Products that promote fibroblast adhesion, proliferation and / or migration and uses thereof

Abstract

The present application belongs to the field of medicine, and particularly relates to products for promoting adhesion, proliferation and / or migration of fibroblasts and uses thereof. Through a large number of screening studies, the present application has obtained a core functional region of natural human collagen XII. Further, based on the above-mentioned core functional region, the present application has successfully expressed and prepared a recombinant humanized collagen XII with biological activity for the first time. Based on the above-mentioned recombinant humanized collagen XII, the present application simultaneously provides products containing the recombinant humanized collagen XII or related biological materials, which have good effects of promoting adhesion, proliferation and / or migration of cells (especially fibroblasts). The products can be used as a new type of biological material derived from human body for medical or non-medical uses of multiple tissues and organs of human body, for example, can be used in tissue repair / filling / volume augmentation scenarios, and can also be used for prevention and treatment of pelvic floor dysfunction.

Description

Technical Field

[0001] This invention belongs to the pharmaceutical field, specifically relating to products that promote fibroblast adhesion, proliferation and / or migration and their uses, and more specifically relating to products containing recombinant type XII humanized collagen for promoting fibroblast adhesion, proliferation and / or migration and their uses. Background Technology

[0002] Pelvic floor dysfunction (PFD) is a common gynecological condition, clinically manifesting as stress urinary incontinence (SUI), vaginal laxity syndrome (VLS), pelvic organ prolapse (POP), and female sexual dysfunction (FSD). Data shows that the prevalence of SUI in my country is 22.9%, while in recent years in the United States, the prevalence has reached as high as 25%, with 2.9% of patients presenting with POP, 9.4% with fecal incontinence, and 17.1% with urinary incontinence. The common underlying cause of these conditions is insufficient mechanical support of the pelvic floor structures (including the pubourethral ligament, pelvic fascia, and periurethral connective tissue). Specific mechanisms include: loss and reduction of type I / III structural collagen fibrils in the dense connective tissue of the periurethral / pelvic floor; functional decline of vaginal / pelvic floor fibroblasts leading to insufficient collagen synthesis; excessive collagen degradation mediated by matrix metalloproteinases (MMPs); imbalance of extracellular matrix (ECM) homeostasis; and abnormal regulatory mechanisms of collagen fiber assembly in pelvic floor ligaments.

[0003] Type XII collagen is a fibrous-associated collagen primarily found in the fibrous structures of tissues, participating in maintaining the morphology and function of fibers. Type XII collagen possesses unique structural features, including a disrupted triple helix structure and a fibronectin type III domain, enabling it to form complex networks in the extracellular matrix, thereby enhancing tissue mechanical strength. The COL12A1 gene encodes the α-chain of type XII collagen, which functions through a series of complex signaling pathways, primarily including: 1) extracellular matrix formation: Type XII collagen is an important component of the extracellular matrix, aiding in its formation and maintenance; 2) cell signaling: Type XII collagen can influence cell behavior, such as proliferation, differentiation, and migration, by interacting with receptors on the cell surface. Type XII collagen not only functions independently but also interacts with other types of collagen (such as type I and type VI collagen). This interaction allows tissues to better distribute stress under pressure, thus protecting them from damage.

[0004] Type XII collagen is highly specifically expressed in dense connective tissues of the human body that experience high mechanical stress, including core lesion sites of SUI, such as the pubourethral ligament, uterosacral ligament, pelvic fascia, periurethral connective tissue, and lamina propria of the vaginal wall. Type XII collagen acts as a molecular bridge and mechanical regulator for type I collagen fibers, its core function being to regulate the lateral aggregation, diameter uniformity, and orderly arrangement of collagen fibrils, directly determining the tensile strength, fatigue resistance, and degradation resistance of collagen fiber bundles. Furthermore, current research indicates that in postmenopausal SUI patients, the mRNA and protein expression levels of COL12A1 in the pelvic floor ligaments / periurethral tissue are significantly lower than in healthy controls, and the expression level is negatively correlated with the severity of SUI; COL12A1 gene polymorphism is significantly associated with the risk of developing SUI in women; and the deficiency of type XII collagen can directly lead to disordered arrangement of type I collagen fibrils and a sharp decrease in mechanical strength. Summary of the Invention

[0005] The problem the invention aims to solve

[0006] The inventors of this invention previously discovered that local application of recombinant type III humanized collagen can promote vaginal epithelial proliferation and enhance extracellular matrix remodeling of vaginal epithelial cells. They also explored the use of recombinant type I humanized collagen in the pelvic floor.

[0007] Based on the above research, this invention aims to provide a recombinant type XII humanized collagen and related products with excellent biological activity, developed based on human COL12A1. In addition to medical or non-medical applications for tissues and organs (e.g., for tissue repair / filling / volume enhancement), it can also provide safe and reliable treatment options and diagnostic measures for clinical symptoms such as female pelvic floor dysfunction, including pelvic organ prolapse, postmenopausal genitourinary syndrome (GSM, formerly known as atrophic vaginitis / vaginal atrophy), vaginal wall injury repair (childbirth trauma, gynecological surgical trauma, postpartum vaginal laxity), vaginal laxity syndrome, stress urinary incontinence, and female sexual dysfunction.

[0008] Solution for solving the problem

[0009] [1]. A recombinant type XII humanized collagen, wherein the amino acid sequence comprises n repeating units, where n is an integer greater than or equal to 2, and the repeating units are directly linked or linked by linking peptides; wherein the amino acid sequence of the repeating units comprises any one of the following (a)-(c):

[0010] (a) A sequence as shown in SEQ ID NO.1 or 2;

[0011] (b) A sequence in which one or more amino acid residues are added, substituted, and / or deleted, as shown in SEQ ID NO.1 or SEQ ID NO.2, while retaining biological activity;

[0012] (c) A sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 and retaining biological activity.

[0013] [2]. The recombinant type XII humanized collagen according to [1], wherein the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.1 with 1-24 amino acid residues added and retaining biological activity; preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.1 with 12 or 24 amino acid residues added and retaining biological activity; more preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.1 with 12 amino acid residues added to the N-terminus and C-terminus respectively and retaining biological activity; even more preferably, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.3, or a sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence as shown in SEQ ID NO.3 and retaining biological activity.

[0014] [3]. Recombinant type XII humanized collagen according to [1] or [2], wherein n is an integer between 2 and 20;

[0015] Preferably, n is an integer between 4 and 8;

[0016] More preferably, the amino acid sequence of the recombinant type XII humanized collagen includes the sequence shown in any one of SEQ ID NO.4-6.

[0017] [4]. A fusion protein, wherein the fusion protein is obtained by fusing recombinant type XII humanized collagen and other peptides as described in any one of [1]-[3].

[0018] [5]. A polynucleotide, wherein the polynucleotide encodes any one of [1]-[3] recombinant type XII humanized collagen or the fusion protein of [4];

[0019] Preferably, the nucleotide sequence of the polynucleotide comprises a sequence as shown in any one of SEQ ID NO. 7-9, or a sequence that hybridizes under stringent conditions to a sequence as shown in any one of SEQ ID NO. 7-9 and encodes a protein having a sequence as shown in any one of SEQ ID NO. 4-6 that promotes fibroblast adhesion, proliferation and / or migration activity.

[0020] [6]. An expression cassette, wherein the expression cassette comprises the polynucleotide described in [5];

[0021] Preferably, the expression cassette includes a control element operatively connected to the polynucleotide;

[0022] More preferably, the control element is a starter, a terminator, and / or an enhancer.

[0023] [7]. A recombinant vector, wherein the recombinant vector comprises the polynucleotide described in [5];

[0024] Preferably, the recombinant vector includes a control element operatively linked to the polynucleotide;

[0025] More preferably, the control element is a starter, a terminator, and / or an enhancer;

[0026] Even more preferably, the recombinant vector is pET-28a-Trx-His containing the polynucleotide.

[0027] [8]. A recombinant host cell, wherein the recombinant host cell comprises the expression cassette of [6] or the recombinant vector of [7];

[0028] Preferably, the recombinant host cell is a bacterium, fungus, or animal cell;

[0029] More preferably, the bacteria include Escherichia coli; the fungus includes yeast.

[0030] [9]. A method for preparing recombinant type XII humanized collagen or fusion protein as described in any one of [1]-[3], wherein the method comprises the following steps: fermenting and culturing the recombinant host cells described in [8], inducing expression, and collecting the recombinant host cells and / or the culture medium of the recombinant host cells containing the recombinant type XII humanized collagen or fusion protein, and isolating the recombinant type XII humanized collagen or fusion protein therefrom.

[0031]

[10] . A product for promoting fibroblast adhesion, proliferation and / or migration, wherein the product comprises at least one of the following: recombinant type XII humanized collagen as described in any one of [1]-[3], the fusion protein as described in [4], the polynucleotide as described in [5], the expression cassette as described in [6], the recombinant vector as described in [7], and the recombinant host cell as described in [8].

[0032] Preferably, the product is a drug, pharmaceutical excipient, biological dressing, obstetric and gynecological biomaterial, human biomimetic material, plastic and cosmetic material, organoid culture material, cardiovascular stent material, coating material, tissue filling / volume enhancement material, ophthalmic material, nerve repair and regeneration material, skin wound repair material, skin barrier repair material, muscle or bone or cartilage or ligament regeneration material, liver tissue material, vascular repair and regeneration material, 3D printed artificial organ biomaterial, or cosmetic raw material;

[0033] Preferably, the product is in the form of liquid, lyophilized powder, gel, sponge, or fiber.

[0034] Use of any of the recombinant type XII humanized collagen described in any one of [1]-[3], the fusion protein described in [4], the polynucleotide described in [5], the expression cassette described in [6], the recombinant vector described in [7], the recombinant host cell described in [8], and / or the product described in

[10] in the preparation of products for promoting extracellular matrix generation or reconstruction, tissue repair, tissue filling, and / or tissue volume enhancement;

[0035] Preferably, the tissue is bone tissue or connective tissue.

[0036]

[12] . The use of any one of the recombinant type XII humanized collagens described in [1]-[3], the fusion protein described in [4], the polynucleotide described in [5], the expression cassette described in [6], the recombinant vector described in [7], the recombinant host cell described in [8], and / or the product described in

[10] in the preparation of a medicament for the prevention and / or treatment of diseases or conditions related to type XII collagen deficiency or for the supplementation of type XII collagen.

[0037]

[13] . The use of any one of the recombinant type XII humanized collagen, [4] the fusion protein, [5] the polynucleotide, [6] the expression cassette, [7] the recombinant vector, [8] the recombinant host cell and / or

[10] the product in the preparation of a medicament for the prevention and / or treatment of pelvic floor dysfunction, pelvic organ prolapse, postmenopausal genitourinary syndrome, vaginal wall injury, vaginal laxity syndrome, stress urinary incontinence and / or female sexual dysfunction.

[0038]

[14] . A method for promoting fibroblast adhesion, promoting fibroblast proliferation, promoting fibroblast migration and / or promoting extracellular matrix generation or reconstruction, wherein the method comprises the step of contacting the recombinant type XII humanized collagen of any one of [1]-[3], the fusion protein of [4], the polynucleotide of [5], the expression cassette of [6], the recombinant vector of [7], the recombinant host cell of [8] and / or the product of

[10] with the cell;

[0039] Preferably, the cell is a mammalian cell;

[0040] More preferably, the cells are human cells;

[0041] Preferably, the cells are skin fibroblasts and / or vaginal fibroblasts;

[0042] Preferably, the promotion of fibroblast adhesion, fibroblast proliferation, fibroblast migration, and / or the promotion of extracellular matrix generation or reconstruction are carried out in vivo or in vitro.

[0043] The effects of the invention

[0044] Through extensive screening studies, this invention has identified the core functional region of natural human type XII collagen. Furthermore, based on this core functional region, this invention has, for the first time, successfully expressed and prepared a biologically active recombinant type XII humanized collagen. The amino acid composition of this protein is 100% identical to the corresponding portion of the amino acid sequence of natural human collagen, and its application in humans will not induce immune rejection or allergic reactions. Simultaneously, experimental data show that this protein possesses excellent biological activity, including promoting cell adhesion, proliferation, and migration, making it suitable for various medical and non-medical applications.

[0045] Based on the aforementioned recombinant type XII humanized collagen, this invention also provides products containing the aforementioned recombinant type XII humanized collagen or related biomaterials, which exhibit excellent efficacy in promoting cell (especially fibroblast) adhesion, proliferation, and / or migration. It can serve as a novel biomaterial derived from the human body for medical or non-medical applications in various tissues and organs, such as tissue repair / filling / volume enhancement, and for the prevention and treatment of pelvic floor dysfunction. Clinical studies have shown that abnormal vaginal wall fibroblast function and extracellular matrix metabolic imbalance are the core pathological basis of pelvic floor dysfunction. The recombinant type XII humanized collagen in this invention can promote the adhesion, proliferation, and migration of fibroblasts, especially vaginal fibroblasts, thereby improving abnormal vaginal fibroblast function, improving abnormal collagen metabolism, restoring the extracellular matrix network, and thus enhancing the biomechanical strength of the vaginal wall and surrounding ligaments, restoring vaginal elasticity and mucosal health. Furthermore, it can provide a potential therapeutic approach for the repair and functional reconstruction of pelvic floor tissue structures.

[0046] Furthermore, the preparation method of recombinant type XII humanized collagen provided by this invention is simple, and recombinant type XII humanized collagen and related products can be produced on a large scale using synthetic biology technology, with high yield. This provides a solid foundation for the large-scale preparation of medical products targeting pelvic floor dysfunction in the future. Attached Figure Description

[0047] Figure 1 Electrophoretic analysis results of purified recombinant type XII humanized collagen rhXII-1.

[0048] Figure 2 Electrophoretic analysis results of purified recombinant type XII humanized collagen rhXII-2.

[0049] Figure 3 Electrophoretic analysis results of purified recombinant type XII humanized collagen rhXII-11.

[0050] Figure 4 Results of HFB cell adhesion activity assay for recombinant type XII humanized collagen rhXII-1, rhXII-2, and rhXII-11.

[0051] Figure 5 Results of HFB cell proliferation and toxicity assays for recombinant type XII humanized collagen rhXII-1, rhXII-2, and rhXII-11.

[0052] Figure 6 Results of primary vaginal fibroblast adhesion activity assays using recombinant type XII humanized collagen rhXII-1, rhXII-2, and rhXII-11.

[0053] Figure 7 Results of primary vaginal fibroblast proliferation and toxicity assays of recombinant type XII humanized collagen rhXII-1, rhXII-2, and rhXII-11.

[0054] Figure 8 Results of primary vaginal fibroblast migration activity assay after treatment with recombinant type XII humanized collagen rhXII-1, rhXII-2, and rhXII-11 for 6 h.

[0055] Figure 9 Results of primary vaginal fibroblast migration activity assay after treatment with recombinant type XII humanized collagen rhXII-1, rhXII-2, and rhXII-11 for 12 hours.

[0056] Figure 10 Results of primary vaginal fibroblast migration activity assay after treatment with recombinant type XII humanized collagen rhXII-1, rhXII-2, and rhXII-11 for 24 h. Detailed Implementation

[0057] The embodiments of the present invention will be described below, but the present invention is not limited thereto. The present invention is not limited to the various configurations described below, and various modifications can be made within the scope of the claims. The embodiments and examples obtained by appropriately combining the technical means disclosed in different implementation schemes and examples are also included in the technical scope of the present invention.

[0058] In this invention, the terms "comprising," "having," "including," or "containing" can mean included or open-ended, and do not exclude additional, uncited elements or method steps. At the same time, "comprising," "having," "including," or "containing" can also mean closed-ended, excluding additional, uncited elements or method steps.

[0059] In this invention, the word "may" has two meanings: to perform a certain process and not to perform a certain process.

[0060] In this invention, "optional" or "optionally" means that certain substances, components, execution steps, application conditions, etc., are used or not used.

[0061] In this invention, the numerical range represented by "value A ~ value B", "value A - value B", and "value A above / below" refers to the range that includes the endpoint values ​​A and B.

[0062] In this invention, the term "about" is used to define that the numerical ranges and parameters of this invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. Unless otherwise explicitly stated, it should be understood that all ranges, quantities, values, and percentages used in this invention are modified by "about". Here, "about" generally means that the actual value is within ±5%, ±3%, ±1%, or ±0.5% of a specific value or range. Furthermore, the values ​​and ranges appearing in this invention should be understood to include systematic errors that are unavoidable in industrial production.

[0063] In this invention, the terms "some specific / preferred embodiments," "other specific / preferred embodiments," "implementation," etc., refer to specific elements (e.g., features, structures, properties, and / or characteristics) related to the described embodiment that are included in at least one of the embodiments described herein, and may or may not be present in other embodiments. Furthermore, it should be understood that the elements may be combined in any suitable manner in various embodiments.

[0064] In this invention, a "peptide" refers to a string of at least two amino acid residues linked together by covalent bonds (e.g., peptide bonds), and can be a recombinant peptide, a natural peptide, or a synthetic peptide. It may contain modified amino acids and may be separated by non-amino acid segments. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with labeled components). Peptides typically have only a primary structure (a linear sequence of amino acids) and may have a simple secondary structure. In some embodiments, the peptides described in this invention are linear.

[0065] In this invention, "protein" refers to a macromolecule composed of one or more polypeptide chains, which can possess higher-order structures and specific biological functions. Proteins typically have complete tertiary or quaternary structures. The maintenance of their conformation depends on various forces such as hydrogen bonds, hydrophobic interactions, and disulfide bonds.

[0066] In this invention, "polynucleotide" refers to a polymeric form of nucleotides of any length, whether deoxyribonucleotides or ribonucleotides, or similar compounds. Polynucleotides can have any three-dimensional structure and can perform any known or unknown function. Nucleic acid molecules can be linear or circular.

[0067] In this invention, "vector" refers to a nucleic acid delivery vehicle into which polynucleotides can be inserted. When a vector enables the expression of the protein encoded by the inserted polynucleotide, the vector is called an expression vector. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material elements they carry to be expressed in the host cells. Vectors are well-known to those skilled in the art and include, but are not limited to, plasmids, viruses, bacteriophages, Coase plasmids, transposons, and artificial chromosomes.

[0068] In this invention, "host cell" refers to a cell into which the aforementioned vector can be introduced. Host cells may include bacterial, fungal, plant, or animal cells. Examples of suitable bacteria include, but are not limited to, members of the Enterobacteriaceae family, such as strains of *Escherichia coli*. Examples of suitable fungi include, but are not limited to, *Saccharomyces cerevisiae* and *Pichia pastoris*. Examples of suitable animal host cell lines include, but are not limited to, CHO (Chinese hamster ovary cell line) and NSO cells.

[0069] In this invention, "codon optimization" refers to configuring the nucleotide sequence encoding a polypeptide to contain codons preferred by the host cell or organism in order to improve gene expression and translation efficiency in the host cell or organism.

[0070] In this invention, a "linking peptide" refers to a short peptide used to link two molecules (e.g., protein, polypeptide), and such a short peptide consists of two or more amino acid residues.

[0071] In this invention, a "tag" refers to a short peptide that is fused or linked to a target protein, thereby facilitating the soluble expression, detection, and / or purification of the recombinant protein. The tag may be fused to or linked to the N-terminus and / or C-terminus of the target protein (optionally via a linker sequence or protease cleavage site).

[0072] In this invention, a "signal peptide" refers to a short peptide that, when fused with a target protein, promotes the secretion of the target protein expressed by the cell onto the cell membrane or extracellularly. Signal peptides are typically located at the N-terminus of the target protein, and various signal peptides are known to those skilled in the art, such as, but not limited to, erythropoietin signal sequences, human insulin signal sequences, human interleukin-2 signal sequences, albumin signal sequences, etc.

[0073] In this invention, the term "identity" refers to the percentage of identical amino acids among two or more polypeptides. Sequence identity between two or more polypeptides can be determined by aligning the amino acid sequences of the polypeptides and scoring the number of positions containing identical amino acid residues in the aligned polypeptides, comparing this to the number of positions containing different amino acid residues in the aligned polypeptides. Sequence identity can be calculated by dividing the number of positions containing identical amino acid residues by the total number of amino acid residues in the polypeptide.

[0074] In this invention, amino acid addition can refer to adding 1, 2, 3 or more amino acids at any position at the C-terminus, N-terminus or between the C-terminus and N-terminus of the amino acid sequence, as long as the modified sequence completely or partially retains the activity of the original amino acid sequence.

[0075] In this invention, amino acid deletion can refer to the deletion of 1, 2, 3 or more amino acids from the amino acid sequence, as long as the altered sequence completely or partially retains the activity of the original amino acid sequence.

[0076] In this invention, amino acid substitution can refer to the replacement of amino acids at positions 1, 2, 3 or more in an amino acid sequence with other amino acids, as long as the altered sequence completely or partially retains the activity of the original amino acid sequence.

[0077] Amino acid substitution can be conserved amino acid substitution, referring to the substitution of several amino acids with amino acids of similar or related properties compared to the original amino acid sequence, forming a peptide (conserved variant peptide). For example, these conserved variant peptides can be generated based on the following amino acid substitutions: substitution of Ala with Val, Leu, or Ile; substitution of Arg with Lys, Gln, Asn, or His; substitution of Asn with Gln, His, Lys, or Arg; substitution of Asp with Glu or Asn; substitution of Cys with Ser or Ala; substitution of Gln with Asn or Glu; substitution of Glu with Asp or Gln; substitution of Gly with Ala; substitution of His with Asn, Lys, Gln, or Arg; substitution of Cys with Leu, Met, Ala, Val, Phe, or leucine. Substitutions include: Ile substitutions; substitutions of Leu with Ile, Met, Ala, Val, Phe, or leucine; substitutions of Lys with Asn, Gln, or Arg; substitutions of Met with Ile, Leu, or Phe; substitutions of Phe with Leu, Val, Ile, Ala, or Tyr; substitutions of Pro with Ala; substitutions of Ser with Thr; substitutions of Thr with Ser or Val; substitutions of Trp with Phe or Tyr; substitutions of Tyr with Trp, Phe, Thr, or Ser; and substitutions of Val with Phe, Ala, Met, Ile, Leu, or leucine. Amino acid substitutions can also be non-conserved amino acid substitutions.

[0078] In this invention, "hybridization" refers to the ability of a polynucleotide to bind to a substantially complementary sequence under stringent conditions, without non-specific binding to non-complementary sequences. The stringent conditions described in this invention are selected from moderately stringent, moderately-highly stringent, highly stringent, and very highly stringent conditions. The terms "moderately stringent," "moderately-highly stringent," "highly stringent," or "very highly stringent" as used in this invention describe the conditions for nucleic acid hybridization and washing. For example, the specific hybridization conditions are as follows: (1) Low stringency hybridization conditions: 6× sodium chloride / sodium citrate (SSC) at about 45°C, then at least 50°C, washed twice in 0.2× SSC, 0.1% SDS (for low stringency conditions, the washing temperature can be increased to 55°C); (2) Medium stringency hybridization conditions: 6× SSC at about 45°C, then at 60°C, washed once or more in 0.2× SSC, 0.1% SDS; (3) High stringency hybridization conditions: 6× SSC at about 45°C, then at 65°C, washed once or more in 0.2× SSC, 0.1% SDS, preferably; (4) Very high stringency hybridization conditions: 0.5M sodium phosphate, 7% SDS at 65°C, then at 65°C, washed once or more in 0.2× SSC, 1% SDS.

[0079] Unless otherwise defined, other technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0080] I. Recombinant Type XII Humanized Collagen

[0081] This invention provides a recombinant type XII humanized collagen, which was obtained by the inventors of this invention based on natural human type XII collagen (GenBank: NP_004361.3).

[0082] In some embodiments, the amino acid sequence of the recombinant type XII humanized collagen comprises n repeating units, where n is an integer greater than or equal to 2, and the repeating units are directly linked or linked by linker peptides; wherein the amino acid sequence of the repeating units comprises any one of the following (a)-(c):

[0083] (a) A sequence as shown in SEQ ID NO.1 or 2;

[0084] (b) A sequence in which one or more amino acid residues are added, substituted, and / or deleted, as shown in SEQ ID NO.1 or SEQ ID NO.2, while retaining biological activity;

[0085] (c) A sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the sequence shown in SEQ ID NO.1 or SEQ ID NO.2 and retaining biological activity.

[0086] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.1 with 1-24 amino acid residues added and retaining biological activity; preferably, the added amino acid residues are located at the N-terminus and / or C-terminus of SEQ ID NO.1.

[0087] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence as shown in SEQ ID NO.1 with 12 or 24 amino acid residues added and retaining biological activity; preferably, the added amino acid residues are located at the N-terminus and / or C-terminus of SEQ ID NO.1.

[0088] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence with 12 amino acid residues added to the N-terminus and C-terminus of the sequence shown in SEQ ID NO.1, while retaining biological activity.

[0089] In some embodiments, the amino acid sequence of the repeating unit comprises the sequence shown in SEQ ID NO.3.

[0090] In some embodiments, the amino acid sequence of the repeating unit comprises a sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence shown in SEQ ID NO.3 and retaining biological activity.

[0091] In some embodiments, the amino acid sequence of the repeating unit is as shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.

[0092] In some embodiments, the amino acid sequence of the repeating unit is as shown in SEQ ID NO.1 or SEQ ID NO.3.

[0093] In some implementations, n is an integer between 2 and 20.

[0094] In some implementations, n is an integer between 3 and 10; for example, it can be 3, 4, 5, 6, 7, 8, 9, or 10.

[0095] In some implementations, n is an integer between 4 and 8, for example, it can be 4, 5, 6, 7 or 8.

[0096] In some specific implementations, n is 4, 6, or 8.

[0097] In some embodiments, the amino acid sequence of the recombinant type XII humanized collagen comprises the sequence shown in any one of SEQ ID NO. 4-6.

[0098] In some embodiments, the amino acid sequence of the recombinant type XII humanized collagen comprises at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence shown in any one of SEQ ID NO. 4-6 and retains sequences that promote fibroblast adhesion, proliferation, and / or migration.

[0099] In some embodiments, the amino acid sequence of the recombinant type XII humanized collagen is as shown in any one of SEQ ID NO. 4-6.

[0100] The recombinant type XII humanized collagen provided by this invention has good activity in promoting fibroblast adhesion, proliferation and / or migration, wherein the fibroblasts include skin fibroblasts and / or vaginal fibroblasts.

[0101] II. Fusion Protein

[0102] This invention provides a fusion protein obtained by fusing other peptides of the recombinant type XII humanized collagen described in Part I.

[0103] In some embodiments, the other polypeptides refer to polypeptides that are not the recombinant type XII humanized collagen. In some embodiments, the other polypeptides include, but are not limited to, other collagen peptides; preferably, the other collagen peptides are derived from truncated amino acid sequences of human collagen, such as truncated fragments of human collagen amino acid sequences, or recombinant humanized collagen peptides composed of repeated truncated fragments of human collagen amino acid sequences.

[0104] III. Polynucleotides

[0105] The present invention provides a polynucleotide encoding the recombinant type XII humanized collagen described in Part I or the fusion protein described in Part II.

[0106] In some embodiments, the nucleotide sequence of the polynucleotide comprises a sequence as shown in any one of SEQ ID NO. 7-9.

[0107] In some embodiments, the nucleotide sequence of the polynucleotide comprises a codon-optimized sequence as shown in any one of SEQ ID NO. 7-9.

[0108] In some embodiments, the nucleotide sequence of the polynucleotide includes a sequence that hybridizes under stringent conditions to any of the sequences shown in SEQ ID NO. 7-9 and encodes a protein having a sequence shown in any of SEQ ID NO. 4-6 that promotes fibroblast adhesion, proliferation, and / or migration activity.

[0109] In some embodiments, the nucleotide sequence of the polynucleotide further includes a sequence encoding a tag and / or a signal peptide; optionally, the tag is selected from His tags, GST tags, MBP tags, SUMO tags, and NusA tags.

[0110] In some embodiments, the nucleotide sequence of the polynucleotide is as shown in any one of SEQ ID NO. 7-9.

[0111] IV. Expression Box

[0112] The present invention provides an expression cassette comprising the polynucleotides described in Part III.

[0113] In some embodiments, the expression cassette includes control elements operatively linked to the polynucleotide, the control elements being promoters, terminators, and / or enhancers.

[0114] V. Recombinant Vector

[0115] The present invention provides a recombinant vector comprising the polynucleotides described in Part III.

[0116] In some embodiments, the recombinant vector includes a control element operatively linked to the polynucleotide.

[0117] In some preferred embodiments, the control element is a promoter, a terminator, and / or an enhancer.

[0118] In some embodiments, the recombinant vector is a plasmid vector, viral vector, transposon, or artificial chromosome containing the polynucleotide.

[0119] The recombinant vector provided by this invention can be a recombinant expression vector or a recombinant integration vector.

[0120] In some preferred embodiments, the recombinant vector is a recombinant expression vector.

[0121] In some preferred embodiments, the recombinant vector is pET-28a-Trx-His containing the polynucleotide.

[0122] VI. Recombinant host cells

[0123] The present invention provides a recombinant host cell comprising the expression cassette described in Part IV or the recombinant vector described in Part V.

[0124] In some implementations, the recombinant host cell is a bacterium, fungus, or animal cell.

[0125] In some preferred embodiments, the bacteria are Escherichia coli.

[0126] In some preferred embodiments, the fungus is yeast; more preferably, it is Saccharomyces cerevisiae or Pichia pastoris.

[0127] VII. Preparation method of recombinant type XII humanized collagen

[0128] The present invention provides a method for preparing the recombinant type XII humanized collagen described in Part I, the method comprising the following steps: fermenting and culturing the recombinant host cells described in Part VI, inducing expression, and collecting the recombinant host cells and / or the culture medium of the recombinant host cells containing the recombinant type XII humanized collagen, thereby isolating the recombinant type XII humanized collagen therefrom.

[0129] In some embodiments, prior to fermentation culture of the recombinant host cells described in Part VI, the preparation method may further include steps of screening functional regions of human natural type XII collagen, constructing a recombinant vector, and constructing recombinant host cells. Specifically, by repeatedly linking the amino acid sequences of the functional regions of the screened human natural type XII collagen and optionally adding amino acid sequences that can be cleaved by collagen tool enzymes (e.g., TEV protease), the amino acid sequence of recombinant type XII humanized collagen as described in Part I of this invention is obtained. Subsequently, the polynucleotide sequence of the coding gene of the above protein can be artificially designed and optimized according to the codon preference of the target organism to obtain the nucleotide sequence as described in Part III of this invention. This sequence is then cloned into a vector to construct the recombinant vector as described in Part V of this invention. The vector is then transformed into host cells to obtain the recombinant host cells as described in Part VI of this invention.

[0130] In some embodiments, the fermentation culture includes: inoculating the screened positive genetically engineered bacteria into a shake flask containing a culture medium containing antibiotics, and culturing it in a constant temperature shaker at 220 rpm and 37°C.

[0131] In some implementations, the induced expression includes: (1) cooling the cultured shake flask to 16-30℃; (2) adding IPTG stock solution to induce expression; (3) placing the induced bacterial culture into a centrifuge bottle, centrifuging at 6000 rpm and 4℃ for 12 min, and then collecting the bacterial cells.

[0132] In some embodiments, the recombinant type XII humanized collagen is isolated from recombinant host cells and / or the culture medium of recombinant host cells using a Ni affinity chromatography column.

[0133] In some embodiments, the preparation method further includes an optional step of enzymatic digestion using a collagen tool enzyme (e.g., TEV protease); preferably, the digestion is performed after purification using a Ni affinity chromatography column; preferably, after digestion, purification can be performed again using a Ni affinity chromatography column.

[0134] VIII. Products

[0135] This invention provides a product for promoting fibroblast adhesion, proliferation, and / or migration, the product comprising the recombinant humanized type XII collagen as described in Part I, the fusion protein as described in Part II, the polynucleotide as described in Part III, the expression cassette as described in Part IV, the recombinant vector as described in Part V, and / or the recombinant host cell as described in Part VI.

[0136] In some embodiments, the product further comprises a solvent; preferably, the solvent is water.

[0137] In other embodiments, the product comprises the recombinant humanized type XII collagen described in Part I, the fusion protein described in Part II, the polynucleotide described in Part III, the expression cassette described in Part IV, the recombinant vector described in Part V, and / or the recombinant host cell described in Part VI.

[0138] In some implementations, the product is a product, an injectable product, or an oral product.

[0139] In some implementations, the product is in the form of a liquid, lyophilized powder, gel, sponge, or fiber.

[0140] In some implementations, the product is a drug, pharmaceutical excipient, biological dressing, obstetric and gynecological biomaterial, human biomimetic material, plastic and cosmetic material, organoid culture material, cardiovascular stent material, coating material, tissue filling / volume enhancement material, ophthalmic material, nerve repair and regeneration material, skin wound repair material, skin barrier repair material, muscle or bone or cartilage or ligament regeneration material, liver tissue material, vascular repair and regeneration material, 3D printed artificial organ biomaterial, or cosmetic raw material.

[0141] The term "drug" as used in this invention refers to a composition used for the prevention, treatment, or diagnosis of human diseases, purposefully regulating human physiological functions, and specifying indications or therapeutic functions, usage, and dosage. The term "pharmaceutical excipient" as used in this invention refers to an inactive ingredient in a pharmaceutical preparation. The term "biological dressing" as used in this invention refers to an artificial material used to cover wounds, promoting wound healing, and may possess hemostatic, anti-infective, and tissue regeneration-promoting functions. The term "gynecological and obstetric biomaterial" as used in this invention refers to a material applied to the female reproductive system, which may possess tissue flexibility and anti-infective properties. The term "human biomimetic material" as used in this invention refers to a material that simulates the structure and function of natural tissues. The term "plastic and cosmetic material" as used in this invention refers to a material used to repair defects or improve appearance, which may possess bioinertness, plasticity, and long-term stability. The term "organoid culture material" as used in this invention refers to a three-dimensional matrix material supporting organoid growth, providing a microenvironment close to that in vivo to promote cell self-organization. The term "cardiovascular stent material" as used in this invention refers to a device material used to support narrowed / occluded blood vessels, possessing both mechanical strength and endothelialization-promoting capabilities. The "coating material" described in this invention refers to a functional material applied to the surface of a medical device to improve the biocompatibility or durability of the substrate. The "tissue injection filler material" described in this invention refers to a material injected to fill soft tissue depressions or wrinkles, possessing injectability and low immunogenicity. The "ophthalmic material" described in this invention refers to a material used for intraocular or ocular surface repair. The "nerve repair and regeneration material" described in this invention refers to a scaffold material that promotes nerve regeneration, often loaded with neurotrophic factors to guide the directional growth of nerve cells. The "skin wound repair material" described in this invention refers to a class of functional biomaterials specifically designed for treating skin wounds, whose main functions include providing a physical barrier, managing exudate, resisting infection, and / or actively promoting healing. The "skin barrier repair material" described in this invention refers to a functional material, for example, that accelerates the repair, strengthening, or reconstruction of a damaged skin barrier by promoting keratinocyte proliferation and enhancing the stratum corneum's renewal capacity. It possesses bioactivity that actively promotes epidermal regeneration, aiming to restore the integrity of the skin structure and enhance the barrier's self-repair ability. Such materials typically possess biocompatibility or skin affinity. The "muscle, bone, cartilage, or ligament regeneration materials" described in this invention are a class of biomaterials designed to guide or induce the structural and functional reconstruction of damaged muscle, bone, cartilage, or ligament tissues. These materials possess biocompatibility, biodegradability, and suitable mechanical properties. The "liver tissue materials" described in this invention refer to materials used for liver injury repair or in vitro liver model construction, simulating the unique metabolic functions of the liver. The "vascular repair and regeneration materials" described in this invention refer to materials used for vascular replacement or regeneration, possessing anticoagulant properties and dynamic compliance. The "3D-printed artificial organ biomaterials" described in this invention refer to materials used to construct organ substitutes through 3D printing technology.The "cosmetic raw materials" mentioned in this invention refer to active or matrix ingredients in skin care products or makeup.

[0142] IX. Uses

[0143] The present invention provides the use of the recombinant type XII humanized collagen described in Part I, the fusion protein described in Part II, the polynucleotide described in Part III, the expression cassette described in Part IV, the recombinant vector described in Part V, the recombinant host cell described in Part VI, and / or the product described in Part VIII in the preparation of products for promoting extracellular matrix generation or reconstruction, tissue repair, tissue filling, and / or tissue volume enhancement; preferably, the tissue is bone tissue or connective tissue.

[0144] This invention provides the use of the recombinant type XII humanized collagen described in Part I, the fusion protein described in Part II, the polynucleotide described in Part III, the expression cassette described in Part IV, the recombinant vector described in Part V, the recombinant host cell described in Part VI, and / or the product described in Part VIII in the preparation of medicaments for the prevention and / or treatment of diseases or conditions associated with type XII collagen deficiency or for the supplementation of type XII collagen.

[0145] This invention provides the use of the recombinant type XII humanized collagen described in Part I, the fusion protein described in Part II, the polynucleotide described in Part III, the expression cassette described in Part IV, the recombinant vector described in Part V, the recombinant host cell described in Part VI, and / or the product described in Part VIII in the preparation of medicaments for the prevention and / or treatment of pelvic floor dysfunction, pelvic organ prolapse, postmenopausal genitourinary syndrome, vaginal wall injury, vaginal laxity syndrome, stress urinary incontinence, and / or female sexual dysfunction.

[0146] This invention provides a method for promoting fibroblast adhesion, fibroblast proliferation, fibroblast migration, and / or extracellular matrix generation or reconstruction, the method comprising contacting cells with the recombinant humanized collagen type XII described in Part I, the fusion protein described in Part II, the polynucleotide described in Part III, the expression cassette described in Part IV, the recombinant vector described in Part V, the recombinant host cell described in Part VI, and / or the product described in Part VIII; preferably, the cells are mammalian cells; more preferably, the cells are human cells; preferably, the cells are skin fibroblasts and / or vaginal fibroblasts.

[0147] In some embodiments, the promotion of fibroblast adhesion, fibroblast proliferation, fibroblast migration, and / or the promotion of extracellular matrix generation or reconstruction are carried out in vivo or in vitro.

[0148] Example

[0149] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified, specific conditions in the examples are performed under conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, all materials and instruments used are conventional products that can be obtained commercially.

[0150] Example 1: Construction and expression of recombinant type XII humanized collagen

[0151] 1.1. Construction of recombinant type XII humanized collagen

[0152] (1) A large-scale screening of natural human type XII collagen α1 chain (GenBank: NP_004361.3) was conducted, and the following different protein functional regions and their amino acid sequences were finally obtained:

[0153] GAKGPRGERGISGAIGPPGPRGDIGPP (SEQ ID NO. 1);

[0154] GPPGSTGSRGPPGPPGRPGNSGIRGPPGPP (SEQ ID NO. 2).

[0155] Further investigation was conducted into variant sequences of the above sequence. Based on SEQ ID NO.1, further screening was performed to obtain protein functional regions and their amino acid sequences that have partial repetitions with SEQ ID NO.1:

[0156] GPPGPPGPAGGPGAKGPRGERGISGAIGPPGPRGDIGPPGPQGPPGPQGPN (SEQ ID NO. 3).

[0157] To ensure the purification and stability of recombinant type XII humanized collagen, the functional regions of the above proteins were used as repeat units. Through n repetitions and direct ligation, recombinant type XII humanized collagen rhXII-1 (repetition unit is SEQ ID NO.1), rhXII-2 (repetition unit is SEQ ID NO.2), and rhXII-11 (repetition unit is SEQ ID NO.3) were obtained, with the corresponding amino acid sequences shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively.

[0158] The amino acid sequence of recombinant type XII humanized collagen rhXII-1 (8 repeats):

[0159] GAKGPRGERGISGAIGPPGPRGDIGPPGAKGPRGERGISGAIGPPGPRGDIGPPGAKGPRGERGISGAIGPPGPRGDIGPPGAKGPRGERGISGAIGPPGPRGDIGPPGAK GPRGERGISGAIGPPGPRGDIGPPGAKGPRGERGISGAIGPPGPRGDIGPPGAKGPRGERGISGAIGPPGPRGDIGPPGAKGPRGERGISGAIGPPGPRGDIGPP (SEQID NO.4).

[0160] The amino acid sequence of recombinant type XII humanized collagen rhXII-2 (6 repeats):

[0161] GPPGSTGSRGPPGPPGRPGNSGIRGPPGPPGPPGSTGSRGPPGPPGRPGNSGIRGPPGPPGPPGSTGSRGPPGPPGRPGNSGIRGPPGPPGPPGSTGSRGPPGPPGRPGNSGIRGPPGPPGPPGSTGSRGPPGPPGRPGNSGIRGPPGPPGPPGSTGSRGPPGPPGRPGNSGIRGPPGPP (SEQ ID NO. 5).

[0162] The amino acid sequence of recombinant type XII humanized collagen rhXII-11 (4 repeats):

[0163] GPPGPPGPAGGPGAKGPRGERGISGAIGPPGPRGDIGPPGPQGPPGPQGPNGPPGPPGPAGGPGAKGPRGERGISGAIGPPGPRGDIGPPGPQGPPGPQGPNGP PGPPGPAGGPGAKGPRGERGISGAIGPPGPRGDIGPPGPQGPPGPQGPNGPPGPPGPAGGPGAKGPRGERGISGAIGPPGPRGDIGPPGPQGPPGPQGPN (SEQ ID NO.6).

[0164] (2) Codon optimization was performed based on the Escherichia coli expression system. The nucleotide sequences of recombinant type XII humanized collagen rhXII-1, rhXII-2 and rhXII-11 are shown in SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9, respectively.

[0165] The nucleotide sequence encoding recombinant humanized collagen type XII rhXII-1 (SEQ ID NO.4):

[0166] (SEQ ID NO.7).

[0167] The nucleotide sequence encoding recombinant humanized collagen type XII rhXII-2 (SEQ ID NO.5):

[0168] GGGCCCCCAGGTAGCACCGGTAGCCGTGGTCCACCGGGACCGCCAGGCCGTCCTGGCAACAGCGGCATCCGCGGTCCGCCGGGCCCGCCGGGCCCGCCGGGTTCGACTGGTTCAAGAGGCCCGCCGGGCCCGCCGGGCCGTCCGGGCAATAGCGGTATTCGTGGTCCGCCGGGTCCACCGGGTCCGCCGGGCTCCACCGGTAGCCGTGGTCCGCCGGGCCCGCCGGGTCGTCCGGGCAACTCCGGTATTCGCGGTCCGCCGGGTCCGCCGGGCCCGCCGGGCAGCACCGGTAGCCGTGGTCCGCCGGGCCCGCCGGGTCGTCCGGGCAATTCGGGTATCCGCGGCCCGCCGGGCCCGCCAGGTCCGCCTGGTAGCACCGGCTCTCGTGGTCCACCGGGTCCGCCTGGTCGCCCAGGGAACTCTGGCATTCGCGGTCCGCCAGGTCCGCCGGGCCCGCCGGGCTCTACGGGTAGCCGTGGCCCGCCGGGTCCGCCAGGTCGTCCGGGCAACAGCGGCATCCGCGGTCCGCCGGGTCCCCCG (SEQ ID NO. 8).

[0169] The nucleotide sequence encoding recombinant humanized collagen type XII rhXII-11 (SEQ ID NO. 6):

[0170] (SEQ ID NO.9).

[0171] 1.2. Expression of recombinant type XII humanized collagen

[0172] After adding the collagen tool enzyme digestion sequence “GAAAACCTGTATTTCCAG (SEQ ID NO.10)” to the 5' end of the nucleotide fragments encoding different recombinant type XII humanized collagen synthesized in 1.1. above, the fragments were inserted into the pET-28a-Trx-His expression vector to obtain the corresponding recombinant expression plasmids.

[0173] The successfully constructed recombinant expression plasmid was transformed into Escherichia coli competent cells BL21(DE3). The specific process was as follows: (1) The Escherichia coli competent cells BL21(DE3) were taken out of the ultra-low temperature freezer and placed on ice. When they were half-thawed, 2 μL of the recombinant expression plasmid to be transformed was added to the Escherichia coli competent cells BL21(DE3) and mixed slightly 2-3 times. (2) The mixture was placed on ice for 30 min, and then heat-shocked in a water bath at 42℃ for 45-90 s. After taking it out, it was placed on ice for 2 min. (3) It was transferred to a biosafety cabinet and 700 μL of liquid Luria-Bertani medium (LB) was added. Then it was cultured at 37℃ and 220 rpm for 60 min. (4) 200 μL of bacterial solution was evenly spread on LB plates containing kanamycin sulfate. (5) The plates were cultured in an incubator at 37℃ for 15-17 h until uniform colonies grew.

[0174] Pick 5-6 single colonies from the transformed LB agar plates and place them in a shake flask containing antibiotic stock solution (50 mg / L kanamycin sulfate). Incubate at 220 rpm and 37°C in a constant temperature shaker for a certain period of time until the colonies appear as a mist. Then, cool the shake flasks to 16-30°C, add isopropylthio-β-D-galactoside (IPTG) (working concentration 0.5 mM) to induce expression for a period of time, aliquot the bacterial culture into centrifuge bottles, centrifuge at 6000 rpm and 4°C for 12 min, collect the bacterial cells, record the cell weight, and perform electrophoresis analysis.

[0175] The collected bacterial cells were resuspended in a balanced working solution (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole). The bacterial suspension was cooled to below 15°C, and the cells were homogenized twice or sonicated to disrupt the cell structure. After disruption, the bacterial suspension was collected. The disrupted bacterial suspension was aliquoted into centrifuge bottles and centrifuged at 17,000 rpm and 4°C for 30 min. The supernatant was collected.

[0176] Recombinant type XII humanized collagen was purified and enzymatically digested using Ni affinity chromatography. The specific process is as follows: (1) Crude purification: a. Equilibrate the column: Equilibrate the column with equilibration buffer (200mM sodium chloride, 25mM Tris, 20mM imidazole) at a flow rate of 10mL / min. b. Load the sample: Add the supernatant after centrifugation to the column until the liquid is completely discharged at a flow rate of 5mL / min. c. Wash away impurities: Add 100mL of washing buffer (200mM sodium chloride, 25mM Tris, 20mM imidazole) until the liquid is completely discharged at a flow rate of 10mL / min. d. Collect the target protein: Add 20mL of elution buffer (200mM sodium chloride, 25mM Tris, 250mM imidazole) at a flow rate of 10mL / min, collect the flow-through, and perform electrophoresis detection. e. Wash the column with 1M imidazole working solution at a flow rate of 10mL / min. (2) Enzyme digestion: Add collagen enzyme at a ratio of 20:1 (total protein to total collagen enzyme) and digest at 16℃ for 2 hours. Place the digested protein solution into a dialysis bag and dialyze at 4℃ for 2 hours. Then transfer it to a new dialysis buffer (20mM sodium chloride, 20mM Tris) and dialyze overnight at 4℃. (3) Purification: a. Equilibrate the column: Equilibrate the column with solution A (20mM Tris, 20mM sodium chloride) at a flow rate of 10mL / min. b. Load the sample: Load the dialysis sample at a flow rate of 5mL / min and collect the flow-through sample (QFL, Quaternary Fractionation Liquid). Perform electrophoresis and store the protein at 4℃. c. Wash the column: Wash the column with solution B (1M sodium chloride, 20mM Tris) for 5 column volumes (CV). d. Wash the column.

[0177] The purified recombinant type XII humanized collagen was detected by SDS-PAGE. The electrophoretic results are as follows: Figures 1-3 .like Figures 1-3 It can be seen that recombinant type XII humanized collagen rhXII-1, rhXII-2, and rhXII-11 were successfully expressed and prepared.

[0178] The theoretical molecular weights of the recombinant type XII humanized collagen rhXII-1, rhXII-2, and rhXII-11 after purification were 20.07 kDa, 16.20 kDa, and 18.14 kDa, respectively. The apparent molecular weights after purification were consistent with the theoretical molecular weights.

[0179] Example 2: Detection of cell adhesion activity of recombinant type XII humanized collagen

[0180] Collagen, as a major component of the extracellular matrix (ECM), plays a crucial physiological role in providing a scaffold for cell adhesion and maintaining cell morphology and tissue homeostasis. Cell adhesion depends on the specific binding of collagen to integrin receptors on the cell surface, a process that directly reflects the molecular structural integrity of collagen (such as the exposure of active sites) and its biocompatibility. Only after cells achieve stable adhesion through collagen can they further initiate subsequent physiological processes such as proliferation, migration, and differentiation. Adhesion experiments can indirectly reflect collagen's ability to regulate cells, thereby demonstrating its overall biological activity.

[0181] A collagen adhesion layer was prepared in a 96-well plate, and then human skin fibroblasts (HFB cells) were seeded into the 96-well plates. In this experimental system, the negative control was Dulbecco's Phosphate-Buffered Saline (D-PBS), and the positive control (PC1) used human type III collagen (purchased from Advanced BioMatrix, ABM-5021-10MG). The number of cells remaining in the wells was quantitatively analyzed using a CCK8 assay kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.), allowing for the calculation of the collagen-mediated cell adhesion ratio, which further reflects the cell adhesion-promoting effect of collagen. The specific experimental procedure is as follows:

[0182] (1) Sample preparation: human type III collagen and recombinant type XII humanized collagen were diluted to 1 mg / mL using D-PBS buffer; the negative control (NC) was D-PBS buffer; and cell-free complete culture medium was set as the zeroing well.

[0183] (2) Coating: Add the above samples to the microplate, 100 μL per well, with 5 replicates per group, and incubate overnight at 4°C.

[0184] (3) Blocking: Discard the supernatant, add 100 μL of 1% bovine serum albumin (BSA) (heat inactivation at 56℃ for 30 min), and incubate at 37℃ for 60 min. Discard the supernatant and wash 3 times with D-PBS solution.

[0185] (4) Cell seeding: Add 10 to each well 5 Cells in good culture condition resuspended in D-PBS were incubated at 37°C for 120 min. Each well was washed three times with D-PBS solution.

[0186] (5) Detection: Add 100 μL of serum-free medium containing 5 μL of CCK8 reaction solution to each well and incubate at 37°C for 120 min. Detect using an enzyme-linked immunosorbent assay (ELISA) reader at a wavelength of 450 nm. Simultaneously, prepare a blank control well containing 5 μL of serum-free medium containing CCK8 reaction solution but without cells.

[0187] (6) Calculate the cell adhesion degree according to the following formula. The cell adhesion rate reflects the cell adhesion force of collagen. The higher the cell adhesion force, the better the external environment can be provided to the cells in a short time, which helps the cells adhere.

[0188]

[0189] In the formula:

[0190] P: Relative cell adhesion ratio;

[0191] OD1: The average UV absorbance of each pore of the test sample at 450 nm;

[0192] OD2: The average UV absorbance of each replicate well of the negative control sample at 450 nm;

[0193] OD0: The average UV absorbance of each replicate well in the blank control group at 450 nm.

[0194] (7) Statistical analysis: The statistical difference between the target recombinant type XII humanized collagen and the negative control was analyzed using a two-tailed t-test. Among them, *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001.

[0195] The results are as follows Figure 4 As shown, compared with the D-PBS group, human type III collagen had a significant cell adhesion promoting effect (202.12%). The recombinant type XII humanized collagen rhXII-1, rhXII-2, and rhXII-11 had a higher cell adhesion promoting effect than the positive control group, with cell adhesion activities of 307.67%, 237.24%, and 211.58% respectively compared with the NC group.

[0196] Example 3: Cell proliferation-promoting activity and toxicity assay of recombinant type XII humanized collagen

[0197] CCK8 reagent contains WST-8 (chemical name: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonic acid benzene)-2H-tetrazole monosodium salt), which is reduced by cellular dehydrogenases to a highly water-soluble yellow formazan dye in the presence of the electron carrier 1-methoxy-5-methylphenazineonium sulfate (1-Methoxy PMS). The amount of formazan dye produced is directly proportional to the number of viable cells. Therefore, this property can be used to directly analyze HFB cell proliferation and toxicity.

[0198] (1) Experimental grouping: The culture medium containing 0.4% (v / v) serum was the negative control (NC), 8wt% NaCl was the positive control (PC), the recombinant type XII humanized collagen with a concentration of 1 mg / mL was the experimental group, and the complete culture medium without cells was the zeroing well.

[0199] (2) Sample preparation: Dilute the above samples to the required concentration with culture medium containing 0.4% (v / v) serum. After sterilization by filtration through a 0.22µm microporous membrane, the samples are used directly as samples. Dissolve NaCl in culture medium containing 0.4% (v / v) serum to a final concentration of 8%, and then filter to sterilize.

[0200] (3) Cell seeding: When the cell confluence reaches approximately 90%, digest and count the cells. Digest and count the cells at a rate of (5-10) × 10⁶ cells per well. 3 Cells were seeded in 96-well plates, and the edge wells were blocked with 100 µL of PBS. Cells were cultured for 24 h to allow adherence.

[0201] (4) Starvation treatment: After the cells adhered, the supernatant was aspirated, and 100 µL of culture medium containing 0.4% (v / v) serum was added to each well and cultured for 24 h.

[0202] (5) Cell drug administration: Discard the supernatant and replace the corresponding group solutions in sequence, with 4 replicates per group, and culture for 24 hours.

[0203] (6) Experimental detection: Discard the culture medium, add 100µL (including 5 µL CCK8 solution) of basal culture medium, incubate in an incubator for 2-4 hours, and detect using an enzyme-linked immunosorbent assay (ELISA) reader at a wavelength of 450 nm. The cell viability calculation formula is as follows.

[0204] Cell viability = [(As-Ab) / (Ac-Ab)] × 100%;

[0205] In the formula:

[0206] As: Absorbance of experimental wells (including cells, culture medium, CCK8 solution and drug solution);

[0207] Ac: Absorbance of control wells (containing cells, culture medium, and CCK8 solution, but excluding drugs);

[0208] Ab: Absorbance of the blank group (including culture medium and CCK8 solution, but excluding cells and drugs).

[0209] (7) Statistical analysis: The statistical differences between the samples and the negative control were analyzed using a two-tailed t-test. Among them, *, P<0.05; **, P<0.01; ***, P<0.001.

[0210] The results are as follows Figure 5 As shown, compared with the negative control group, the cell survival rate of the positive control group was significantly reduced, and the difference was statistically significant. The experiment demonstrated that the cell viability of the three recombinant type XII humanized collagen proteins rhXII-1, rhXII-2, and rhXII-11 in the experimental group were 129.79%, 113.59%, and 117.76%, respectively, with no cytotoxicity. Among them, rhXII-1 showed significant cell proliferation-promoting activity.

[0211] Example 4: Detection of the activity of recombinant type XII humanized collagen in promoting primary vaginal fibroblasts

[0212] In vaginal wall tissue, fibroblasts are mainly distributed in the connective tissue between the submucosa and the muscular layer. Together with epithelial cells, smooth muscle cells, and other cell types, they constitute the basic structure of the vaginal wall, providing support and protection. Furthermore, fibroblasts participate in the repair and regeneration of the vaginal mucosa. Human vaginal fibroblasts, primarily isolated from human vaginal wall tissue, are a cell type with diverse biological functions. They can synthesize and secrete various cytokines, growth factors, and collagen, which play a crucial role in maintaining the integrity and function of the vaginal mucosa. In addition, human vaginal fibroblasts can interact with other cell types, such as co-regulating vaginal immune responses with immune cells. In medical research and applications, human vaginal fibroblasts have attracted considerable attention due to their unique biological characteristics and functions. They are widely used in cell therapy, tissue engineering, and drug screening. For example, human vaginal fibroblasts can be used to construct artificial vaginal mucosal tissue, providing new treatment options for patients with vaginal malformations and vaginal stenosis. Furthermore, human vaginal fibroblasts can be used to study the mechanisms of vaginal mucosal damage repair, providing a theoretical basis for the prevention and treatment of related diseases.

[0213] This invention utilizes a primary vaginal fibroblast model to precisely verify the biological activities of collagen in promoting cell proliferation, repairing the extracellular matrix, and improving the structural integrity of the vaginal wall. This is helpful for studying female lower genital tract and pelvic floor diseases with vaginal wall fibroblast dysfunction and extracellular matrix (collagen / elastin) metabolic disorders as the core pathologies. Verification of this cell activity can provide core pharmacodynamic support for preclinical studies of the corresponding indications.

[0214] Example 4-1: Adhesion Activity Experiment of Primary Vaginal Fibroblasts

[0215] For specific experimental steps and methods, please refer to Example 2, where HFB cells were replaced with primary vaginal fibroblasts. The results of the primary vaginal fibroblast adhesion experiment are as follows: Figure 6 As shown, compared with the D-PBS group (NC group), human type III collagen (positive control, denoted as PC1) significantly promoted cell adhesion by 216.39%. Recombinant type XII humanized collagen rhXII-1, rhXII-2, and rhXII-11 showed higher cell adhesion-promoting effects than the positive control group, with cell adhesion activities of 253.43%, 243.97%, and 230.79% respectively compared to the NC group.

[0216] Example 4-2: Experiment on the Proliferative Activity of Primary Vaginal Fibroblasts

[0217] For specific experimental steps and methods, please refer to Example 3, where HFB cells were replaced with primary vaginal fibroblasts. Results are as follows: Figure 7 As shown, compared with the negative control group (culture medium containing 0.4% (v / v) serum), the cell survival rate of the positive control group (8% NaCl) was significantly reduced, and the difference was statistically significant. The experiment demonstrated that the cell viability of the three recombinant type XII humanized collagen proteins rhXII-1, rhXII-2, and rhXII-11 in the experimental group were 159.90%, 152.85%, and 150.23%, respectively, with no cytotoxicity and significant cell proliferation-promoting activity.

[0218] Example 4-3 Primary vaginal fibroblast migration activity assay

[0219] The main material of a Transwell is the Transwell chamber, which is shaped like a small cup that can be placed inside a well plate. The bottom of the cup is a polycarbonate membrane, which is permeable. The Transwell chamber is placed in a culture plate; the inner part of the chamber is called the upper chamber, and the area inside the culture plate is called the lower chamber. Cells are seeded in the upper chamber, and the lower chamber contains the sample solution. Due to the permeability of the chamber membrane, the sample solution in the lower chamber can affect the cells in the upper chamber, thus allowing studies on the effect of the sample solution in the lower chamber on cell migration.

[0220] DAPI, or 4,6-biamidin-2-phenylindole, is a commonly used fluorescent dye. Its mechanism of action involves interaction with the grooves of the DNA double helix, allowing it to bind tightly to the DNA double strand. This property can be used to analyze cell migration.

[0221] Experimental groups: Samples were diluted to the appropriate ratio using culture medium; the positive control (PC) was epidermal growth factor (EGF); the negative control (NC) was culture medium containing 0.4% (v / v) fetal bovine serum (FBS).

[0222] Sample preparation: Collagen was dissolved in 0.4% FBS medium to the working concentration (10 mg / ml) and sterilized by filtration through a 0.22 µm microporous membrane. EGF was dissolved in 0.4% FBS medium to a final concentration of 10 ng / mL and sterilized by filtration.

[0223] Digest the cells, stop digestion, centrifuge and discard the culture medium, wash with PBS 1-2 times. Resuspend in serum-free medium and adjust the cell density to 1×10⁶ cells / year. 6 / mL.

[0224] Add 500 μL of sample to the lower chamber and 200 μL of cell suspension to the upper chamber, and incubate for 24 h.

[0225] Carefully remove the upper chamber with tweezers, aspirate the liquid, and transfer it to a well pre-filled with approximately 800 μL of methanol. Fix at room temperature for 30 min, then wash twice with PBS.

[0226] Add 100 μL of DAPI to the upper chamber, stain for 15 min, then gently wipe away the unmigrated cells in the upper layer with a cotton swab and wash 3 times with PBS.

[0227] Observe under a fluorescence microscope and take pictures at 6, 12, and 24 hours. Count the cells using ImageJ. The magnification of the pictures was uniformly 200×. Take at least two random fields of view for each Transwell well and take the average number of cells. Each experimental group has 5 replicates and is repeated 3 times.

[0228] Relative cell migration rate = Ct / Cnc × 100%

[0229] In the formula:

[0230] Ct: The average number of cells in each replicate well of the experimental group (including cells, culture medium, and sample material);

[0231] Cnc: The average number of cells in each replicate well of the negative control group (containing cells and culture medium, but excluding sample material).

[0232] Statistical analysis: Two-tailed t-tests were used to analyze the statistical differences between the samples and the negative control. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

[0233] The experimental results are shown in Table 1 and Figures 8-10 As shown, the bar charts are based on the relative cell migration rate data obtained from the ImageJ software counting analysis after taking photos with a fluorescence microscope, and the blue fluorescent cell images are random field-of-view images cropped after taking photos with a fluorescence microscope.

[0234] Table 1. Migration rate of primary vaginal fibroblasts (NC = 100%)

[0235]

[0236] Results after 6 hours Figure 8 As shown in the figure, compared with the D-PBS group, epidermal growth factor had a slight cell migration-promoting effect, with a migration rate of 108.68%. Furthermore, recombinant type XII humanized collagen rhXII-1, rhXII-2, and rhXII-11 all promoted cell migration, and their effects were higher than those of the positive control group, with cell migration rates of 153.23%, 123.78%, and 122.27% respectively compared to the NC group.

[0237] Results after 12 hours Figure 9 As shown in the figure, epidermal growth factor (EGFR) promoted cell migration compared to the D-PBS group, with a migration rate of 130.74%. Furthermore, recombinant type XII humanized collagen rhXII-1, rhXII-2, and rhXII-11 all promoted cell migration, and their effects were higher than those of the positive control group, with migration rates of 176.52%, 133.31%, and 136.85% respectively compared to the NC group.

[0238] 24-hour results as follows Figure 10 As shown in the figure, epidermal growth factor (EGFR) promoted cell migration compared to the D-PBS group, with a migration rate of 121.30%. Furthermore, recombinant type XII humanized collagen rhXII-1, rhXII-2, and rhXII-11 all promoted cell migration, and their effects were higher than those of the positive control group, with migration rates of 226.79%, 143.20%, and 140.06% respectively compared to the NC group.

[0239] It is evident that the three recombinant type XII humanized collagen proteins, rhXII-1, rhXII-2, and rhXII-11, can all promote the adhesion, proliferation, and migration of vaginal fibroblasts, assist in repairing or remodeling the extracellular matrix of the vaginal wall, and increase the synthesis of collagen and elastic fibers, thereby helping to restore the thickness, toughness, and support of the vaginal wall.

[0240] Vaginal fibroblasts can secrete type I and type III collagen, which can enhance the supporting stiffness of the vaginal wall as a "hammock" structure. From a biomechanical perspective, this can delay or improve the downward displacement of the uterus, bladder, and rectum, thus improving the support of the pelvic floor structure and aiding in the prevention and treatment of pelvic floor dysfunction and pelvic organ prolapse. Simultaneously, it can strengthen the anterior vaginal wall support layer below the urethra, providing treatment strategies for problems such as stress urinary incontinence.

[0241] By promoting the adhesion, proliferation, and migration of vaginal fibroblasts, it is possible to improve or reverse the senescent phenotype of fibroblasts caused by postmenopausal estrogen deficiency, improve problems such as increased collagen dissolution, thinning of the vaginal wall, and increased fragility, and provide assistance for the prevention and treatment of diseases such as postmenopausal genitourinary syndrome.

[0242] By promoting the adhesion, proliferation, and migration of vaginal fibroblasts, it can guide surrounding healthy fibroblasts to move towards the injury center, reduce the risk of interface dehiscence after healing, maintain the extensibility of the vaginal wall, and help repair vaginal wall damage.

[0243] Increasing the number of vaginal fibroblasts can promote the synthesis of more elastic fibers, thereby restoring the vagina's contractility and gripping power. At the same time, it reduces the slippage and detachment of the submucosa and muscle layer, enhances the closing pressure of the vaginal cavity, and helps improve vaginal laxity.

[0244] By promoting the adhesion, proliferation and migration of vaginal fibroblasts, it can also increase the thickness of the basal layer under the vaginal epithelium, reduce pain during intercourse, improve local blood supply, and relieve dryness and burning sensation.

Claims

1. A product for promoting fibroblast adhesion, proliferation, and / or migration, characterized in that, The product comprises at least one of the following: recombinant humanized type XII collagen, a polynucleotide encoding the recombinant humanized type XII collagen, an expression cassette containing the polynucleotide, a recombinant vector containing the polynucleotide, and a recombinant host cell containing the expression cassette or the recombinant vector. The amino acid sequence of the recombinant type XII humanized collagen consists of n repeating units, where n is 4 or 8, and the repeating units are directly connected; wherein the amino acid sequence of the repeating unit is the sequence shown in SEQ ID NO.1 or SEQ ID NO.3; The amino acid sequence of the recombinant type XII humanized collagen is the sequence shown in SEQ ID NO.4 or SEQ ID NO.

6.

2. The product according to claim 1, characterized in that, The nucleotide sequence of the polynucleotide is the sequence shown in SEQ ID NO.7 or SEQ ID NO.

9.

3. The product according to claim 1, characterized in that, The expression cassette also includes control elements operatively linked to the polynucleotide, the control elements being promoters, terminators, and / or enhancers.

4. The product according to claim 1, characterized in that, The recombinant vector is pET-28a-Trx-His containing the polynucleotide.

5. The product according to claim 1, characterized in that, The recombinant host cell is a bacterium, fungus, or animal cell, wherein the bacteria include Escherichia coli; and the fungus includes yeast.

6. The product according to claim 1, characterized in that, The preparation method of the recombinant type XII humanized collagen includes the following steps: fermenting and culturing the recombinant host cells, inducing expression, and collecting the recombinant host cells and / or the culture medium of the recombinant host cells containing the recombinant type XII humanized collagen, and isolating the recombinant type XII humanized collagen from them.

7. The product according to any one of claims 1-6, characterized in that, The product is in the form of liquid, freeze-dried powder, gel, sponge, or fiber.

8. Use of the product according to any one of claims 1-7 in the preparation of a medicament for the prevention and / or treatment of pelvic organ prolapse, vaginal laxity syndrome and / or stress urinary incontinence.

Images