Use of inhibitors targeting the j am-c protein for the preparation of medicaments for the treatment of cnv-related eye diseases

Abstract

The application discloses application of an inhibitor targeting JAM-C protein in preparation of a drug for treating CNV eye diseases, and relates to the technical field of biological medicines. The inhibitor is an agent for targeting silencing or reducing expression of JAM-C gene and / or JAM-C protein or an agent for inhibiting biological functions of JAM-C protein, and includes siRNA, shRNA for targeting silencing or reducing JAM-C gene and / or JAM-C protein or an agent for inhibiting biological functions of JAM-C protein. The application also provides a recombinant carrier containing the siRNA or shRNA and application of the recombinant carrier in preparation of a drug for treating CNV eye diseases. Animal experiments prove that the inhibitor can specifically act on JAM-C to reduce migration of retinal pigment epithelial cells, reduce leakage of the retinal pigment epithelial layer and improve blood-retinal outer barrier functions, thereby providing a new choice for developing a targeted drug for treating CNV eye diseases.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of inhibitors targeting the JAM-C protein in the preparation of drugs for treating CNV-related eye diseases. Background Technology

[0002] Choroidal neovascularization (CNV) can occur in a wide range of ophthalmic diseases, including those caused by inflammation, infection, degeneration, tumors, trauma, genetic factors, and congenital conditions, and can occur in people of different ages and sexes. Among these, wet age-related macular degeneration, high myopia macular degeneration, idiopathic CNV, and ocular histoplasmosis syndrome are the most common causes of blindness in clinical practice. CNV, characterized primarily by the occurrence and formation of new blood vessels, is a common and important pathological basis for many choroidal and retinal diseases, making the study of its pathogenesis and prevention strategies of great significance.

[0003] Choroidal microvascular endothelial cells, retinal pigment epithelial cells, fibroblasts, smooth muscle cells, and various inflammatory cells involved in CNV formation, in conjunction with multiple growth factors, inflammatory factors, and signaling molecules in the microenvironment, jointly complete the pathological process of angiogenesis. Although the composition of CNV is complex, it can be mainly divided into two categories: the first category is vascular components, including vascular endothelial cells, pericytes, and endothelial progenitor cells; the second category is extravascular components, including inflammatory cells (macrophages, lymphocytes, granulocytes, and foreign body giant cells), glial cells, RPE cells, and fibroblasts. This shows that CNV is a pathological process involving both inflammation and angiogenesis. Changes in each component can vary depending on the primary disease and the stage of the disease. Some scholars divide the natural course of CNV into three stages: the first is the initiation stage, where vascular endothelial cells proliferate from the choroidal capillaries and migrate across Bruch's membrane towards the retina; the second is the activation stage, where the neovascular complex grows to form CNV; and the third is the degeneration stage, where CNV tissue undergoes fibrosis and scarring.

[0004] Current clinical treatments mainly include photodynamic therapy and anti-vascular endothelial growth factor (VEGF) drugs. VEGF plays a crucial role in the development of CNV. Tissue hypoxia induces the upregulation of VEGF expression, and increased VEGF can initiate the migration and proliferation of vascular endothelial cells from capillaries. Simultaneously, VEGF is a activating factor for vascular endothelial cells and can also increase capillary permeability and monocyte chemotaxis. However, drugs targeting VEGF or combined photodynamic therapy are not ideal; approximately one-sixth of patients receiving treatment still experience uncontrolled blindness.

[0005] The study of blood-retinal barrier cells releasing vasoactive molecules and chemokines in response to various injury signals (such as ischemia, hypoxia, oxidative damage, and infection), thereby activating local tissues and blood-derived macrophages, and altering the distribution and expression of related molecules located on the tight junctions of the blood-retinal barrier, represents a novel field and direction.

[0006] The blood-retinal barrier is a crucial structure for maintaining the stability of the local tissue microenvironment. Tight junctions are the molecular basis of the blood-retinal barrier structure and play a decisive role in maintaining its integrity. Tight junctions (TJs) within the barrier not only regulate the transport of ions, small molecules, and inflammatory cells but also play a vital role in intracellular and extracellular signal transduction. Junctional adhesion molecule-C (JAM-C) in the outer blood-retinal barrier is one of the key adhesion molecules related to barrier function and tight junctions. This invention reveals that JAM-C is specifically expressed in the eye in the outer blood-retinal barrier, suggesting that JAM-C may play an important role in CNV (collateral vascular endothelial lesions). Summary of the Invention

[0007] To address the problems existing in the prior art, this invention analyzes the specific expression and distribution of JAM-C in choroidal neovascularization and further explores the regulatory mechanism of this molecule on blood-retinal barrier function and macrophage migration. It clarifies the role of JAM-C in vascular leakage and macrophage chemotaxis in CNV lesions and verifies that JAM-C mainly participates in abnormal cell activation by regulating blood-retinal barrier function to inhibit CNV generation. Therefore, it proposes the application of JAM-C in the preparation of drugs for treating choroidal neovascularization, providing a new drug option for the treatment of choroidal neovascularization.

[0008] In a first aspect, the present invention provides the application of an inhibitor targeting the JAM-C protein in the preparation of a drug for treating CNV-related eye diseases.

[0009] Furthermore, the encoding nucleotide sequence of the JAM-C protein is shown in SEQ ID NO.1.

[0010] As one possible implementation of the first aspect, the inhibitor is a siRNA targeting the JAM-C protein, the siRNA targeting the JAM-C protein including siJAM-CF and siJAM-CR, wherein the nucleotide sequence of siJAM-CF is shown in SEQ ID NO.2 and the nucleotide sequence of siJAM-CR is shown in SEQ ID NO.3.

[0011] As another possible implementation of the first aspect, the inhibitor may also be an shRNA targeting the JAM-C protein, the nucleotide sequence of which is shown in SEQ ID NO.4, SEQ ID NO.6, or SEQ ID NO.8.

[0012] As another possible implementation of the first aspect, the inhibitor can also be the JAM-C Fc protein.

[0013] More preferably, the JAM-C Fc protein is embedded in a sustained-release carrier, wherein the sustained-release carrier comprises PLGA microspheres and hyaluronic acid hydrogel.

[0014] As another possible implementation of the first aspect, the inhibitor can also be LNP-shJAM-C that targets and delivers JAM-C shRNA. In a second aspect, the present invention provides a recombinant vector comprising the siRNA or shRNA targeting the JAM-C protein described in the first aspect above.

[0015] Thirdly, the present invention provides the use of the recombinant carrier as described in the second aspect above in the preparation of a drug for treating choroidal neovascular eye disease.

[0016] Fourthly, the present invention provides a medicament for treating choroidal neovascular ophthalmopathy, the medicament comprising the inhibitor described in the first aspect or the recombinant carrier described in the second aspect.

[0017] Compared with the prior art, the beneficial effects of the present invention are reflected in the following aspects: First, this invention analyzes the expression changes of JAM-C in a laser-induced mouse CNV model and clarifies the role of JAM-C in vascular leakage and macrophage chemotaxis in CNV lesions through targeted inhibition at the gene and protein levels. It verifies that JAM-C mainly participates in abnormal cell activation by regulating the blood-retinal outer barrier function to inhibit CNV generation, thus providing strong theoretical support for the application of JAM-C in the preparation of drugs for treating choroidal neovascular eye diseases.

[0018] Secondly, based on the theoretical foundation that JAM-C inhibits CNV generation by regulating the blood-retinal outer barrier function and is mainly involved in abnormal cell activation, this invention targets the active function of JAM-C and combines existing mature technologies such as the design principles of interfering RNA, the construction methods of recombinant lentiviral vectors or recombinant lentiviruses for shRNA, and recombinant fusion protein technology to provide a variety of inhibitors targeting JAM-C proteins, including siRNA targeting JAM-C protein, shRNA targeting JAM-C protein, and JAM-CFc protein. Animal experiments have verified that the above inhibitors can specifically act on JAM-C to reduce retinal pigment epithelial cell migration, reduce leakage of the retinal pigment epithelial layer, and improve the blood-retinal outer barrier function, providing a new option for the development of targeted drugs for the treatment of choroidal neovascular eye diseases. Attached Figure Description

[0019] Figure 1 Expression of JAM-C during angiogenesis in the normal retina and choroid. A and B represent results from real-time quantitative PCR; C represents results from Western blot analysis; D and E represent results from immunofluorescence staining; Bar: 50 µm. *P < 0.01; **P < 0.001.

[0020] Figure 2 Effects of JAM-C functional inhibition on choroidal angiogenesis and vascular leakage. A and B represent IB4 staining results; C and D represent histological analysis results; E and F represent fluorescein fundus angiography results; Bars: 50µm (A,C); 250µm (E). *P<0.01.

[0021] Figure 3 Effects of JAM-C functional inhibition on macrophage chemotaxis and migration. AC represents Mac3+ staining (red, macrophage marker) results within choroidal neovascularization lesions; D represents the migration results of peripheral blood mononuclear macrophages from CNV patients across the hRPE cell layer under JAM-C Fc protein treatment; E represents the migration results of peripheral blood mononuclear macrophages from normal adults across the hRPE cell layer under JAM-C Fc protein treatment; *P < 0.01; ns: no significant difference.

[0022] Figure 4 Effects of low JAM-C expression on retinal pigment epithelial cell migration. A represents real-time quantitative PCR results; B represents Western blotting results; C represents Transwell migration assay results; *P < 0.01.

[0023] Figure 5Results of a permeability assay to investigate the effect of low JAM-C expression on the barrier function of the retinal pigment epithelium; *P<0.01. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0025] In the embodiments of this application, the terms "exemplary" or "for example" are used to indicate that something is an example, illustration, or description. Any embodiment or design that is described as "exemplary" or "for example" in the embodiments of this application should not be construed as being more preferred or advantageous than other embodiments or design. Specifically, the use of the terms "exemplary" or "for example" is intended to present the relevant concepts in a specific manner.

[0026] In the embodiments of this application, unless otherwise specified, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0027] In this application, all tissues and cells collected were used in accordance with the intended purpose of healthy volunteers and CNV patients, and informed consent was obtained. Blood sample collection and experimental procedures were reviewed and approved by the Ethics Committee of the First Affiliated Hospital of Air Force Medical University. All animal experiments were approved by the Animal Center's Feeding and Use Committee of Air Force Medical University and conducted in accordance with operating guidelines and standards.

[0028] This invention analyzes the specific expression and distribution of JAM-C in choroidal neovascularization and further explores the regulatory mechanism of this molecule on blood-retinal barrier function and macrophage migration. It clarifies the role of JAM-C in vascular leakage and macrophage chemotaxis in CNV lesions and verifies that JAM-C mainly participates in abnormal cell activation by regulating blood-retinal barrier function to inhibit CNV generation. Therefore, it proposes the application of JAM-C in the preparation of drugs for treating choroidal neovascularization, providing a new option for developing targeted drugs for the treatment of choroidal neovascularization.

[0029] This application provides the application of inhibitors targeting the JAM-C protein in the preparation of drugs for treating CNV-related eye diseases.

[0030] This application does not specifically limit the source of the JAM-C protein; any JAM-C protein well-known in the art can be used. For example, in this application embodiment, the encoding nucleotide sequence of the human JAM-C protein (the NCBI reference sequence corresponding to transcript variant 1 is NM_032801.5, and the full-length coding region (CDS) sequence of this transcript is 933 bp) is shown in SEQ ID NO.1: SEQ ID NO.1: ATGGCGCTGCGGCGGCCGCCGCGGCTGCGGCTGTGCGCGCTGCCCGACTTCTTCCTGCTGCTGCTGTTCCGCGGCTGCCTGATCGGCGCCGTGAACCTGAAGAGCAGCAACCGCACCCCGGTGGTGCAGGAGTTCGAGAGCGTGGAGCTGAGCTGCATCATCACCGACAGCCAGACCAGCGACCCGCGCATCGAGTGGAAGAAGATCCAGGACGAGCAGACCACCTACGTGTTCTTCGACAACAAGATCCAGGGCGACCTGGCCGGCCGCGAGATCCTGGGCAAGACCAGCCTGAAGATCTGGAACGTGACCCGCCGCGACAGCGCCCTGTACCGCTGCGAGGTGGTGGCCCGCAACGACCGCAAGGAGATCGACGAGATCGTGATCGAGCTGACCGTGCAGGTGAAGCCGGTGACCCCGGTGTGCCGCGTGCCGAAGGCCGTGCCGGTGGGCAAGATGGCCACCCTGCACTGCCAGGAGAGCGAGGGCCACCCGCGCCCGCACTACAGCTGGTACCGCAACGACGTGCCGCTGCCGACCGAGCGCGCCAACCCGCGCTTCCGCAACAGCAGCTTCCACCTGAACAGCGAGACCGGCACCCTGGTGTTCACCGCCGTGCACAAGGACGACAGCGGCCAGTACTACTGCATCGCCAGCAACGACGCCGGCAGCGCCCGCTGCGAGGAGCAGGAGATGGAGGTGTACGACCTGAACATCGGCGGCATCATCGGCGGCGTGCTGGTGGTGCTGGCCGTGCTGGCCCTGATCACCCTGGGCATCTGCTGCGCCTACCGCCGCGGCTACTTCATCAACAACAAGCAGGACGGCGAGAGCTACAAGAACCCGGGCAAGCCGGACGGCGTGAACTACATCCGCACCGACGAGGAGGGCGACTTCCGCCACAAGAGCAGCTTCGTGATC In the embodiments of this application, based on purified humanized JAM-C shRNA, JAM-C siRNA or JAM-C Fc protein, a targeted drug for the treatment of choroidal neovascular ophthalmopathy is developed targeting the active function of JAM-C.

[0031] In the embodiments of this application, the above-mentioned inhibitors targeting JAM-C protein are reagents that target and silence or reduce the expression level of JAM-C gene and / or JAM-C protein, or reagents that inhibit the biological function of JAM-C protein.

[0032] The inhibitors that target silencing or reduce the expression of the JAM-C gene preferably include at least one of the following: small interfering RNA, sgRNA, gene editing vector containing said sgRNA, or shRNA.

[0033] Optionally, in one embodiment of this application, the inhibitor that targets and silences or reduces the expression level of the JAM-C gene is a siRNA targeting the JAM-C protein (also called JAM-C siRNA). This application does not impose any special limitations on the design method of the JAM-C siRNA; any siRNA design principles well-known in the art can be used. In this embodiment, a laser-induced mouse CNV model was established using mice as subjects, and a verification experiment was conducted to examine the effect of targeted silencing of JAM-C gene expression on choroidal angiogenesis. The JAM-C siRNA includes siJAM-CF and siJAM-CR, wherein the nucleotide sequence of siJAM-CF is shown in SEQ ID NO.2, and the nucleotide sequence of siJAM-CR is shown in SEQ ID NO.3.

[0034] SEQ ID NO.2: 5'-GCAACUACCUGGAGCGUGAAU-3'; SEQ ID NO. 3: 5'-AUUCACGCUCCAGGUAGUUGC-3'.

[0035] In another embodiment of this application, the inhibitor that targets and silences or reduces the expression level of the JAM-C gene is a shRNA targeting the JAM-C protein (also called JAM-C shRNA). This application does not impose any special limitations on the design method of the JAM-C shRNA; any shRNA design principles well-known in the art can be used. In this embodiment, a laser-induced mouse CNV model was established using mice as subjects, and a verification experiment was conducted to examine the effect of targeted knockdown of JAM-C gene expression on choroidal angiogenesis. The JAM-C shRNA includes shRNA-1, shRNA-2, or shRNA-3, with corresponding nucleotide sequences shown in SEQ ID NO. 4, SEQ ID NO. 6, and SEQ ID NO. 8, respectively.

[0036] SEQ ID NO.4: 5'-GAGACTCAGCCCTTTATCGCTTCAAGAGAGCGATAAAGGGCTGAGTCTCTTTTT-3', Its target sequence is shown in SEQ ID NO.5: GAGACTCAGCCCTTTATCGC; SEQ ID NO.6: 5'-CCTTCGGCACTCTACAGACATTCAAGAGATGTCTGTAGAGTGCCGAAGGTTTTT-3', Its target sequence is shown in SEQ ID NO.7: CCTTCGGCACTCTACAGACA; SEQ ID NO.8: 5'-GCAAGTACCTGAGCGTGAATTTCAAGAGAATTCACGCTCAGGTACTTGCTTTTT-3', The target sequence it targets is shown in SEQ ID NO.9: GCAAGTACCTGAGCGTGAAT.

[0037] Among them, shRNA-1 has the highest efficiency, while shRNA-3 has good versatility. Those skilled in the art can choose the corresponding shRNA sequence according to their needs, and this application does not make specific limitations in this regard.

[0038] In another embodiment of this application, the reagent for inhibiting the biological function of JAM-C protein is JAM-C Fc protein. This application does not impose any special restrictions on the design method of JAM-C Fc protein, and the design principles of fusion proteins well known in the art can be adopted.

[0039] For example, JAM-C Fc is formed by genetically engineering the fusion of the extracellular region of JAM-C and the Fc segment of human IgG1 (the encoding nucleotide sequence of this JAM-C Fc is shown in SEQ ID NO.10), and is a soluble bait protein. The specific structure is: JAM-C extracellular region (Val32-Asn241) + linker peptide + IgG1 Fc segment (Pro100-Lys330); SEQ ID NO.10: The JAM-C extracellular region coding sequence is 630 bp long, the linker peptide sequence is 30 bp long, and the human IgG1 Fc segment coding sequence is 653 bp long, for a total length of 1313 bp.

[0040] The JAM-C Fc fragment described above is a homodimer with a molecular weight of approximately 50 kDa. It retains the receptor-binding capacity of the extracellular region of JAM-C and can competitively block the homo / heterologous interactions of endogenous JAM-C; the Fc fragment can prolong the half-life, enhance stability, and mediate effector functions.

[0041] Natural JAM-C contains an extracellular region (two Ig-like domains), a transmembrane region, and an intracellular region. It is mainly expressed in endothelial cells, RPE cells, and macrophages, mediating heterologous binding of JAM-C / JAM-B and homologous binding of JAM-C / JAM-C, and regulating vascular permeability and angiogenesis.

[0042] JAM-C Fc: Contains only the extracellular region + Fc segment, without transmembrane / intracellular region; is soluble and can be free in extracellular fluid; acts as a decoy receptor, blocking the pro-angiogenic signal of endogenous JAM-C.

[0043] Therefore, JAM-C Fc is a recombinant soluble fusion form of the extracellular region of JAM-C, retaining ligand-binding ability and functionally antagonizing the pathological effects of natural JAM-C.

[0044] Animal experiments have demonstrated that JAM-C Fc can be directly injected intravitreally to treat CNV, but frequent administration is required. Therefore, as an improvement, the JAM-C Fc protein can be encapsulated in a sustained-release carrier. Encapsulating the JAM-C Fc protein in this carrier allows for slow release of the protein, prolonging its duration of action. It is understood that the carrier can be selected from PLGA microspheres, hyaluronic acid hydrogels, or other commonly used sustained-release carriers in the art; this application does not impose any specific limitations on this.

[0045] In another embodiment of this application, the above-mentioned inhibitor is LNP-shJAM-C, which targets and delivers JAM-C shRNA. This application does not impose any special restrictions on the preparation method of LNP-shJAM-C, and nanoliposome drug delivery technology well known in the art can be used. This application also provides a recombinant vector comprising the aforementioned siRNA or shRNA targeting the JAM-C protein, namely AAV-DJ-siJAM-C or AAV-DJ-shJAM-C. This application does not impose any particular limitation on the construction method of the aforementioned recombinant lentiviral vector AAV-DJ-siJAM-C or AAV-DJ-shJAM-C or the aforementioned recombinant lentivirus; any recombinant lentiviral vector or recombinant lentivirus construction method well known in the art can be used.

[0046] This application also provides a drug for treating choroidal neovascular eye disease, preferably a gene therapy drug. The gene therapy drug includes the above-mentioned inhibitor or the above-mentioned recombinant vector. This invention does not impose any special limitations on the preparation method of the gene therapy drug; any gene therapy drug preparation method well known in the art can be used.

[0047] The following detailed description, in conjunction with specific embodiments, illustrates the application of the JAM-C protein-targeting inhibitor provided in this application in the preparation of drugs for treating CNV-related eye diseases. However, these descriptions should not be construed as limiting the scope of protection of this invention.

[0048] The embodiments of this application were verified using retinal tissue from clinical patients and animals as experimental materials.

[0049] Example 1: Acquisition, culture, and JAM-C gene transfection of human retinal pigment epithelial (RPE) cells and peripheral blood mononuclear macrophages. 1. Sample collection and grouping Normal posterior segment tissue from donated adult corneas was obtained from the Xi'an Central Eye Bank. The vitreous humor and retina were removed, and the eye cups were rinsed with phosphate-buffered saline (PBFS) followed by trypsin digestion for 30 minutes. Retinal pigment epithelial cells were gently scraped off and seeded in epithelial cell culture medium containing 15% fetal bovine serum. Cells were proliferated and passaged, with cells from passages 4-8 used for subsequent experiments.

[0050] Peripheral blood was collected from healthy volunteers and CNV patients, with 10 cases in each group. There were no statistically significant differences in age and sex between the two groups. After gradient centrifugation, leukocytes were separated from the blood, and monocytes were separated and purified using anti-human CD14 (monocyte marker) magnetic beads. The proportion of purified CD14+ cells was greater than 90%. The culture medium was complete monocyte culture medium (RPMI 1640, penicillin 100 U / mL, streptomycin 100 U / mL, L-glutamine 2 mM, and 10% fetal bovine serum). Monocytes were treated with macrophage colony-stimulating factor for 6 days to differentiate into macrophages.

[0051] 2. RPE cell transfection and expression identification Human RPE cells were passaged and seeded in culture dishes. RPE cells were transfected with JAM-C shRNA and a blank vector for 72 hours, respectively. The transfection effect was analyzed using real-time quantitative PCR to determine the expression level of JAM-C at the nucleic acid level. Primers for real-time quantitative PCR are shown in Table 1.

[0052] Table 1: Primers for Real-Time Quantitative PCR Western blot analysis was used to verify the expression level of JAM-C at the protein level. Transfected RPE cells were lysed, centrifuged, and the protein was quantified. After 10% polyacrylamide gel electrophoresis, the cells were transferred to a membrane. JAM-C monoclonal antibody (commercially available products such as rabbit anti-mouse JAM-C monoclonal antibody) and horseradish peroxidase-labeled fluorescent secondary antibody were added sequentially. The signal intensity was detected using chemiluminescence reagents, and quantitative analysis was performed using a LAS-3000 imaging system.

[0053] To investigate the potential role of adhesion molecule C in choroidal neovascularization (CNV) formation, this study used real-time quantitative PCR, Western blot, and immunofluorescence staining to analyze the expression of JAM-C in normal retinal tissue sections and choroidal neovascularization tissue sections.

[0054] (1) Real-time quantitative PCR analysis showed that JAM-C expression in retinal tissue did not change significantly during CNV formation, while JAM-C expression in the lesion area (including the neovascularized choroid-retinal pigment epithelium complex) was upregulated over time. On day 4 of CNV formation, JAM-C expression in choroidal neovascularization tissue began to increase and peaked on day 14. Figure 1 A, 1B; Sample size n=8).

[0055] (2) Western blot analysis showed that JAM-C protein expression was elevated in choroidal neovascularization tissue. Figure 1 C).

[0056] (3) Immunofluorescence staining results showed that JAM-C was highly expressed in the neovascularization region of the choroid ( Figure 1 D, the underlined area represents neovascularization lesions), while in normal retinal tissue, JAM-C is mainly expressed in the retinal pigment epithelium, the inner and outer segments of cone and rod cells, and the inner retinal retina (see D). Figure 1 E), Bar: 50 µm. * P＜ 0.01; ** P＜ 0.001.

[0057] The above analysis results indicate that JAM-C expression in the lesion area was significantly upregulated during choroidal neovascularization, suggesting that JAM-C is involved in regulating the occurrence and development of choroidal neovascularization.

[0058] Example 2: Establishment of a laser-induced mouse choroidal neovascularization model and investigation of the effect of JAM-C target intervention on CNV generation. 1. Establish a laser-induced mouse CNV model Female C57B16 mice aged 8-10 weeks were used for the experiment. After anesthesia, one eye was randomly selected and 4 points around the optic disc were irradiated with an 810nm infrared laser (set values: spot size 75µm, exposure time 75ms, energy 90mW).

[0059] 2. Study the impact of JAM-C target intervention on CNV generation. JAM-C Fc protein intervention group: 1µg of the drug was injected into the vitreous cavity immediately after laser treatment, and the injection was repeated on the 4th day after laser treatment. Antibiotic eye ointment was applied after the injection. Control group: Intravitreal injection of IgG Fc protein.

[0060] (1) IB4 staining and measurement of CNV area One week after laser treatment, the eyeballs were enucleated for retinal smears or sections, stained with IB4, and the CNV area was measured. Compared with the control Fc protein group, JAM-C Fc protein intervention significantly reduced the area of ​​choroidal neovascularization (Figures 2A and 2B; n=8; P<0.01). Histological analysis also confirmed that JAM-C Fc protein treatment significantly reduced the area of ​​choroidal neovascularization (Figures 2C and 2D; n=8; P<0.01).

[0061] (2) Fluorescence angiography to assess choroidal neovascularization leakage One week after laser-induced choroidal neovascularization in mice, fundus fluorescein angiography was performed. 100 µL of FITC-dextran (20 mg / mL) was slowly injected via the tail vein over 10 seconds. Twenty minutes later, the eyeball was enucleated, and a retinal retina was prepared for imaging. Leakage images of the choroidal neovascularization tissue were recorded under a fluorescence microscope. Two researchers scored the leakage: Grade 0: no leakage; Grade 1: mild leakage; Grade 2: moderate leakage; Grade 3: severe leakage. The average score from the two researchers was taken as the final result. If the difference between the two researchers' scores was greater than 1, further discussion and evaluation were conducted, and the average score was used.

[0062] fluorescein fundus angiography results showed that, one week after laser modeling, JAM-C Fc protein intervention significantly reduced vascular leakage in choroidal neovascularization. Figure 2 E, 2F; n=10; P<0.01).

[0063] (3) Immunofluorescence staining analysis of JAM-C expression and macrophage chemotaxis in CNV. One week after laser-induced choroidal neovascularization in mice, the eyes were enucleated, the cornea and lens were removed, and the eye cups were embedded for immunofluorescence staining of tissue sections. Sections were fixed in 4% paraformaldehyde and treated with 0.1% Triton X-100 for 5 minutes. After incubation with 5% goat serum at room temperature for 1 hour, the sections were incubated with rabbit anti-mouse JAM-C or rat anti-mouse Mac3 primary antibody, followed by incubation with fluorescent secondary antibody. The sections were photographed under a fluorescence microscope, and statistical analysis was performed.

[0064] Immunofluorescence staining analysis of Mac3 in choroidal neovascularization tissue sections + Staining (red, macrophage markers) results showed that JAM-C Fc protein significantly inhibited the number of macrophages in CNV tissue. Figure 3 AC).

[0065] Example 3: Investigating the effect of JAM-C targeted inhibition on blood-retinal outer barrier function 1. Investigating the effect of JAM-C Fc protein on macrophage migration across the hRPE cell layer. Human RPE cells were seeded at the bottom of the lower chamber of a reversible cell culture dish and cultured for 24 hours to allow for cell adhesion and growth. The dish was then inverted to its normal orientation, with the upper pole of the cells facing the lower chamber, and cultured for another 3 weeks until confluence. The cell chemokine MCP-1 (50 ng / mL) was added to the lower chamber, and macrophages from healthy adults or CNV patients were added to the upper chamber. The experiment was divided into three groups: Group A with MCP-1 added to the upper chamber, Group B with IgG Fc protein added, and Group C with JAM-C Fc protein added. All cells were incubated together at 37°C for 3 hours, and the number of macrophages migrating across the RPE cell layer was counted.

[0066] In vitro experiments showed that JAM-C Fc protein inhibited the basal-to-apical migration of macrophages derived from patients with wet age-related macular degeneration (wet AMD) across the human retinal pigment epithelium (hRPE) monolayer (Fig. 3D; n=5; P<0.01). This inhibitory effect was not observed in macrophages derived from healthy controls (Fig. 3E; n=5).

[0067] The above results suggest that JAM-C is involved in regulating the translaminar migration of macrophages and the infiltration of lesions under pathological conditions.

[0068] 2. To investigate the migration and proliferation capabilities of human RPE cells with low JAM-C expression. Retinal pigment epithelial (hRPE) cells play a key role in the pathogenesis of choroidal neovascularization (CNV). Previous studies have confirmed that hRPE cells express the JAM-C protein. Therefore, this application further investigates whether knockdown of JAM-C affects the migration and proliferation capabilities of hRPE cells.

[0069] Human RPE cells were transfected with JAM-C shRNA to obtain human RPE cells with low JAM-C expression. Normal human RPE cells and human RPE cells with low JAM-C expression were seeded in the upper chamber of a Transwell culture dish, while macrophage conditioned medium from CNV patients was added to the lower chamber. Macrophage conditioned medium from normal adults served as a control. After 18 hours of culture, the number of RPE cells migrating to the lower chamber was counted using HE staining. The MTT assay was used to compare and analyze the proliferation changes of normal human RPE cells and human RPE cells with low JAM-C expression.

[0070] Real-time quantitative PCR results showed that after intervention with JAM-C shRNA, the expression level of JAM-C in hRPE cells decreased to about 20% of that in the control group (Figure 4A). Western blot assays further confirmed that JAM-C protein levels decreased after transfection (Figure 4B). Transwell migration assay results showed that when using conditioned medium of macrophages from wet AMD patients as a chemokine, JAM-C gene knockdown significantly inhibited hRPE cell migration compared with the empty vector group and the blank control group; however, when induced with 10% fetal bovine serum (FBS) or 0.2% fetal bovine serum, there was no statistically significant difference in cell migration ability among the three groups (Figure 4C; n=3; P<0.01).

[0071] Furthermore, JAM-C gene knockdown had no significant effect on the proliferation capacity of RPE cells (data not shown).

[0072] 3. Investigating changes in the osmotic function of human RPE cell layers with low JAM-C expression. The retinal pigment epithelium (RPE) maintains the integrity of the blood-retinal outer barrier (BRB), preventing certain substances from entering the retina. Therefore, this application further investigates whether JAM-C gene knockdown affects the permeability of the RPE barrier.

[0073] Normal human RPE cells or human RPE cells with low JAM-C expression were cultured until they fused to form a monolayer. Three different stimulation conditions were used: A: conditioned medium of peripheral blood macrophages from CNV patients; B: VEGF; C: histamine, treating RPE cells for 1 hour each. Fluorescent dye was added to the upper chamber of the cell culture dish, and after 30 minutes, 20 µl of culture medium was collected from the lower chamber. The fluorescence intensity in the culture medium was measured using a fluorescence intensity meter to quantitatively analyze the leakage of fluorescent dye and determine the effect of low JAM-C expression on the permeability of the human RPE cell layer.

[0074] Permeability assay results showed that 30 minutes after the addition of fluorescein dye, the concentration of fluorescein in the basal compartment of cells transfected with JAM-C shRNA was significantly lower than that in the other two control groups (Figure 5; n=3; P<0.01).

[0075] The study suggests that knocking down JAM-C can reduce the barrier permeability of the human retinal pigment epithelium (hRPE) cell monolayer, meaning that the barrier function of the RPE cell layer is enhanced.

[0076] This application, through the above embodiments, demonstrates that intravitreal injection of JAM-C-targeted drugs can significantly inhibit CNV formation and reduce choroidal vascular tissue leakage. Targeted inhibition of JAM-C expression in retinal pigment epithelial cells can suppress cell migration, reduce retinal pigment epithelial leakage, and enhance the blood-retinal outer barrier function. Therefore, JAM-C has clear application value in the preparation of drugs for treating choroidal neovascularization.

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of this application.

Claims

1. The application of an inhibitor targeting JAM-C protein in the preparation of a drug for treating choroidal neovascularization, characterized in that, The inhibitor can suppress the expression of JAM-C protein.

2. The application as described in claim 1, characterized in that, The encoding nucleotide sequence of the JAM-C protein is shown in SEQ ID NO.

1.

3. The application as described in claim 1, characterized in that, The inhibitor is a siRNA that targets the JAM-C protein. The siRNA that targets the JAM-C protein includes siJAM-CF and siJAM-CR, wherein the nucleotide sequence of siJAM-CF is shown in SEQ ID NO.2 and the nucleotide sequence of siJAM-CR is shown in SEQ ID NO.

3.

4. The application as described in claim 1, characterized in that, The inhibitor may also be an shRNA targeting the JAM-C protein, and the nucleotide sequence of the shRNA targeting the JAM-C protein is shown in SEQ ID NO.4, SEQ ID NO.6, or SEQ ID NO.

8.

5. The application as described in claim 1, characterized in that, The inhibitor may also be a reagent that inhibits the biological function of JAM-C protein, wherein the reagent that inhibits the biological function of JAM-C protein is JAM-C Fc protein.

6. The application as described in claim 5, characterized in that, The JAM-C Fc protein was embedded in a sustained-release carrier, which included PLGA microspheres and hyaluronic acid hydrogel.

7. A recombinant vector, characterized in that, This includes the siRNA targeting the JAM-C protein as described in claim 3 or the shRNA targeting the JAM-C protein as described in claim 4.

8. The use of the recombinant carrier as described in claim 7 in the preparation of a drug for treating choroidal neovascular eye disease.

9. A drug for treating choroidal neovascularization of the eye, characterized in that, The drug comprises the inhibitor of claim 1, 3, 4 or 5 or the recombinant vector of claim 7.

10. The application as described in claim 1 or 8, characterized in that, The choroidal neovascular eye diseases include wet age-related macular degeneration, high myopia macular degeneration, idiopathic CNV, and ocular histoplasmosis syndrome.

Images