells were planted at 5 × 10⁶ cells per well. 5 Cells were seeded at a density of 100 cells / well in 6-well plates and incubated at 37°C until 70% confluence was achieved. Experimental groups were: Control, NIR, Hyd, AuNRs, AuNRs+NIR, AuNRs-Hyd, and AuNRs-Hyd+NIR. After treatment, the culture medium was discarded, cells were digested with EDTA-free trypsin, and washed twice with pre-cooled PBS. ROS levels were measured using the Beyotime S0033S kit, and observed and imaged using confocal microscopy.

[0068] like Figures 28-29 As shown, the DCFH-DA fluorescent probe was used to react with ROS, and the results showed that the fluorescence intensity of the drug-treated group was enhanced compared with the control group, which was consistent with the results of the flow cytometry above; the results indicate that AuNRs exert a photothermal effect to increase the ROS content of B16 cells.

[0069] 9. Effects of measuring changes in mitochondrial membrane potential Mitochondrial membrane potential was detected using the JC-1 probe and flow cytometry. Cells were grouped as follows: Control, NIR, Hyd, AuNRs, AuNRs+NIR, AuNRs-Hyd, and AuNRs-Hyd+NIR. B16 cells were then cultured at a rate of 5 × 10⁻⁶ cells / cells. 5 Each cell / well was seeded into a 6-well plate and cultured to 70% confluence. Serum was then starved for 12 h, followed by treatment with various drugs for 24 h. The cells were digested with EDTA-free trypsin, washed twice with pre-cooled PBS, and 0.5 mL of JC-1 working solution was added. The plates were incubated at 37°C for 20 min, centrifuged at 600×g for 5 min, washed with PBS, and then analyzed.

[0070] like Figures 30-31As shown, compared with the Control treatment, the percentage of cells with mitochondrial membrane depolarization (shown as green fluorescence) increased in the drug-treated group, resulting in a decrease in mitochondrial membrane potential.

[0071] 10. Effects of AuNRs on the viability of normal HaCaT cells HaCaT cells were seeded into two 96-well plates and cultured in a cell culture incubator for 24 h. Then, AuNRs at concentrations of 0, 5, 10, 15, 20, 25, 50, 100, and 128 μg / mL were added and cultured under 808 nm near-infrared light for 24 h and 48 h, respectively. The absorbance at 450 nm was then measured using a microplate reader.

[0072] like Figure 32 As shown, cell viability gradually decreased with increasing AuNRs concentration, indicating mild toxicity to the normal HaCaT cell line.

[0073] 11. Effects of AuNRs-Hyd on the viability of normal HaCaT cells HaCaT cells were seeded into two 96-well plates and cultured in a cell culture incubator for 24 h. Then, AuNRs-Hyd extract at concentrations of 0, 5, 10, 15, 20, 25, 50, 100, and 150 μg / mL was added and the cells were irradiated with 808 nm near-infrared light for 24 h and 48 h, respectively. The absorbance at 450 nm was then measured using a microplate reader.

[0074] like Figure 33 As shown, the cell viability assay of HaCaT cells by AuNRs-Hyd shows that loading AuNRs with AuNRs-Hyd reduces the cytotoxicity of bare gold nanorods (especially the cationic surfactant CTAB adsorbed on the surface) to normal cells that are not sufficiently modified or still contain residual synthetic reagents; indicating that AuNRs-Hyd has good biocompatibility.

[0075] 12. Hemolysis test The hemolysis rate of AuNRs-Hyd extract was assessed using rabbit erythrocytes. AuNRs-Hyd was extracted with PBS at a ratio of 1:3 at 37°C for 12 h, and diluted to obtain extracts of 128, 64, 32, 16, 8, and 4 μg / mL. AuNRs of the same concentration were used as controls. PBS (negative) and 5% Triton-X (positive) were also used. 485 μL of hemolysis buffer was taken, 15 μL of washed rabbit erythrocyte pellet was added, and then 15 μL of the test drug was added. The mixture was incubated at 37°C for 30 min. After centrifugation, the supernatant was collected into a 96-well plate, and the absorbance at 543 nm was measured to calculate the hemolysis rate.

[0076] like Figures 34-36 As shown, the hemolysis rates of both the AuNRs and AuNRs-Hyd treatment groups were below 2%, which is lower than the 5% hemolysis standard; indicating that the AuNRs-Hyd provided by this invention has good blood compatibility.

[0077] 13. Immunofluorescence detection of AuNRs-Hyd on normal HaCaT cells The biocompatibility of AuNRs-Hyd cells was verified by Calcein-AM (live cells, green) and PI (dead cells, red) staining. The cells were divided into Control, Hyd, AuNRs, and AuNRs-Hyd groups. After 24 h of cell treatment, the cells were washed with PBS, and Calcein-AM / PI mixture (2:1:1000) was added. The cells were incubated at room temperature in the dark for 15 min and observed under a confocal microscope.

[0078] like Figure 37 As shown, AuNRs-Hyd did not have a significant killing effect on normal HaCaT cells, demonstrating good biocompatibility.

[0079] 14. Western blot experiment The expression of copper death-related proteins FDX1 and DLAT was detected by Western blot. B16 cells were used at a concentration of 3 × 10⁻⁶. 5 Proteins were seeded per well in 6-well plates. After drug treatment, the plates were washed three times with PBS, and proteins were extracted on ice with RIPA lysis buffer. After mixing with loading buffer, the proteins were denatured at 100°C. After SDS-PAGE electrophoresis, transfer to a membrane, and blocking, FDX1 and DLAT primary antibody (1:1000) were added and incubated overnight at 4°C. After washing with PBST, secondary antibody (1:2000) was added and incubated at room temperature for 1 h. ECL was used for imaging, and the gray values ​​of the bands were analyzed using ImageJ.

[0080] Total RNA was extracted from cells in each treatment group using the TRIzol Total RNA Extraction Kit (purchased from Invitrogen) and merged into cDNA. RT-qPCR analysis was performed using GAPDH as an internal reference gene. The primers used were: FDX1-F:AAAGTCTCCTGAGGAACTGAAG (SEQ ID NO.1); FDX1-R: AGGGGCCATCCACAGTCTTC (SEQ ID NO.2); DLAT-F: ATGTCAGTGTTGCGGTCAGT (SEQ ID NO.3); DLAT-R:CGTAAAAGTGCCACCCTGGA (SEQ ID NO.4); GAPDH-F: GGACGAGATCCCTCCAAAAT (SEQ ID NO. 5); GAPDH-R: GGCTGTTGTCATACTTCTCATGG (SEQ ID NO. 6).

[0081] The amplification system consisted of a total volume of 20 μL, containing SYBR Green Master Mix, 0.2 μM forward and reverse gene-specific primers, and an appropriate amount of cDNA template. The amplification program was as follows: 95 °C pre-denaturation for 5 min, followed by 40 cycles (95 °C denaturation for 15 s, 60 °C annealing / extension for 30 s). The relative mRNA expression level of the target gene was calculated using the 2^(-ΔΔCt) method. All samples were tested in triplicate.

[0082] like Figures 38-40 As shown in the Western blot results, compared with the control group, the expression of FDX1 and DLAT proteins in the AuNRs-treated group and the AuNRs+NIR-treated group were significantly increased, especially in the light-treated group. This result suggests that AuNRs+NIR combined treatment can significantly inhibit the growth of melanoma cells by inducing copper death.

[0083] 15. In vivo anti-tumor experiments To investigate whether AuNRs-Hyd could enhance the therapeutic effect in vivo, B16 cells (1×10⁶) were injected into the right ventral region of sex C57BL / 6 mice. 6 A subcutaneous tumor model was established using 100 μL of laser light. Male C57BL / 6 mice (purchased from Liaoning Changsheng Biotechnology Co., Ltd.) were randomly divided into 7 groups: Control (saline), NIR, Hyd, AuNRs, AuNRs+NIR, AuNRs-Hyd, and AuNRs-Hyd+NIR. Treatment began when the tumor volume reached 100 mm³. Body weight and tumor volume (V = L×W² / 2) were monitored every 2 days, with a 1-day interval between each treatment course. The NIR group received laser irradiation for 5 minutes (the light source was approximately 3 cm away from the tumor). After 12 days of treatment, the mice were sacrificed, the tumors were weighed and photographed, and the heart, liver, spleen, lungs, and kidneys were collected for H&E staining. The tumor tissues were then subjected to H&E and Ki67 immunofluorescence detection.

[0084] like Figures 41-42 As shown, during the observation period, the tumor volume curves indicated that tumor growth in mice treated with AuNRs, AuNRs-Hyd, AuNRs+NIR, and AuNRs-Hyd+NIR showed a slowing trend; among them, AuNRs-Hyd+NIR had the most significant effect. like Figures 43-45As shown, the body weight of mice in each treatment group did not fluctuate significantly, indicating that AuNRs-Hyd has good biocompatibility. Compared with the Control (saline), NIR, and Hyd treatment groups, the tumor inhibition rates of the AuNRs, AuNRs-Hyd, AuNRs+NIR, and AuNRs-Hyd+NIR treatment groups were significantly higher; among them, the AuNRs-Hyd+NIR treatment group showed the most significant effect.

[0085] like Figure 46 As shown, the morphology of tumor cells in mice treated with AuNRs was gradually destroyed, and the nuclear disintegration of tumor cells in mice treated with AuNRs-Hyd+NIR was the most prominent.

[0086] like Figure 47 As shown, the H&E staining images reveal that the structures of each organ remain intact without obvious damage, indicating that the AuNRs-Hyd provided by this invention has good biocompatibility.

[0087] 16. AuNRs-Hyd's in vivo wound healing properties and anti-tumor recurrence effects To establish a residual B16 melanoma model after surgery, 100 μL of B16 cell suspension (1.0 × 10⁻⁶ cells) was used. 6 (Number of tumor cells / mL) was subcutaneously injected into the right posterior abdomen of male C57BL / 6J mice until the tumor volume reached approximately 100 mm. 3 Surgical resection was performed afterwards, with approximately 40mm intentionally preserved. 3 Residual tumors were used to simulate postoperative microlesions. Mice were randomly divided into 5 groups: normal group, saline group, AuNRs-Hyd group, and AuNRs-Hyd+NIR group. The hydrogel dressing was changed every 2 days. Body weight, tumor volume and wound condition were monitored on days 3, 6 and 12. Mice were sacrificed on day 12 and wound tissue was taken for Ki67 immunohistochemical staining.

[0088] Given that AuNRs-Hyd possesses excellent photothermal conversion and catalytic properties, its in vivo tumor-suppressing ability was evaluated, and the results showed excellent anti-tumor effects. Considering the risk of recurrence after melanoma surgery, its potential for inhibiting recurrence was further explored.

[0089] like Figure 48 As shown, the tumor volume reached 100 mm. 3 At that time, a full-thickness skin defect model (approximately 1 cm in diameter) was established, with a residual tumor mass of 5 mm in diameter (e.g., Figure 48 (As shown in Part A); the wounds in the normal group, AuNRs-Hyd group, and AuNRs-Hyd+NIR group healed gradually, while the wounds in the other groups healed more slowly (e.g., ...). Figure 48 (As shown in the middle BC section); there was no significant change in the body weight of mice in each group (e.g., Figure 48(As shown in Part D); The saline and Hyd groups showed significant recurrence of residual tumors post-surgery, while the AuNRs-Hyd+NIR group showed no significant increase in tumor growth within 12 days, indicating that it can effectively inhibit post-operative tumor recurrence (e.g., ...). Figure 48 (As shown in sections B and E); almost no Ki67 positive staining was observed in the normal group and the AuNRs-Hyd+NIR group (e.g., Figure 48 As shown in section F, AuNRs-Hyd can significantly inhibit the proliferation of residual tumor cells under near-infrared radiation. In summary, photothermal responsive AuNRs-Hyd, as a multifunctional hydrogel, shows promising application prospects in postoperative tumor treatment and tissue regeneration.

[0090] 17. In vivo assessment of postoperative wound healing in AuNRs-Hyd Female Kunming mice (28-30 g, purchased from Liaoning Changsheng Biotechnology Co., Ltd.) were used to establish a full-thickness skin defect model with a diameter of 1 cm on their backs. The mice were divided into groups and treated as follows: saline (blank group), NIR, Hyd, AuNRs-Hyd, and AuNRs-Hyd+NIR. The gel dressing was changed every 2 days and laser treatment was performed. The wound healing was monitored on days 1, 4, 8, and 12 after treatment. Samples were collected for H&E staining to assess tissue morphology and Masson staining to assess collagen deposition and inflammatory response.

[0091] To evaluate the wound healing ability of hydrogel after melanoma surgery, a full-thickness skin defect model was established on the back of a mouse (1 cm × 1 cm, e.g., Figure 49 (As shown in Part A). Healing status of each group at different time points is as follows. Figure 49 As shown in Part B, all wounds showed congestion and exudation on day 0 post-surgery; by day 4, epithelialization had occurred in all groups, and the wounds had shrunk, with the AuNRs-Hyd+NIR group showing the most significant shrinkage, while the Hyd and AuNRs-Hyd groups showed a small amount of scab formation; by day 8, the wounds in all groups had further shrunk, with the AuNRs-Hyd+NIR group showing even more significant shrinkage; by day 12, the AuNRs-Hyd+NIR group showed the fastest healing, less scab formation, and a tendency for new hair growth. Figure 49 As shown in Section C, the healing rate analysis is consistent with the above results; as Figure 49 As shown in section D, H&E staining results indicate that the AuNRs-Hyd and AuNRs-Hyd+NIR groups showed healthier healing processes and significantly reduced inflammatory infiltration compared to the Control and NIR groups. Figure 49 As shown in section E, Masson staining results revealed a significant increase in collagen fiber deposition and myofibroblast formation in the AuNRs-Hyd+NIR group. In conclusion, AuNRs-Hyd demonstrates significant potential in wound repair, providing a novel strategy for postoperative wound management.

[0092] The specific embodiments of the present invention disclosed above are merely illustrative of the invention. These embodiments do not exhaustively describe all details, nor do they limit the invention to the specific embodiments described. Many modifications and variations can be made based on the content of this specification. This specification selects and specifically describes these embodiments to better explain the principles and practical applications of the invention, thereby enabling those skilled in the art to better understand and utilize the invention.

Claims

1. A method for preparing a polysaccharide hydrogel from Auricularia auricula-judae, characterized in that, The preparation method includes the following steps: S1: Weigh CTAB and dissolve it in deionized water. Stir until the solution is completely transparent. Add HAuCl4 solution and mix well to obtain a mixed solution. Place the mixed solution in an ice bath to cool to 0℃. Then add NaBH4 solution and stir immediately for 30 s. When the solution color changes from light yellow to dark brown, the reaction is complete, and the gold nano-seed solution is obtained. Seal the gold nano-seed solution and let it stand at room temperature for ≥2 h. S2: Weigh CTAB and dissolve it in deionized water. Stir until the solution is completely transparent. Add HAuCl4 solution and AgNO3 solution in sequence, stir for 30 seconds, mix well, and then add L-AA solution to obtain the growth solution. S3: Using a pipette, slowly and evenly add the gold nano-seed solution obtained in S1 to the growth solution obtained in S2. Immediately after the addition is complete, stir at 700 rpm for 30 s. Seal the mixed solution and place it in a static environment for ≥6 h. When the solution turns pink, the reaction is complete. Centrifuge at 12000 rpm for 15 min, discard the supernatant, and resuspend the precipitate with deionized water. Repeat the washing 2-3 times to obtain the gold nanorod solution. S4: Weigh out the polysaccharide of Auricularia auricula-judae and dissolve it in an alcohol-water solution. Add NaIO4 solution and react in the dark for 6 h. Add ethylene glycol to stop the reaction. Stir for 30 min. Add ethanol and stir for 5 min. Let stand for 2 h. Filter and purify by dialysis with distilled water for 3 days. Freeze dry to obtain oxidized Auricularia auricula-judae polysaccharide. S5: Weigh carboxymethyl chitosan and dissolve it in phosphate buffer, stir well to obtain solution A; weigh sodium periodate and mix it with the oxidized auricularia polysaccharide obtained in S4 to obtain a mixture; dissolve the mixture in phosphate buffer and stir well to obtain solution B; S6: Mix solution A obtained in S5 with the gold nanorod solution obtained in S3 until homogeneous. Slowly add solution B obtained in S5 under continuous stirring and continue stirring to mix thoroughly. Allow the mixture to stand at room temperature to react and obtain the auricularia auricula polysaccharide hydrogel.

2. The preparation method according to claim 1, characterized in that, The mass-to-volume ratio of CTAB, deionized water, HAuCl4 solution, and NaBH4 solution in S1 is 0.364 g: 10 mL: 0.25 mL: 0.6 mL; the concentration of the HAuCl4 solution is 0.025 M, and the concentration of the NaBH4 solution is 0.01 M.

3. The preparation method according to claim 1, characterized in that, The mass-to-volume ratio of CTAB, deionized water, HAuCl4 solution, and AgNO3 solution in S2 is 0.728 g: 40 mL: 2.0 mL: 0.4 mL; the concentration of the HAuCl4 solution is 0.025 M, and the concentration of the AgNO3 solution is 0.01 M.

4. The preparation method according to claim 1, characterized in that, The mixing volume ratio of the growth solution and the gold nanoseed solution in S3 is 42.72 mL: 0.08 mL.

5. The preparation method according to claim 1, characterized in that, The mass-volume ratio of the oxidized auricularia auricula polysaccharide, the alcohol-water solution, and the NaIO4 solution in S4 is 2.0 g: 25 mL: 25 mL; the volume ratio of alcohol to water in the alcohol-water solution is 1:1; the concentration of the NaIO4 solution is 8%; the amount of ethylene glycol added is 10 mL; and the amount of ethanol added is 2 mL.

6. The preparation method according to claim 1, characterized in that, In S5, the mass-volume concentration of carboxymethyl chitosan in solution A is 3.5%; the mass-volume concentration of sodium periodate in the mixture is 8%; and the mass-volume concentration of the mixture in solution B is 3.5%.

7. The preparation method according to claim 1, characterized in that, The mixing volume ratio of solution A, gold nanorod solution and solution B in S6 is 1.5 mL: 100 μL: 1.5 mL.

8. A polysaccharide hydrogel of Auricularia auricula-judae, characterized in that, The *Auricularia auricula-judae* polysaccharide hydrogel is obtained by the preparation method described in any one of claims 1 to 7.

9. The use of the *Auricularia auricula-judae* polysaccharide hydrogel according to claim 8 in the preparation of products for improving / treating melanoma.

10. The application according to claim 9, characterized in that, The application is achieved by combining the polysaccharide hydrogel of Auricularia auricula-judae with irradiation by 808 nm near-infrared light.