Use of kaempferol-3-o-neohesperidoside in the preparation of a medicament for treating depression

By regulating the microglial phenotype through kaempferol-3-O-neohesperidin and reducing neuroinflammation, this approach addresses the ineffectiveness of existing antidepressants, achieves the effect of improving depressive symptoms, and provides a safe and effective treatment option.

CN122376607APending Publication Date: 2026-07-14KUNMING UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
KUNMING UNIV OF SCI & TECH
Filing Date
2026-05-11
Publication Date
2026-07-14

Smart Images

  • Figure CN122376607A_ABST
    Figure CN122376607A_ABST
Patent Text Reader

Abstract

The application discloses a new application of kaempferol-3-O-neohesperidoside in preparation of a treatment of depression, and experiment results show that the kaempferol-3-O-neohesperidoside has an effect of improving cognitive impairment in LPS-induced depression mice, and it is proved that the kaempferol-3-O-neohesperidoside has an effect of treating depression; and the kaempferol-3-O-neohesperidoside reduces neuroinflammation of BV2 cells in an in-vitro experiment; these evidences show that the kaempferol-3-O-neohesperidoside can improve depression symptoms, and has development potential as a new anti-depression candidate drug.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the application of kaempferol 3-neohesperidoside in the treatment of depression, and belongs to the field of pharmaceutical technology. Background Technology

[0002] Depression is a complex neuropsychiatric disorder caused by a combination of genetic, psychosocial, and biological factors. Its main clinical features are significant and persistent mood swings and cognitive impairment, often accompanied by psychotic symptoms. In severe cases, it can lead to self-harm and suicide, and is a major cause of the global mental health burden. The disease has a high incidence, relapse rate, and mortality rate. Its etiology is complex, and the exact pathogenesis remains unclear. Current clinical treatments have significant limitations; approximately 65% ​​of individuals do not respond to first-line antidepressant medication, and one-third still struggle to achieve remission after multiple treatments. There is an urgent need for novel and highly effective antidepressant treatments. In recent years, numerous studies have shown a close link between long-term chronic stress, immune system disorders, and depression. Increased blood-brain barrier permeability leads to a surge in inflammatory factors in the brain, triggering a neuroinflammatory cascade, damaging normal neuronal function, and contributing to the pathogenesis of depression.

[0003] Neuroinflammation is typically accompanied by activation of microglia, astrocytes, and elevated levels of inflammatory cytokines in the brain. Microglia play a crucial role in stress-induced mental and behavioral abnormalities; therefore, targeted regulation of microglia-mediated neuroinflammation has become an important direction in the development of antidepressant drugs. The microenvironment mediated by the M1-M2 microglia phenotypic switching plays a decisive role in the fate of neurons in this disease. M2-type microglia exert neuroprotective functions by promoting the release of anti-inflammatory factors (such as IL-10 and Arg1), while M1-type microglia induce neuroinflammation by promoting the release of pro-inflammatory cytokines (such as IL-6 and TNF-α). In depression-related studies, LPS (lipopolysaccharide) is often used to induce BV2 cell polarization towards the M1 type, leading to increased release of pro-inflammatory factors (such as IL-6 and IL-1β), while inhibiting M1 activation and promoting M2 polarization can significantly reduce inflammation levels.

[0004] Kaempferol-3-O-neohesperidin (K3N) is a flavonoid glycoside derived from kaempferol, characterized by the combination of kaempferol and neohesperidin via a hydroxyl group at the 3-position. Flavonoids are a class of polyphenolic secondary metabolites widely found in plants, abundant in vegetables, fruits, and some beverages, and possess various biological activities such as antioxidant, anti-inflammatory, and antimutagenic effects. Currently, there are no reports on the neuroprotective effects of K3N. Summary of the Invention

[0005] This invention provides a novel use for kaempferol-3-O-neohesperidin, namely its application in the preparation of drugs for treating depression.

[0006] The structural formula of kaempferol-3-O-neohesperidin is as follows: .

[0007] The active ingredient (or active ingredient) of the drug for treating depression of the present invention is kaempferol-3-O-neohesperidin, and one or more pharmaceutically acceptable excipients may be added, or it may be compounded with other active ingredients to exert a therapeutic effect; in addition to being made into tablets, the drug may also be made into various pharmaceutically acceptable forms such as pills, powders, capsules, granules, oral liquids and injections.

[0008] This invention uses LPS treatment to treat BV2 cells to simulate neurodepressive-like injury. This depression model exhibits a significant trend of increased levels of cellular inflammatory factors, consistent with the effects of depression on human physiological indicators. Furthermore, treatment of LPS-induced BV2 cells with K3N revealed that K3N reduced the expression of cellular inflammatory factors. In vitro experiments demonstrate that K3N can protect nerve cells and reduce neuroinflammation, thereby alleviating depressive symptoms. Simultaneously, in vivo experiments showed that K3N improved cognitive impairment in LPS-induced depressed mice, demonstrating that K3N has a therapeutic effect on depression.

[0009] This invention reveals the therapeutic potential of kaempferol-3-O-neohesperidin (K3N) in addressing the pathological mechanism (neuritis) of depression. As a natural flavonoid compound, K3N has high safety and few side effects with long-term use, improving the clinical value of depressive symptoms. It provides an alternative treatment option with fewer side effects and high compliance, and is especially suitable for patients on long-term medication. Therefore, K3N has the potential to become a novel antidepressant drug candidate. Attached Figure Description

[0010] Figure 1 The results of CCK8 assay for detecting the toxicity of K3N to BV2 cells; Figure 2 The results of Q-PCR detection of mRNA expression of inflammatory factors IL-6 (left) and IL-1β (right) in BV2 cells; Figure 3 The results of Q-PCR detection of mRNA expression of inflammatory factors TNF-α (left) and iNOS (right) in BV2 cells; Figure 4 The results of Western Blot analysis of the expression of inflammatory factor-related proteins (TNF-α, IL-6, Arg1, iNOS) in BV2 cells were obtained. Figure 5The trajectory diagram of the mouse open field experiment showing the effect of K3N on the motor ability of LPS-induced depression model mice; Figure 6 The left and right bar charts show the effects of K3N on the motor abilities of LPS-induced depressed model mice, showing the total distance traveled (left) and the average speed of movement. Figure 7 A bar chart of the sugar water preference experiment; Figure 8 A bar chart of the resting time in the tail suspension experiment; Figure 9 A bar chart showing the static time during the forced swimming experiment. Detailed Implementation

[0011] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments, but these embodiments should not be used to explain the limitation of the present invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available. Example 1: Detection experiment of K3N toxicity to BV2 cells Prepare DMEM medium containing 10% fetal bovine serum (FBS) and 100 U / mL penicillin-streptomycin, and then adjust the BV2 cell density to 5 × 10⁶ cells / mL using the above DMEM medium. 4 The cells / mL were then seeded into 96-well plates at a volume of 100 μL per well with the adjusted BV2 cell suspension. The cells were then cultured at 37°C and 5% CO2 for 24 h to allow the BV2 cells to adhere to the plate. BV2 cells adherent to the wells of a 96-well plate were incubated with DMEM medium containing 0, 10, 20, 30, 40, or 60 μM K3N (100 μL per well) for 24 hours. Then, 10 μL of CCK8 reagent was added to each well, gently mixed, and incubated at 37°C in the dark for 1 hour. The absorbance (OD) was then measured at 450 nm using a microplate reader. A control group (BV2 cells + DMEM medium without K3N) and a blank control group (100 μL of DMEM medium) were also set up. Cell viability is calculated as follows: Cell viability (%) = ×100%; See results Figure 1 As can be seen from the figure, there was no difference between the K3N-treated group and the control group. The results indicate that K3N ketone concentrations below 60 μM have no cytotoxicity on BV2 cells.

[0012] Example 2: Regulation of LPS-induced expression of inflammatory factors in BV2 cells by K3N BV2 cells were resuspended in culture dishes and seeded into 6-well culture plates. After 24 hours of culture and cell adhesion, blank control group, LPS model group, and K3N administration groups (5, 10, and 20 μM) were set up. The blank control group received no intervention except for the addition of an equal volume of culture medium. The LPS model group received only LPS for modeling, without drug administration. The K3N administration groups were pre-protected by adding different concentrations of K3N to the cells for 24 hours. After the pre-protection treatment, LPS modeling was performed on the LPS model group and K3N administration groups at a concentration of 1 mg / kg, added at a ratio of 1.5 μL LPS per 1.5 mL of culture medium. After modeling, the cells were cultured for another 6 hours, and then the cells were collected. Total RNA was extracted by washing with pre-cooled PBS and adding TRIzol lysis buffer. The RNA concentration and purity were measured, and then the RNA was reverse transcribed into cDNA using a reverse transcription kit. Then, using cDNA as a template, amplification was performed using the following primers, and the relative expression levels of TNF-α, IL-6, IL-1β and iNOS were calculated (2^(-ΔΔCt) method), with GAPDH as an internal control.

[0013] TNF-α-F: CACCATGAGCACGGAAAGCA; TNF-α-R: GCAATGACTCCAAAGTAGACC; IL-6-F: GAGAAAAGAGTTGTGCAATGGCA; IL-6-R: AGTGCATCATCGCTGTTCATACA; IL-1β-F:TGGGCCTCAAAGGAAAGAAT; IL-1β-R:CAGGCTTGTGCTCTGCTTGT; iNOS-F: CACCTACTTCCTGGACATCACTAC; iNOS-R: GTACTCTGAGGGCTGACACAAG; GAPDH-F: GCCACCCAGAAGACTGTGGAT; GAPDH-R: GGAAGGCCATGCCAGTGA; The real-time PCR reaction system consisted of: 10 μL of SYBR Green Master Mix (2×), 0.4 μL each of primers (10 μmol / L), 1 μL of template cDNA, and ddH2O to bring the total volume to 20 μL. The reaction conditions were: 94℃ for 15 s; denaturation at 94℃ for 15 s, annealing at 60℃ for 5 s, extension at 72℃ for 10 s, for 40 cycles. After the reaction, the amplification curve was adjusted to a linear distribution, and the Ct values ​​of each sample were read for relative quantification.

[0014] The results are as follows Figure 2 , 3 As shown, the RNA of TNF-α, IL-6, IL-1β and iNOS increased significantly after LPS induction, while K3N reversed this process and significantly reduced the expression of inflammatory factors, demonstrating that K3N has the ability to alleviate neuroinflammation in in vitro experiments.

[0015] Example 3: Western Blot analysis of the effect of K3N on the expression of LPS-induced inflammation-related proteins in BV2 cells BV2 cells were resuspended in culture dishes and seeded onto 6-well culture plates. After culturing for 24 hours and cell adhesion, blank control group, LPS model group, and K3N administration group (5, 10, 20 μM) were set up. The blank control group received no intervention except for the addition of an equal volume of culture medium. The LPS model group received only LPS for modeling without pre-administration. The K3N administration group was pre-protected by adding different concentrations of K3N reagent to the cells for 24 hours. After the pre-protection treatment, LPS modeling was performed on the LPS model group and all K3N administration groups at a concentration of 1 mg / kg, with 1.5 μL of LPS added per 1.5 mL of culture medium. After modeling, the cells were cultured for another 24 hours, followed by lysis with RIPA lysis buffer to extract proteins for Western blotting.

[0016] The results are as follows Figure 4 As shown, the protein expression of inflammatory cytokines TNF-α, IL-6, and iNOS in the LPS group significantly increased after modeling, while the protein expression of the anti-inflammatory cytokine Arg1 in the LPS group significantly decreased after modeling, and K3N reversed this process. This demonstrates that K3N has the ability to reduce neuroinflammation in vivo.

[0017] Example 4: Constructing an LPS-induced C57BL / 6J mouse model to investigate the therapeutic effect of K3N on depression. 1. Establishment of an acute depression model in mice using LPS Thirty-six male C57B1 / 6J mice were acclimatized for one week before the experiment. The mice were housed at a temperature of 20-24℃ and a relative humidity of 40%-80%, with free access to food and water. Before the experiment, the mice were randomly divided into 6 groups of 6 mice each: a control group, an LPS (1 mg / kg) group, an LPS (1 mg / kg) + fluoxetine (Flu, 20 mg / kg) group, an LPS (1 mg / kg) + K3N (5 mg / kg) group, an LPS (1 mg / kg) + K3N (10 mg / kg) group, and an LPS (1 mg / kg) + K3N (20 mg / kg) group.

[0018] 2. The modeling method and drug administration regimen are as follows: From the day of modeling, except for the control group, each group was given a protective drug at a different dose every morning for 6 consecutive days. After the last administration, mice in each group were given a single intraperitoneal injection of LPS (1 mg / kg), while mice in the control group were given a single intraperitoneal injection of physiological saline. Behavioral tests were conducted 24 hours later.

[0019] 3. Behavioral experiments 3.1 Open Field Experiment (OFT) The mice were transferred to the testing room in advance, and the instruments were then adjusted. Before the test, 75% ethanol was sprayed on the mice and the experimental chamber was wiped clean with paper towels. During the experiment, the mice were held by the base of their tails (about 1 / 3) and placed in the central area of ​​the experimental chamber. At the same time, the video acquisition and analysis system was activated, and the video was taken for 10-15 minutes. After the acquisition was completed, the excrement of the previous animal was removed, and the odor was extracted with 75% ethanol. After the chamber was dry, the experiment was conducted on the next animal.

[0020] See results Figure 5 The figure shows the movement trajectory of mice in the open field experiment. The LPS model group showed reduced exploratory behavior, while the positive control group and K3N group showed increased movement frequency, indicating that the drug may alleviate the reduction of depression-related behaviors.

[0021] See results Figure 6 As can be seen from the figure, the total movement distance in the LPS group was significantly lower than that in the blank group (Conl), indicating that the depression model was successful; the positive control group and the K3N group both showed an increase in the total movement distance.

[0022] 3.2 Sucrose Preference Test (SPT) Prior to SPT, all mice were housed individually and placed in a 1% sucrose solution for 24 hours. Then, after 12 hours of water deprivation, each mouse was provided with two pre-weighed bottles containing a 1% sucrose solution and drinking water. The positions of the two bottles were randomized and exchanged after 6 hours to avoid spatial bias. After 12 hours, the intake of sucrose solution and water was measured and recorded, and the sucrose preference (SP) value was calculated. The degree of sucrose preference was calculated using the following formula: Sucrose preference (%) = (Sucrose solution consumption / (Sucrose solution consumption + Tap water consumption) × 100%.

[0023] See results Figure 7 As can be seen from the figure, the sucrose preference rate was significantly reduced in the LPS model group, and the loss of pleasure was completely reversed in the high-dose K3N group.

[0024] 3.3 Suspended Tail Test (TST) Attach medical tape to the tip of the mouse's tail about 1 cm away and suspend the mouse 50 cm above the ground. Suspend each mouse for 6 minutes, with the first 2 minutes as acclimatization time, and record the cumulative stillness time for the remaining 4 minutes. The criteria for judging a mouse as still are: its limbs are completely still or exhibit only slight limb tremors.

[0025] See results Figure 8 As can be seen from the figure, the resting time in the LPS group was significantly increased; the resting time in the K3N group decreased with increasing dose, indicating that the drug K3N has an antidepressant effect.

[0026] 3.4 Forced Swimming Test (FST) The mice were placed in a transparent cylinder 45cm high and 20cm in diameter, with a water depth of 15cm and a water temperature of 23±1℃. The mice were gently removed from their cages and slowly placed into the water. Once the mice had regained their balance, the timing was started, and the video recording lasted for 6 minutes. The swimming time and stillness time in the last 4 minutes were recorded and evaluated.

[0027] See results Figure 9 As can be seen from the figure, the resting time in the LPS group was significantly longer than that in the control group (Conl group), and the resting time in the K3N group (especially the high-dose group) was significantly reduced, indicating that the drug has a strong antidepressant effect.

Claims

1. The application of a flavonoid compound, kaempferol-3-O-neohesperidin, in the preparation of a drug for treating depression, wherein the chemical structural formula of kaempferol-3-O-neohesperidin is as follows: 。