Recombinant oncolytic virus and small molecule anticancer drug combination therapy for tumor
The combined treatment of recombinant oncolytic viruses and small molecule anticancer drugs has solved the problems of pathogenicity of oncolytic viruses and drug resistance and low efficiency of small molecule anticancer drugs, achieving a stronger tumor cell killing effect and showing broad clinical application prospects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- JOINT BIOSCIENCES (SH) LTD
- Filing Date
- 2023-07-26
- Publication Date
- 2026-07-14
AI Technical Summary
Existing oncolytic viruses pose a risk of pathogenicity in tumor immunotherapy and have poor cure rates after modification, while small molecule anticancer drugs face challenges of drug resistance and low efficiency.
The treatment of tumors involves combining recombinant oncolytic viruses with small molecule anticancer drugs. By inserting cytokines and expressing antigens into the oncolytic virus, the small molecule anticancer drugs can attack tumor cells, thereby enhancing the anti-tumor effect.
It improves the therapeutic effect on tumor cells, overcomes the limitations of using recombinant oncolytic viruses or small molecule anticancer drugs alone, achieves stronger antitumor effects, and has broad clinical application prospects.
Smart Images

Figure FT_1 
Figure FT_2 
Figure SMS_1
Abstract
Description
[0001] This application is a divisional application of the invention entitled "Method for Combined Treatment of Tumors with Recombinant Oncolytic Virus and Small Molecule Anticancer Drugs", filed on July 26, 2023, with application number 2023109214698. Technical Field
[0002] This application relates to the field of biomedicine, specifically to a drug for the combined treatment of tumors using a recombinant oncolytic virus and a small molecule anticancer drug. Background Technology
[0003] Oncolytic viruses are a class of tumor-killing viruses with replication capabilities, and are now widely accepted as an important branch of tumor immunotherapy. Oncolytic viruses can specifically target and infect tumor cells, for example, by utilizing the inactivation or defect of oncolytic virus genes in tumor cells, thereby selectively infecting tumor cells. After infecting tumor cells, oncolytic viruses replicate extensively within the tumor cells and ultimately destroy them, thus killing the tumor cells. Simultaneously, oncolytic viruses can also provide the immune stimulation signals necessary for the host's own anti-cancer response, thereby attracting more immune cells to continue killing residual tumor cells.
[0004] While oncolytic viruses show promise in tumor immunotherapy, wild-type oncolytic viruses often cause damage and dysfunction to tissues and organs, and pose a significant pathogenic risk when infecting tumor cells. Therefore, to further advance the clinical application of oncolytic viruses, it is necessary to modify wild-type oncolytic viruses to obtain attenuated versions. Using attenuated oncolytic viruses in clinical applications will reduce the pathogenic risk and improve the safety of oncolytic viruses.
[0005] However, in the process of modifying oncolytic viruses, if only wild-type oncolytic viruses are randomly genetically modified, although their toxicity can be reduced, the modified oncolytic viruses may have poor cure rates, and the modified oncolytic viruses may even be unable to be packaged, which is not conducive to promoting the clinical application of oncolytic viruses.
[0006] With the development of modern molecular biology and the application of advanced technologies such as computer-aided drug design, structural biology, and combinatorial chemistry, small molecule anticancer drugs have entered a stage of rapid development. To date, the FDA (United States Food and Drug Administration) and NMPA (National Medical Products Administration) have approved 89 small molecule anticancer drugs for the treatment of various cancers. Thousands of targeted therapies are undergoing clinical trials for cancer treatment. Among them, a large number of promising drugs have entered Phase III trials. It is predicted that the global anticancer drug market will reach $200 billion in 2021, with targeted therapies being the "main force." Despite significant progress, small molecule anticancer drugs still face some challenges.
[0007] The first major challenge is drug resistance. Almost all targeted anticancer drugs develop resistance after a period of clinical use. Resistance is related to many mechanisms, including gene mutations, amplification, tumor stem cells, efflux transporters, apoptosis dysregulation, and autophagy. Gene mutations are the primary cause of antitumor drug resistance. Low efficacy is another major challenge for targeted anticancer drugs. Targeted anticancer drugs are effective only in a limited number of patients. For example, less than 20% of non-small cell lung cancer patients are sensitive to EGFR inhibitors such as gefitinib and erlotinib. Summary of the Invention
[0008] To further improve the therapeutic effect on tumor cells, this application provides a drug for the combined treatment of tumors using a recombinant oncolytic virus and a small molecule anticancer drug.
[0009] Oncolytic viruses are a class of tumor-killing viruses with replication capabilities, and are now widely accepted as an important branch of tumor immunotherapy. Oncolytic viruses can specifically target and infect tumor cells, for example, by utilizing the inactivation or defect of oncolytic virus genes in tumor cells, thereby selectively infecting tumor cells. After infecting tumor cells, oncolytic viruses replicate extensively within the tumor cells and ultimately destroy them, thus killing the tumor cells. Simultaneously, oncolytic viruses can also provide the immune stimulation signals necessary to enhance the host's own anti-cancer response, thereby attracting more immune cells to continue killing residual tumor cells. Therefore, oncolytic viruses have the ability to disrupt the tumor tissue microenvironment and transform "cold tumors" into "hot tumors."
[0010] Meanwhile, although small-molecule anticancer drugs have entered a phase of rapid development, with thousands of targeted drugs undergoing clinical trials for cancer treatment, despite significant progress, they still face challenges such as drug resistance and low efficacy. The treatment method described in this application utilizes a combination of recombinant oncolytic viruses and small-molecule anticancer drugs to attack and kill tumor cells, thereby achieving a synergistic effect greater than the sum of its parts.
[0011] Furthermore, to enhance therapeutic efficacy, cytokines can be inserted and expressed into oncolytic viruses. The synergistic effect of these three antitumor mechanisms—oncolytic viruses, cytokines, and small-molecule anticancer drugs—results in a stronger antitumor effect.
[0012] This application provides a drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug, employing the following technical solution: A drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug; The small molecule anticancer drug is a small molecule anticancer drug that targets KRAS; The recombinant oncolytic virus includes M protein, G protein, N protein, P protein, and L protein.
[0013] Compared with the amino acid sequence shown in SEQ ID NO 1, the site mutation of the M protein includes any one or more of M51R, V221F, and S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; or the site mutation of the M protein includes N32S, N49D, M51R, H54Y, knockout of the leucine-encoded base at position 111, V221F, and V225I. 25I, S226R, or any one or more of the following: or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes G21 E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R. Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, S226R.
[0014] Compared with the amino acid sequence shown in SEQ ID NO 12, the site mutations of the G protein include any one or more of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.
[0015] Compared to the amino acid sequence shown in SEQ ID NO 14, the site mutations of the N protein include any one or more of I14V, R155K, and S353N.
[0016] Compared with the amino acid sequence shown in SEQ ID NO 16, the site mutations of the P protein include any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.
[0017] Compared to the amino acid sequence shown in SEQ ID NO 18, the site mutations of the L protein include any one or more of S87P and I487T.
[0018] In this application, the wild-type VSV virus Indiana MuddSummer subtype M protein contains the amino acid sequence shown in SEQ ID NO 1.
[0019] In one specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 2.
[0020] In one specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 3.
[0021] In one specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 4.
[0022] In one specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 5.
[0023] In one specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 6.
[0024] In one specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 7.
[0025] In one specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 8.
[0026] In one specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 9.
[0027] In one specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 10.
[0028] In one specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 11.
[0029] In this application, the G protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in SEQ ID NO 12.
[0030] In one specific embodiment, the G protein has the amino acid sequence shown in SEQ ID NO 13.
[0031] In this application, the N protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in SEQ ID NO 14.
[0032] In one specific embodiment, the N protein comprises an amino acid sequence as shown in SEQ ID NO 15.
[0033] In this application, the wild-type VSV virus Indiana MuddSummer subtype P protein contains the amino acid sequence shown in SEQ ID NO 16.
[0034] In one specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 17.
[0035] In this application, the wild-type VSV virus Indiana MuddSummer subtype L protein contains the amino acid sequence shown in SEQ ID NO 18.
[0036] In one specific embodiment, the L protein comprises the amino acid sequence shown in SEQ ID NO 19.
[0037] Preferably, the recombinant oncolytic virus includes any one or more of rod-shaped viruses, poxviruses, herpes simplex viruses, measles viruses, Semliki Forest virus, poliovirus, reovirus, Seneca Valley virus, echovirus, Coxsackie virus, Newcastle disease virus, and Malaba virus.
[0038] In some specific implementations, the recombinant oncolytic virus is obtained by site-directed mutation based on a rod-shaped virus.
[0039] In some specific implementations, the recombinant oncolytic virus is obtained by site-directed mutation of vesicular stomatitis virus (VSV).
[0040] In some specific implementations, the recombinant oncolytic virus is obtained by site-directed mutation based on the VSV Indiana MuddSummer subtype.
[0041] Furthermore, the recombinant oncolytic virus also includes an antigen encoded by a foreign gene.
[0042] Furthermore, the antigen is selected from solid tumor antigens or hematologic malignancy antigens.
[0043] Furthermore, the solid tumor antigens include, but are not limited to, 5T4, ROR1, EGFR, FcγRI (CD64), FcγRIIa (CD32a), FcγRIIb (CD32b), CD28, CD137 (4-1BB), CTLA-4, HER2, HER3, FAS, FAP (fibroblast activation protein), LGR5, C5aR1, A2AR, fibroblast growth factor receptor 1 (FGFR1), FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related (GITR) protein, lymphotoxin-β receptor (LTβR), tumor necrosis factor-related apoptosis-inducing ligand receptor 1 (TRAIL receptor 1), T RAIL receptor 2, prostate-specific membrane antigen (PSMA) protein, prostate stem cell antigen (PSCA) protein, tumor-associated protein carbonic anhydrase IX (CAIX), epidermal growth factor receptor 1 (EGFR1), EGFRvIII, ErbB3 (HER3), folate receptor, liver glycoprotein receptor, PDGFRa, ErbB-2, CD2, CD40, CD74, CD80, CD86, CCAM5 (CD66e), CCAM6 (CD66c), p53, MET (tyrosine protein kinase Met), HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10 MAGE-A12, BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, Tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC2, P-cadherin, Myostatin (GDF8), Cripto (TDGF1), MUC5AC, PRAME P15, RU1, RU2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, Mesothelin (MSLN)DR5, PD-1, PD-L1, IGF-1R, CXCR4, Neuropilin 1 (NRP-1), Glypican 2 / 3 (GPC 2 / 3), EphA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGFR-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP2, FOLR1, AXL, Claude 18.2, MUC1, TPBG, CEA, EpCAM.
[0044] Furthermore, the hematologic tumor antigens include, but are not limited to, BCMA (TNFRSF17), CD4, CD5 (Leu-1), CD7, CD10, FcγRIIIa (CD16a), FcγRIIIb (CD16b), CD19, CD20 (MS4A1), CD22 (Siglec-2), CD23, CD30 (TNFRSF8), CD33 (Siglec-3), CD34, CD37, CD38, CD44, CD47, CD56 (NCAM1), and CD7. 0. CD117, CD123 (IL3RA), CD138 (SDC1), CD174, CLL-1, ROR1, NKG2DL1 / 2 (ULBP1 / 2), IL1R3 (IL-1-RAP), FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR8, SHP2, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, c-Kit, SLAMF3 (CD229), SLAMF7 (CD319), TCR B-chain, ITGB7, k-1gG, TACI, TRBCI, LeY.
[0045] Further, the antigen is selected from any one or more of the following: CD19, CD22, BCMA, MUC1, NY-ESO-1, MAGE A4, MET, Claude 18.2, MSLN, EGFR, VEGFR2, HER2, TPBG, AFP, MAGE-A10.
[0046] In one specific embodiment, the antigen CD19 comprises an amino acid sequence as shown in SEQ ID NO 20.
[0047] In one specific embodiment, the antigen CD22 comprises an amino acid sequence as shown in SEQ ID NO 21.
[0048] In one specific embodiment, the antigen NY-ESO-1 comprises an amino acid sequence as shown in SEQ ID NO 22.
[0049] In one specific implementation, the antigen MAGE A4 comprises an amino acid sequence as shown in SEQ ID NO 23.
[0050] In one specific embodiment, the antigen Claude 18.2 comprises the amino acid sequence shown in SEQ ID NO 24.
[0051] In one specific implementation, the antigen EGFR comprises an amino acid sequence as shown in SEQ ID NO 25.
[0052] In one specific implementation, the antigen HER2 comprises an amino acid sequence as shown in SEQ ID NO 26.
[0053] Furthermore, the small molecule anticancer drugs targeting KRAS include, but are not limited to, small molecule anticancer drugs targeting KRAS G12A, KRAS G12C, KRAS G12D, KRAS G12R, KRAS G12V, KRAS G13D, KRAS Q61L, and KRAS Q61H.
[0054] Furthermore, the small molecule anticancer drugs targeting KRAS G12C include, but are not limited to, Sotorasib and Adagrasib.
[0055] Small molecule anticancer drugs that target EGFR, including but not limited to Mobocertinib.
[0056] Small molecule anticancer drugs indicated for melanoma, including but not limited to Vemurafenib, Dabrafenib, Encorafenib, Trametinib, Binimetmib, and Cobimetinib.
[0057] Small molecule anticancer drugs indicated for cell tumors or sarcomas, including but not limited to Pexidartinib, tazemetostat, Pazopanib, and Anlotinib.
[0058] Small molecule anticancer drugs indicated for leukemia, including but not limited to Imatini b, Bosutini b, Nilotinib, Gilteritinib, and Ivosidenib.
[0059] Small molecule anticancer drugs indicated for NSCLC, including but not limited to Sotorasib, Capmatinib, Tepotinib, Savolitinib, Pralsetinib, selpercatinib, Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Lorlatinib, Afatinib, Dacomitinib, Erlotinib, Gefitinib, Icotinib, Mobocertinib, Osimertinib, Rybrevant, and Befotinib.
[0060] Furthermore, the small molecule anticancer drug is selected from any one or more of the following: tivazanib, Everolimus, Sirolimus, Temsirolimus, Midostaurin, Ripretinib, Selumetinib, Larotrectinib, Lurbinectedin, and Olverembatinib.
[0061] Furthermore, the small molecule anticancer drug is selected from any one or more of the following: Drugs: Lorlatinib, Acalabrutinib, Ibrutinib, Zanubrutinib, Erlotinib, Gefitinib, Icotinib, Osimertinib, Rybrevant, Erdafitinib, Infigratin ib、Pemazyre、Pemigatinib、Pyrotinib、Tucatinib、Avapritinib、Fluzoparib、Niraparib、Olaparib、Rucaparib、linperlisib、Apatinib、Abemaciclib、Dalpiciclib、Palbociclib ib, Ribociclib, Vemurafenib, Dabrafenib, Encorafenib, Trametinib, Binimetmib, Cobimetinib, Pexidartinib, tazemetostat, Gilteritinib, Ivosidenib, Sotorasib, Capmatinib, Tepotinib, Savolitinib, Pralsetinib, selpercatinib, Everolimus, Sirolimus, Temsirolimus, Midostaurin, Ripretinib, Selumetinib, Larotrectinib, Lurbinectedin.
[0062] Multi-targeted small molecule anticancer drugs, including but not limited to: Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Afatinib, Dacomitinib, Lapatinib, Mobocertinib, Dasatinib, Neratinib, duvelisib, Axitinib, Lenvatinib, Pazopanib, Regorafenib, Anlotinib, Cabozantinib, Sunitinib, Vandetanib, Ponatinib, Sorafenib, Imatinib, Bosutinib, Nilotinib, tivazanib.
[0063] Furthermore, the small molecule anticancer drug is selected from any one or more of the following: Ceritinib, Ibrutinib, Afatinib, Dacomitinib, Icotinib, Lenvatinib, Pazopanib, Anlotinib, Pyrotinib, Niraparib, Olaparib, Regorafenib, Palbociclib, Vemurafenib, Savolitinib, Everolimus, Mobocertinib, and Sotorasib.
[0064] Furthermore, the recombinant oncolytic virus also includes cytokines encoded by exogenous genes.
[0065] Furthermore, the cytokines are selected from interleukins, interferons, tumor necrosis factor, colony-stimulating factor, transforming growth factor β, and chemokine families.
[0066] Further, the cytokines are selected from any one or more of the following: GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN-β, IFN-γ, IFN-β, TGF-β, and TNF-α.
[0067] Furthermore, the cytokines are selected from any one or more of the following: GM-CSF, IL-2, IL-12, IL-15, IL-18, TNF-α, IFN-β.
[0068] In one specific embodiment, the cytokine IL-12A comprises an amino acid sequence as shown in SEQ ID NO 27.
[0069] In one specific embodiment, the cytokine IL-12B comprises an amino acid sequence as shown in SEQ ID NO 28.
[0070] In one specific embodiment, the cytokine IL-18 comprises an amino acid sequence as shown in SEQ ID NO 29.
[0071] In some specific embodiments, the recombinant oncolytic virus comprises a nucleic acid molecule; the nucleic acid molecule comprises a nucleic acid sequence encoding the M protein with the site mutation, a nucleic acid sequence encoding the G protein with the site mutation, a nucleic acid sequence encoding the N protein with the site mutation, a nucleic acid sequence encoding the P protein with the site mutation, and a nucleic acid sequence encoding the L protein with the site mutation.
[0072] In one specific embodiment, the KRAS G12C comprises an amino acid sequence as shown in SEQ ID NO 30.
[0073] In one specific embodiment, the nucleic acid molecule further includes a nucleic acid sequence encoding a cytokine.
[0074] In one specific embodiment, the nucleic acid molecule further includes a nucleic acid sequence encoding an antigen.
[0075] In one specific embodiment, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein with the site mutation and the nucleic acid sequence encoding the L protein with the site mutation.
[0076] In one specific embodiment, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the G protein with the site mutation and the nucleic acid sequence encoding the L protein with the site mutation.
[0077] The antigen sequence inserted into the recombinant oncolytic virus can be the full sequence or a partially specific sequence. Similarly, the target sequence inserted into the recombinant oncolytic virus can be the full sequence or a partially specific sequence. Likewise, the cytokine inserted into the recombinant oncolytic virus can be the full sequence or a partially specific sequence.
[0078] In some specific embodiments, the combination of the recombinant oncolytic virus and the small molecule anticancer drug for the treatment of tumors is used to continuously kill abnormally proliferating cells.
[0079] In some specific embodiments, the abnormally proliferating cells are selected from tumor cells or related cells of tumor tissue.
[0080] In some specific implementations, the tumor includes a solid tumor or a hematoma.
[0081] In some specific embodiments, the tumors include, but are not limited to, acute lymphoblastic leukemia, acute B-lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-Hodgkin's lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), sensory neuroblastoma, Ewing sarcoma, fallopian tube cancer, gallbladder cancer, and gastric cancer. Gastrointestinal carcinoid tumors, hepatocellular carcinoma, hypopharyngeal carcinoma, Kaposi's sarcoma, renal cancer, Langerhans cell carcinoma, laryngeal cancer, liver cancer, lung cancer, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary adenoma, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small bowel cancer, squamous neck cancer, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and vascular tumors.
[0082] This application also provides a composition comprising the above-described oncolytic virus vaccine and a small molecule anticancer drug.
[0083] In summary, this application has the following beneficial effects: The method for treating tumors using recombinant oncolytic virus combined with small molecule anticancer drugs provided in this application has a significant inhibitory effect on tumor growth. Furthermore, the experimental results of treating tumors with recombinant oncolytic virus directly combined with small molecule anticancer drugs are superior to those of treating tumors with recombinant oncolytic virus alone or with small molecule anticancer drugs alone. The experimental results of treating tumors with recombinant oncolytic virus containing inserted and expressed antigen fragments, combined with small molecule anticancer drugs, are superior to those of treating tumors with recombinant oncolytic virus directly combined with small molecule anticancer drugs or with recombinant oncolytic virus containing inserted and expressed antigen fragments directly. Therefore, the method for treating tumors using recombinant oncolytic virus and small molecule anticancer drugs provided in this application further effectively improves the therapeutic effect on tumor cells.
[0084] The method for treating tumors using a combination of recombinant oncolytic virus and small molecule anticancer drugs provided in this application exhibits good inhibitory ability on tumor cell growth. It can be determined that this method also shows good inhibitory ability on other cancer cells, and has broad clinical application prospects. Attached Figure Description
[0085] Figure 1 This is the result of an animal trial demonstrating the combined use of recombinant oncolytic virus and the small molecule anticancer drug Mobocertinib for the treatment of tumors.
[0086] Figure 2This is the result of an animal trial using a combination of recombinant oncolytic virus and the small molecule anticancer drug Sotorasib to treat tumors.
[0087] Other aspects and advantages of this application will readily be apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive. Detailed Implementation
[0088] The following specific embodiments illustrate the implementation of the invention. Those skilled in the art can easily understand other advantages and effects of the invention from the content disclosed in this specification.
[0089] Terminology Definition In this application, the term "oncolytic virus" generally refers to a virus capable of replicating in and killing tumor cells. Oncolytic viruses include, but are not limited to: vesicular stomatitis virus (VSV), poxvirus, herpes simplex virus (HSV), measles virus, Semlikie forest virus, poliovirus, reovirus, Seneca Valley virus (SVV), echovirus, Coxsackie virus, Newcastle disease virus (NDV), and Malaba virus. In some embodiments, the oncolytic virus is modified to increase its selectivity for tumor cells. In some embodiments, the oncolytic virus is modified to reduce its immunogenicity.
[0090] In some implementations, the VSV virus is a mutant of the Indiana MuddSummer subtype of VSV virus, which can be used to treat tumors. This virus does not interact with endogenous IFN-β in normal cells and can only selectively amplify and grow in tumor cells.
[0091] VSV viruses can express a variety of cell surface molecules, including low-density lipoprotein receptors, phosphatidylserine, sialolipids, and heparan sulfate, and can attach to the cell surface through these molecules. Compared with other oncolytic cell virus platforms currently under development, VSV viruses have the following advantages: (1) small genome, short replication time, and fast cross-synaptic speed; (2) The exogenous gene expression is extremely high, so it can have a high titer, allowing for large-scale production; (3) it has an independent cell cycle and there is no risk of transformation in the cytoplasm of the host cell. This oncolytic virus does not integrate into the DNA, and after attenuation, it can avoid the neurological inflammation caused by the wild-type virus. Given the above characteristics, VSV has great potential in tumor immunotherapy.
[0092] In some implementations, site-directed gene mutations can be performed on the M protein, and / or G protein, and / or N protein, and / or P protein, and / or L protein of the VSV virus.
[0093] In some embodiments, the recombinant oncolytic virus described in this application may be a genetically modified oncolytic virus, such as one or more modified genes to enhance its tumor selectivity and / or preferentially replicate in dividing cells. The genetic modification may involve modifying genes involved in DNA / RNA replication, nucleic acid metabolism, host orientation, surface attachment, virulence, lysis, and diffusion processes, or it may involve integrating exogenous genes. The exogenous genes may include exogenous immune regulatory genes, exogenous selection genes, exogenous reporter genes, etc. The modified oncolytic virus may also be an amino acid-modified oncolytic virus, such as through the insertion, deletion, or substitution of one or more amino acids.
[0094] In this application, the term "M protein" generally refers to the VSV viral matrix protein. The M protein is an important virulence factor of VSV and is also a known VSV protein that can interfere with the innate immune response in mice. The term "M protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the wild-type VSV virus Indiana MuddSummer subtype M protein may contain the amino acid sequence shown in SEQ ID NO 1. In this application, the oncolytic virus M protein may contain the amino acid sequences shown in SEQ ID NO 2-11.
[0095] In this application, the term "G protein" generally refers to the glycoprotein of VSV virus, also known as the envelope protein. The term "G protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the G protein of the wild-type VSV virus IndianaMuddSummer subtype may contain the amino acid sequence shown in SEQ ID NO 12. In this application, the G protein of the oncolytic virus may contain the amino acid sequence shown in SEQ ID NO 13.
[0096] In this application, the term "N protein" generally refers to the nucleocapsid protein of VSV virus. The term "N protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the N protein of the wild-type VSV virus IndianaMuddSummer subtype may contain the amino acid sequence shown in SEQ ID NO 14. In this application, the N protein of the oncolytic virus may contain the amino acid sequence shown in SEQ ID NO 15.
[0097] In this application, the term "P protein" generally refers to a phosphoprotein of VSV virus. The term "P protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the P protein of the wild-type VSV virus Indiana MuddSummer subtype may contain the amino acid sequence shown in SEQ ID NO 16. In this application, the P protein of the oncolytic virus may contain the amino acid sequence shown in SEQ ID NO 17.
[0098] In this application, the term "L protein" generally refers to the VSV viral RNA polymerase protein. The L gene of VSV virus encodes an RNA polyE protein. The term "L protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In this application, the L protein of the wild-type VSV virus Indiana MuddSummer subtype may contain the amino acid sequence shown in SEQ ID NO 18. In this application, the L protein of the oncolytic virus may contain the amino acid sequence shown in SEQ ID NO 19.
[0099] In this application, protein mutation sites are typically described as "amino acid + amino acid position + mutated amino acid". In this application, the mutation may include, but is not limited to, the addition, substitution, deletion, and / or removal of amino acids. For example, the term "M51R" typically refers to a mutation at position 51, where methionine M is replaced by arginine R.
[0100] In this application, the term "amino acid substitution" generally refers to replacing an amino acid residue present in the parental sequence with another amino acid residue. The amino acid in the parental sequence can be substituted, for example, via chemical synthesis or by recombination methods known in the art. Therefore, "substitution at position xx" generally means replacing the amino acid present at position xx with an alternative amino acid residue. In this application, the amino acid substitution may include amino acid mutations.
[0101] In this application, the term "mutation" generally refers to an alteration of the nucleotide or amino acid sequence of a wild-type molecule. Amino acid changes can include substitution, deletion, omission, insertion, addition, truncation, or protein processing or cleavage.
[0102] In this application, the recombinant oncolytic virus is synthesized by site-directed gene mutation of the M, and / or G, and / or N, and / or P, and / or L proteins of VSV virus, while integrating exogenous genes. Specifically, the exogenous genes are genes encoding antigens and / or cytokines.
[0103] In this application, "small molecule anticancer drugs" refer to chemical substances or peptides, typically signal transduction inhibitors. They are called small molecule anticancer drugs because of their small molecular weight. Small molecule anticancer drugs are usually formulated as oral medications that dissolve rapidly in the intestines after being taken by the patient. After being absorbed by the body, they inhibit the activity of certain kinases by binding to their active conformations, thereby preventing cancer cell growth; or they inhibit the activity of abnormal proteins by blocking signal transduction mediated within tumor cells, thus preventing the growth and spread of cancer cells.
[0104] The GTP-hydrolyzing activity of the KRAS protein enables it to function as a binary switch downstream of cell surface receptors in signal transduction. Simply put, the nucleotide binding state of KRAS determines its activation state. In the absence of mitotic signals, the KRAS protein primarily binds to GDP and is in an inactive conformation. This inactive state is maintained by its intrinsic GTP-hydrolyzing activity and interaction with GTPase activator proteins (GAPs), thereby accelerating the conversion of GTP to GDP. When cell surface receptors are activated by mitotic signals, they recruit guanine nucleotide exchange factors (GEFs) to bind to the inactive KRAS, catalyzing the efflux of GDP from the active site, thus passively loading GTP. The binding of GTP to KRAS changes the active site from an open conformation to a closed conformation. This closed conformation promotes subsequent interactions between KRAS and various effector proteins. KRAS is one of the most common oncogenes in solid tumors, with mutations present in approximately 30% of tumors, including 90% of pancreatic cancers, 30-40% of colon cancers, and 15-20% of lung cancers. Of the KRAS gene mutations, 97% occur at amino acid residues 12 or 13, including G12C, G12D, and G13D, with G12C mutations being the most common. KRAS G12C mutations occur in approximately 14% of lung adenocarcinomas (the most common subtype of NSCLC), 4% of colorectal cancers, and 2% of pancreatic cancers. Patients with this mutation have a poor prognosis and are prone to developing resistance to standard therapies; once chemotherapy or immunotherapy fails, treatment options are very limited. As one of the most difficult targets to overcome, currently approved inhibitors for KRAS G12C mutations include Lumakras (sotorasib) and Krazati (adagrasib).
[0105] Adagrasib is a specific inhibitor of the KRAS G12C mutant and has shown good efficacy in the treatment of non-small cell lung cancer, colorectal cancer, and other solid tumors.
[0106] EGFR is a glycoprotein belonging to the tyrosine kinase receptor class. It is a transmembrane receptor that spans the cell membrane. Upon binding to a ligand and activation, it transforms from a monomer to a dimer, activating downstream intracellular pathways and inducing cell proliferation. Studies have shown that EGFR is highly expressed or abnormally expressed in solid tumors. Activating mutations in EGFR lead to structural activation of the tyrosine kinase, phosphorylation of downstream pathways, and ultimately, uncontrolled cell proliferation. Small-molecule anticancer drugs targeting EGFR can inhibit EGFR activity, thereby blocking the activation of related pathways.
[0107] In some specific implementations, small molecule anticancer drugs targeting KRAS: Sotorasib targets KRAS G12C.
[0108] Adagrasib targets KRAS G12C.
[0109] In this application, the term "antigen" refers to a substance that can induce the production of antibodies or immune cells; it is any substance that can trigger an immune response in the body. Specifically, it is a substance that can be specifically recognized and bound by antigen receptors (TCR / BCR) on the surface of T / B lymphocytes, activating T / B cells, causing them to proliferate and differentiate, producing immune response products (sensitized lymphocytes or antibodies), and capable of specifically binding to these products in vivo and in vitro. Therefore, antigenic substances possess two important characteristics: immunogenicity and immunoreactivity. Immunogenicity refers to the ability of an antigen to induce a specific immune response in the body, producing antibodies and / or sensitized lymphocytes; immunoreactivity refers to the ability to specifically bind to corresponding immune effector substances (antibodies or sensitized lymphocytes) in vivo and in vitro.
[0110] In some specific implementations, the antigen is exogenous, meaning that the antigen comes from a different species.
[0111] In some specific embodiments, the antigen is an endogenous antigen. Specifically, the antigen is an antigen that is typically expressed on tumor cells.
[0112] In one specific implementation, the antigen is a tumor-associated antigen (TAA) or a tumor-specific antigen (TSA).
[0113] In a specific implementation, TAA or TSA encompasses a molecule or a portion thereof presented on the cell surface (antigens recognized by CAR), within the cell membrane (antigens recognized by TCR), or present in the tumor environment (e.g., in the tumor microenvironment).
[0114] In some specific embodiments, the cells are tumor cells.
[0115] In some specific implementations, TAA or TSA includes tumor-associated antigens or tumor-specific antigens on the cell surface or within the cell membrane.
[0116] In some specific embodiments, the cells are non-tumor cells present in the tumor environment. Examples include, but are not limited to, cells present in vascular system tissues associated with tumors or cancer.
[0117] In some specific implementations, TAA or TSA are angiogenic antigens in the tumor microenvironment.
[0118] In some specific implementations, TAA or TSA are antigens on blood vessels in the tumor microenvironment.
[0119] In some specific embodiments, the cells are stromal cells present in the tumor environment.
[0120] In some specific implementations, TAA or TSA are stromal cell antigens in the tumor microenvironment.
[0121] In some specific implementations, TAA or TSA includes extracellular epitopes of tumor cell surface antigens, tetramers inside or outside the tumor cell membrane, or other structures that can be recognized by antibodies or immune cells.
[0122] In some specific implementations, TAA or TSA includes extracellular matrix antigens.
[0123] In some specific implementations, the TAA or TSA contains antigens present in the tumor microenvironment (TME).
[0124] In some specific implementations, the TAA or TSA contains molecules secreted into the TME by tumor cells.
[0125] In some specific implementations, the TAA or TSA contains effector molecules secreted into the TME by tumor cells.
[0126] In some specific implementations, the TAA or TSA contains effector molecules secreted by tumor cells into the TME that downregulate or inhibit the activity of cytotoxic natural killer (NK) cells or T cells.
[0127] In some specific implementations, the TAA or TSA contains a soluble activated receptor ligand secreted by tumor cells into the TME to block the recognition of tumor cells by NK cells or T cells.
[0128] In some specific implementations, examples of TAA or TSA include, but are not limited to, 5T4, ROR1, EGFR, FcγRI, FcγRIIa, FcγRIIb, FcγRIIIa, FcγRIIIb, CD28, CD137, CTLA-4, FAS, FAP (fibroblast activation protein), LGR5, C5aR1, A2AR, fibroblast growth factor receptor 1 (FGFR1), FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related (GITR) protein, lymphotoxin-β receptor (LTβR), toll-like receptor (TLR), tumor necrosis factor-related apoptosis-inducing ligand receptor 1 (TRAIL receptor 1), TRAIL receptor 2, prostate-specific membrane antigen (PSMA) protein, prostate stem cell antigen (PSCA) protein, tumor-associated protein carbonic anhydrase IX (CAIX), epidermal growth factor receptor 1 (EGFR1), EGFRvIII, and human epidermal growth factor receptor 2 (HER2 / neu).Erb2), ErbB3 (Her3), folate receptor, hepatocyte glycoprotein receptor, PDGFRa, ErbB2, CD2, CD20, CD22, CD30, CD33, CD40, CD37, CD38, CD70, CD74, CD56, CD80, CD86, CD123, CCAM5, CCAM6, BCMA, p53, MET (tyrosine protein kinase Met), hepatocyte growth factor receptor (HGFR), MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MA GE-A10, MAGE-A12, BAGE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, Tyrosinase, Wilms tumor antigen (WT1), TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iC E, MUC1, MUC2, β-cadherin, Myostatin (GDF8), Cripto (TDGF1), MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, WT1, AFP, β-catenin / m, Caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, Myosin / m, RAGE, SART-2 TRP-2 / INT2, 707-AP, Annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, mesothelin, DR5, PD-1, PD-L1, HER2, HER3, IGF-1R, CXCR4, neurociliacin 1, phosphatidylinositol proteoglycans, EphA2, CD138, B7-H3, B7-H4, gpA33, GPC3, SSTR2 or VEGF-R2, CEA, EpCAM.
[0129] In this application, the term "cytokines" refers to bioactive substances synthesized and secreted by immune cells (lymphocytes, monocytes, macrophages, etc.) and their related cells (vascular endothelial cells, fibroblasts, etc.) that regulate the function of other immune cells or target cells. They are small molecule polypeptides or glycoproteins. Cytokines with immunomodulatory effects can be expressed using recombinant oncolytic viruses. Based on their main functions, cytokines are classified as follows: interleukin (IL), interferon (IFN), tumor necrosis factor (TNF), colony stimulating factor (CSF), transforming growth factor-β family (TGF-β family), growth factor (GF), and chemokine family.
[0130] Interleukins include IL-1, IL-2, IL-7, IL-9, IL-15, IL-21, IL-4, IL-12, and IL-18.
[0131] Specifically, interleukin-1 (IL-1): IL-1 is a pleiotropic cytokine involved in cortical inflammation, cell growth, and tissue repair. The IL-1 superfamily has 11 members, such as IL-1A, IL-1B, IL-1Ra, and IL-18. IL-1 is a drug target for some cancers and is also used in cell therapy. In cellular immunotherapy, IL-1 can stimulate the proliferation of CD4+ T cells in vitro, induce the production of IL-2, co-stimulate the activation of CD8+ / IL1R+ T cells, and stimulate the proliferation of mature B cells and the secretion of immunoglobulins.
[0132] Specifically, interleukin-2 (IL-2): Also known as T cell growth factor, IL-2 is produced by T cells in response to antigens or mitotic stimuli and is widely used to promote the activation and proliferation of T cells and NK cells. IL-2 can stimulate NK cell proliferation, increase cytotoxicity, and stimulate NK cells to secrete various cytokines. However, further research has found that IL-2 can cause excessive T cell differentiation and induce apoptosis of activated T cells. It can also activate CD4+ FoxP3 Treg regulatory cells, thereby inhibiting T cell activation and tumor-killing activity. Therefore, IL-2 is considered to be a T cell regulatory factor rather than just an activator. As a result, some studies now use IL-7, IL-15, and IL-21 to replace IL-2.
[0133] Specifically, interleukin-7 (IL-7): IL-7 is a hematopoietic growth factor secreted by stromal cells in the bone marrow and thymus. It shares a γc receptor subunit with IL-2 and stimulates the proliferation of lymphoprogenitor cells. IL-7 can provide continuous stimulatory signals for naïve T cells and memory T cells. As mentioned above, IL-7 does not activate CD4+FoxP3+ Treg cells during the activation of CD8+ T cells. Clinically, IL-7 can also be used to restore T cell numbers after chemotherapy or hematopoietic stem cell transplantation. Furthermore, IL-7 plays an important role in certain stages of B cell maturation and can influence their proliferation. IL-7 can also act as a regulator of intestinal mucosal lymphocytes.
[0134] Specifically, interleukin-15 (IL-15): IL-15 has a similar structure to IL-2, sharing a γc receptor subunit and belonging to a family with four α-helix helical bundles (others include IL-2, IL-4, IL-7, IL-9, G-CSF, and GM-CSF). IL-15 regulates the activation and proliferation of T cells and NK cells. In the innate immune system, IL-15 primarily kills virus-infected cells. Simultaneously, IL-15 can activate NKT cells and γδT cells. In immunotherapy, IL-15 does not induce apoptosis of activated T cells but activates CD8+ effector T cells. IL-15 maintains the survival of memory T cells, thus playing an important role in long-term anti-tumor activity.
[0135] Specifically, interleukin-21 (IL-21): IL-21 also belongs to the IL-2 family, sharing a γc receptor subunit. It has a strong regulatory effect on immune system cells and can induce cell division and proliferation in its target cells. In cell immunotherapy, IL-21 can promote the proliferation of CD4+ and CD8+ T cells, enhance the cytotoxicity of CD8+ T cells and NK cells, and does not cause apoptosis due to activation. IL-21 preferentially expands "young" CD27+CD28+ CD8+ T cells, which have stronger cytotoxicity. Of course, IL-21 does not cause the expansion of Tregs; therefore, the application of IL-21 in cell immunotherapy is becoming increasingly widespread.
[0136] Specifically, interleukin-4 (IL-4): IL-4 activates the proliferation of activated B cells and T cells, and regulates the expression of Fc receptors on lymphocytes and monocytes. IL-4 induces the transformation of Th1 cells into Th2 cells. IL-4 stimulates Th2 cells to secrete IL-4, IL-5, IL-6, IL-10, and IL-13. IL-4 guides monocytes to differentiate into dendritic cells (DCs) by inhibiting macrophage growth. Monocytes will differentiate into macrophages in the culture system without the addition of IL-4. IL-4 plays a key role in regulating humoral and adaptive immunity, inducing B cell antibody class switching towards IgE and upregulating the production of MHC class II molecules. The combined action of IL-4 and GM-CSF can direct the differentiation of monocytes into immature DCs. At this stage, DCs have strong antigen uptake and processing capabilities, but weak antigen presentation capabilities. The sequential use of IL-4 and TNF-α can promote DC maturation.
[0137] Specifically, interleukin-12 (IL-12): IL-12 acts on activated T and NK cells, exhibiting broad biological activity. Its effects on lymphocytes are mediated by activators of the transcription protein STAT4. IL-12 is essential for IFN-γ-independent T cell induction and plays a crucial role in the differentiation of Th1 and Th2 cells. IL-12B binds to IL-23A to form IL-23 interleukin, which possesses innate and adaptive immune functions. IL-12 is a drug target. In cellular immunotherapy, IL-12 promotes the differentiation of CD4+ T cells into CD4+ Th1 T cells and enhances the activity of CD8+ CTLs. The therapeutic effect of IL-12 is related to its dose, duration of action, and other interacting cytokines, promoting the tumor-killing activity of immune cells through multiple mechanisms. In a mouse anti-melanoma model, high doses of IL-12 act through NK cells, while low doses exert tumor-killing effects through NKT cells.
[0138] Specifically, interleukin-18 (IL-18): Also known as interferon-γ inducible factor, IL-18 is a pro-inflammatory cytokine produced by macrophages and other cells. IL-18 can stimulate NK cells and CD8+ T cells to secrete IFN-γ, enhancing the cytotoxic effects of NK cells and CD8+ T cells. IL-18 can also activate macrophages, promote the development of Th1 CD4+ T cells, and promote the expression of FasL by lymphocytes. IL-18 may provide a potential therapeutic target for allergic diseases. Furthermore, the synergistic effect of IL-18, IL-12, and IL-15 can maintain Th1 responses and monocytokine production in autoimmune diseases.
[0139] Gamma interferon, a type II interferon, is primarily produced by NK and NKT cells and possesses antiviral, antitumor, and immunomodulatory effects, including IFN-γ and IFN-β. IFN-γ has an antiproliferative effect on transformed cells and can enhance the antiviral and antitumor effects of type I interferon. IFN-γ activates macrophages, inducing the expression of MHC I, MHC II, and coactivating molecules on antigen-presenting cells (APCs). Furthermore, IFN-γ can induce changes in proteasome expression, thereby enhancing antigen-presenting capacity. IFN-γ can also promote the differentiation of CD4+ T cells into Th1 cells and inhibit IL-4-dependent B cell subtype switching. IFN-γ activates the JAK-STAT cell pathway by phosphorylating JAK1 and JAK2 proteins. In cellular immunotherapy, IFN-γ acts on host immune cells, exhibiting effects on macrophages, T cells, B cells, and NK cells. IFN-γ enhances antigen presentation by promoting the expression of MHC class II molecules in macrophages or by inducing the expression of MHC class II molecules in cells that normally do not express them (such as vascular endothelial cells, certain epithelial cells, and connective tissue cells). IFN-γ can promote the differentiation of B cells and CD8+ T cells, but not their proliferation. IFN-γ enhances the activity and immune function of TH1 cells. IFN-γ enhances the phagocytic capacity of neutrophils and activates NK cells, thereby enhancing their cytotoxic effects. Abnormal IFN-γ expression is associated with many autoinflammatory and autoimmune diseases.
[0140] Tumor necrosis factor (TNF) belongs to the TNF superfamily of cytokines and is a multifunctional molecule that regulates biological processes, including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. TNF-α participates in anti-tumor activity. In cellular immunotherapy, TNF-α induces the differentiation of immature dendritic cells (DCs) into mature DCs. This process is achieved by downregulating macropinocytosis and the expression of Fc receptors on the surface of immature DCs, and upregulating the expression of MHC class I and II molecules and B7 family molecules (CD80, CD86, etc.) on the cell surface. Mature DCs exhibit significantly reduced antigen uptake and processing capabilities, but significantly enhanced antigen presentation capabilities, which can strongly activate T cells. TNF-α can also affect the production of other cytokines, such as stimulating monocytes and macrophages to secrete IL-1, enhancing the proliferation of IL-2-dependent thymocytes and T cells, promoting the production of lymphokines such as IL-2, CSF, and IFN-γ, and enhancing the proliferation and Ig secretion of B cells stimulated by mitogens or foreign antigens.
[0141] Granulocyte-macrophage colony-stimulating factor (GM-CSF) plays a crucial role in embryo transfer and development. GM-CSF is one of the earliest discovered cytokines to act on dendritic cells (DCs). In DC culture, GM-CSF promotes the differentiation of monocytes into macrophage-like cells and enhances the expression of MHC class II molecules on the cell surface, thereby improving antigen presentation. Furthermore, GM-CSF can promote DC survival. In cellular immunotherapy, GM-CSF can activate immune responses, generating anti-tumor activity by activating macrophages and DCs. Regarding antigen presentation, GM-CSF can promote DC maturation, upregulate co-stimulatory molecules, and enhance CD1d receptor expression. Recent studies have found that GM-CSF stimulates the differentiation of hematopoietic progenitor cells into monocytes and neutrophils, thereby reducing the risk of febrile neutropenia in cancer patients. Other studies have demonstrated that GM-CSF can induce differentiation of bone marrow DCs, promote Th1 cell-biased immune responses, promote angiogenesis, and influence the development of allergic inflammation and autoimmune diseases. Therefore, GM-CSF is used clinically to treat malignant tumors.
[0142] In this application, the term "nucleic acid molecule" generally refers to a nucleotide of any length. In this application, the term "nucleic acid molecule" may encode a protein contained in the oncolytic virus. In this application, the nucleic acid molecule may contain DNA and / or RNA. In some cases, the RNA may contain single-stranded RNA (ssRNA) or double-stranded RNA (dsRNA), and the single-stranded RNA may contain sense RNA, anti-sense RNA, or ambiguous RNA.
[0143] In this application, the term "prevention" generally refers to preventing the occurrence, onset, recurrence, and / or spread of a disease or one or more symptoms thereof by taking certain measures in advance. In this application, the term "treatment" generally refers to eliminating or improving a disease, or one or more symptoms associated with a disease. In some embodiments, treatment generally refers to administering one or more drugs to a patient suffering from the disease so that the disease is eliminated or alleviated. In some embodiments, "treatment" may be the administration of the drug combination and / or pharmaceutical product after the onset of symptoms of a specific disease, in the presence or absence of other drugs. For example, using the drug combination and / or pharmaceutical product described in this application to prevent the occurrence, development, recurrence, and / or metastasis of a tumor.
[0144] In this application, the term "tumor" generally refers to any new pathological tissue growth. Tumors may be benign or malignant. In this application, the tumor may be a solid tumor and / or a hematoma. When used for research purposes, these tissues can be isolated from readily available resources using methods well known to those skilled in the art.
[0145] In some specific embodiments, the tumors include, but are not limited to, acute lymphoblastic leukemia, acute B-lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-Hodgkin's lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, breast cancer (BRCA), cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), sensory neuroblastoma, Ewing sarcoma, fallopian tube cancer, gallbladder cancer, etc. Stomach cancer, gastrointestinal carcinoid tumors, hepatocellular carcinoma, hypopharyngeal cancer, Kaposi's sarcoma, kidney cancer, Langerhans cell carcinoma, laryngeal cancer, liver cancer, lung cancer, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary adenoma, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small bowel cancer, squamous neck cancer, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and vascular tumors. Invention Details A wild-type VSV virus, specifically the Indiana strain of VSV virus, specifically the Indiana MuddSummer subtype of VSV virus. The amino acid sequence of its M protein is shown in SEQ ID NO 1; the amino acid sequence of its G protein is shown in SEQ ID NO 12; the amino acid sequence of its N protein is shown in SEQ ID NO 14; the amino acid sequence of its P protein is shown in SEQ ID NO 16; and the amino acid sequence of its L protein is shown in SEQ ID NO 18. In this application, the M, G, N, P, and L proteins can all be modified.
[0147] A recombinant oncolytic virus, which is obtained by mutating sites on the amino acid sequences of the above-mentioned wild-type VSV virus, namely the M, G, N, P and L proteins.
[0148] This application provides a drug for the combined treatment of tumors using a recombinant oncolytic virus and a small molecule anticancer drug, specifically including: using a small molecule anticancer drug and a recombinant oncolytic virus to treat tumors in combination.
[0149] Small molecule anticancer drugs include small molecule anticancer drugs that target KRAS.
[0150] The recombinant oncolytic virus includes M protein, G protein, N protein, P protein, and L protein.
[0151] Compared with the amino acid sequence shown in SEQ ID NO 1, the site mutation of the M protein includes any one or more of M51R, V221F, and S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; or the site mutation of the M protein includes N32S, N49D, M51R, H54Y, knockout of the leucine-encoded base at position 111, V221F, and V225I. 25I, S226R, or any one or more of the following: or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes G21 E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R. Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, S226R.
[0152] Compared with the amino acid sequence shown in SEQ ID NO 12, the site mutations of the G protein include any one or more of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.
[0153] Compared to the amino acid sequence shown in SEQ ID NO 14, the site mutations of the N protein include any one or more of I14V, R155K, and S353N.
[0154] Compared with the amino acid sequence shown in SEQ ID NO 16, the site mutations of the P protein include any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.
[0155] Compared to the amino acid sequence shown in SEQ ID NO 18, the site mutations of the L protein include any one or more of S87P and I487T.
[0156] Furthermore, the recombinant oncolytic virus is obtained by introducing a foreign gene encoding an antigen into the above-mentioned recombinant oncolytic virus.
[0157] Furthermore, the recombinant oncolytic virus also includes an antigen encoded by a foreign gene.
[0158] Further, the antigen is selected from any one or more of the following: CD19, CD22, BCMA, MUC1, NY-ESO-1, MAGE A4, MET, Claude 18.2, MSLN, EGFR, VEGFR2, HER2, TPBG, AFP, MAGE-A10.
[0159] Furthermore, the recombinant oncolytic virus also includes cytokines encoded by exogenous genes.
[0160] Furthermore, the cytokines are selected from any one or more of the following: GM-CSF, IL-2, IL-12, IL-15, IL-18, TNF-α, IFN-β.
[0161] In this application, the recombinant oncolytic virus described herein can be obtained through a viral packaging process and a viral rescue process. Specifically, the process may include infecting BSR-T7 cells with vaccinia virus vTF7-3 expressing T7 RNA polymerase, followed by lipofectamine transfection using expression plasmids and backbone plasmids that clone the VSV N, VSV P, and VSV L genes, respectively, to obtain the target oncolytic virus.
[0162] This application provides a composition comprising the above-mentioned recombinant oncolytic virus and a small molecule anticancer drug.
[0163] In some embodiments, the composition may include suitable formulations of one or more (pharmaceutically effective) adjuvants, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers, and / or preservatives. The acceptable components of the composition are preferably non-toxic to the recipient at the dosage and concentration used. The compositions of this application include, but are not limited to, liquid, freeze-dried, and lyophilized compositions.
[0164] In some embodiments, the pharmaceutically acceptable carrier may include any and all solvents, dispersion media, coatings, isotonic agents, and absorption delay agents that are compatible with drug administration and are generally safe and non-toxic.
[0165] In some embodiments, the composition may be administered parenterally, subcutaneously, intracavitarily, intra-arterially, intravenously, intrathecally, and / or intranasally, or directly injected into tissues. For example, the composition may be administered to a patient or subject by infusion or injection. In some embodiments, the composition may be administered in various ways, such as intravenously, intraperitoneally, subcutaneously, intramuscularly, intradermally, or intratissuely. In some embodiments, the composition may be administered continuously. This continuous (or uninterrupted) administration may be achieved using a small pump system worn by the patient to measure the amount of therapeutic agent flowing into the patient, as described in WO2015 / 036583.
[0166] This application also provides the use of the above-described composition in the preparation of medicaments for the prevention and / or treatment of diseases and / or conditions.
[0167] The recombinant oncolytic virus combined with small molecule anticancer drugs provided in this application exhibits a significant inhibitory effect on tumor growth. Furthermore, the experimental results of treating tumors with the recombinant oncolytic virus directly combined with small molecule anticancer drugs are superior to those of treating tumors with the recombinant oncolytic virus alone or with the small molecule anticancer drugs alone. The experimental results of treating tumors with the recombinant oncolytic virus inserting and expressing antigen fragments, combined with small molecule anticancer drugs, are superior to those of treating tumors with the recombinant oncolytic virus directly combined with small molecule anticancer drugs or with the recombinant oncolytic virus inserting and expressing antigen fragments directly. Therefore, the drug for treating tumors using the recombinant oncolytic virus and small molecule anticancer drugs provided in this application further effectively improves the therapeutic effect on tumor cells.
[0168] The drug for treating tumors using a combination of recombinant oncolytic virus and small molecule anticancer drug provided in this application exhibits good inhibitory ability on tumor cell growth. It can be determined that the drug for treating tumors using a combination of recombinant oncolytic virus and small molecule anticancer drug provided in this application also has good inhibitory ability on other cancer cells, and has broad clinical application prospects.
[0169] The present application will be further described in detail below with reference to preparation examples 1-34 and examples.
[0170] Preparation Example Preparation Examples 1-10 Preparation Examples 1-10 provide a drug for the combined treatment of tumors using a recombinant oncolytic virus and a small molecule anticancer drug.
[0171] This drug utilizes a combination of recombinant oncolytic virus and small molecule anticancer drugs to treat tumors.
[0172] This recombinant oncolytic virus includes M, G, N, P, and L proteins. The M, G, N, P, and L proteins were all obtained through point mutations based on the wild-type VSV virus Indiana MuddSummer subtype.
[0173] The differences between the various preparation examples are as follows: the mutation sites of the M protein are different. The mutation sites of the M protein are the amino acid sequences shown in SEQ ID NO 2 to SEQ ID NO 11, respectively. The G protein contains the amino acid sequence shown in SEQ ID NO 13, the N protein contains the amino acid sequence shown in SEQ ID NO 15, the P protein contains the amino acid sequence shown in SEQ ID NO 17, and the L protein contains the amino acid sequence shown in SEQ ID NO 19.
[0174] The mutation sites of each protein and the types of small molecule anticancer drugs are shown in Table 1.
[0175] The methods for constructing recombinant oncolytic viruses provided in the above preparation examples are as follows: (1) Constructing a carrier Using pRV-core plasmid (BioVector NTCC plasmid vector bacterial cell gene preservation center) as a template, PCR technology was used to introduce the M protein mutation sites, G protein mutation sites, N protein mutation sites, P protein mutation sites and L protein mutation sites as shown in Table 1.
[0176] Gene fragments containing the aforementioned protein mutation sites and containing XbaI and MluI restriction sites were synthesized separately. These fragments were used as templates for PCR amplification. The PCR products were then subjected to 1% agarose gel electrophoresis, double digestion with XbaI and MluI, and gel extraction to obtain gene fragments containing the M, G, N, P, and L protein mutation sites, respectively. The RV-core plasmid was double digested with XbaI and MluI, and gel extraction was performed to obtain the pRV-core digested backbone fragment.
[0177] The gene fragments with M protein mutation sites, G protein mutation sites, N protein mutation sites, P protein mutation sites, and L protein mutation sites were ligated with the pRV-core digestion and recovery backbone fragment, transformed, plated, and single clones were selected for PCR verification to obtain the constructed plasmid pRV-core Mut, which was then sent to a sequencing company for sequencing.
[0178] Table 1. Recombinant oncolytic viruses and small molecule anticancer drugs prepared in Examples 1-10
[0179] (2) Virus rescue Using a calcium phosphate transfection kit (Thermo Fisher Scientific), the constructed plasmid pRV-core Mut was transfected into BSR-T7 cells (purchased from ATCC, the American Type Culture Collection Center, also known as the American Type Culture Collection Center) via cell transfection technology.
[0180] The four plasmids, pRV-core Mut, pP, pN, and pL, were mixed in a mass ratio of 10:5:4:1, with a total plasmid volume of 5 μg. The plasmids were diluted with 200 μl of opti-MEM medium (Thermo Fisher Scientific) and 7.5 μl of Plus Reagent transfection reagent (Life Technologies) was added to obtain a premixed transfection plasmid solution. The premixed solutions included pP (plamid carrying the rod-shaped virus phosphoprotein gene), pN (plamid carrying the rod-shaped virus nucleoprotein gene), and pL (plamid carrying the rod-shaped virus polymerase protein gene). The parent vectors for pN, pP, and pL were all pCAGGS (purchased from ATCC). Dilute 10 μl of lipofectamine LTX (Thermo Fisher Scientific) with 200 μl of opti-MEM medium to obtain an LTX mixture; Plasmid transfection was performed according to the instructions for use of lipofectamine LTX. After 6 hours, BSR-T7 cells were washed twice with PBS and then seeded in DMEM medium (Thermo Fisher Scientific) containing 10% fetal bovine serum and cultured for 3 days. The cell supernatant obtained from culturing BSR-T7 cells was transferred to Vero cells (Thermo Fisher Scientific), and the Vero cells were cultured at 37°C for 3 days. The green fluorescence in the cells was observed under a fluorescence microscope to determine the virus rescue status. The rescued mutant rod-shaped virus library was further passaged in Vero cells, and monoclonal virus strains were selected in the established plaque screening system.
[0181] (3) Gene sequencing. Viral genomic RNA was extracted using the Trizol kit, and reverse transcription was performed using random primers. PCR was performed on the reverse-transcribed cDNA using primers designed for the M protein gene sequence, the G protein gene sequence, the N protein gene sequence, the P protein gene sequence, the L protein gene sequence, and the antigen-encoding gene sequence. The primer sequences designed for the M protein gene sequence are: PF: ATGAGTTCCTTAAAGAA; PR: TCATTTGAAGTGG.
[0182] The primer sequences designed for the G protein gene sequence are: PF: ATGAAGTGCCTTTTGTACTTAG; PR: TTACTTTCCAAGTCGGTTCATCT.
[0183] The primer sequences designed for the N protein gene sequence are: PF: ATGTCTGTTACAGTCAAGAG; PR: TCATTTGTCAAATTCTGACTT.
[0184] The primer sequences designed for the P protein gene sequence are: PF: ATGGATAATCTCACAAAAGTTCG; PR: CTACAGAGAATATTTGACTCTCG.
[0185] The primer sequences designed for the L protein gene sequence are: PF: ATGGAAGTCCACGATTTTGAGA; PR: TTAATCTCTCCAAGAGTTTTCCT.
[0186] The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 1.
[0187] Preparation Examples 11-19 Preparation Examples 11-19 respectively provide a drug for the combined treatment of tumors using a recombinant oncolytic virus and a small molecule anticancer drug.
[0188] This drug utilizes a combination of recombinant oncolytic virus and small molecule anticancer drugs to treat tumors.
[0189] The recombinant oncolytic virus includes M protein, G protein, N protein, P protein, L protein, and antigen. The mutation sites of the M, G, N, P, and L proteins are the same as those in Preparation Example 2.
[0190] The differences lie in the types of antigens and the types of small molecule anticancer drugs. Table 2 shows the mutation sites, antigen types, and types of small molecule anticancer drugs for each protein.
[0191] The method for constructing the recombinant oncolytic virus provided in the above preparation example is the same as the method for constructing the virus in preparation example 2. The specific differences in the construction methods are as follows: Between step (1) vector construction and step (2) virus rescue, the following steps are also included: inserting a foreign gene encoding the antigen. Specifically, the plasmid pRV-core Mut obtained in step (1) is double-digested with Xho I and Mlu I to recover the long fragment. The foreign gene encoding the antigen is synthesized by a gene synthesis company and amplified with the corresponding primers. The target gene fragment is recovered by double-digesting with Xho I and Nhe I. The pRV-core Mut and the foreign gene fragment are ligated and transformed. Single clones are selected, identified by PCR or enzyme digestion, and then sent to a sequencing company for sequencing to obtain the plasmid pRV-core Mut carrying the foreign gene. In step (2) virus rescue, the plasmid pRV-core Mut carrying the foreign gene is used to transfect BSR-T7 cells.
[0192] Step (3) includes sequencing of various types of antigens. Viral genomic RNA was extracted using a Trizol kit, reverse transcription was performed using random primers, and PCR was performed on the reverse-transcribed cDNA using primers designed for the antigen gene sequence. The primer sequences designed from the antigen gene sequence are as follows: 1) CD19 F: ACGCTCGAGATGCCACCTCCTGCCTCC; CD19 R: TTCTGGCTAGCTCATCTTTTCCTCCTCAGG.
[0193] 2) CD22 F: ATGCATCTCCTCGGCCCCT; CD22 R: TCAGAGCCCACAGATTGCCAGG.
[0194] 3) NY-ESO-1 F: ACGCTCGAGATGCAGGCAGAAGGAAG; NY-ESO-1 R: TCTGGCTAGCTCATCTTCTCTGTCCGCTA.
[0195] 4) MAGE A4 F: ACGCTCGAGACAGAGGAGCACCAAGGAG; MAGE A4 R: TCTGGCTAGCATAGACTGAGGCATAAGGC.
[0196] 5) Claude 18.2 F: ACGCTCGAGATGGACCAGTGGAGCACCC; Claude 18.2 R: TCTGGCTAGCTTAGGCGATGCACATCATC.
[0197] 6) EGFR F: ACGCTCGAGATGCGACCCTCCGGGACGG; EGFR R: TCTGGCTAGCTTACATGAAGAGGCCGAT.
[0198] 7) HER2 F: ATGGAGCTGGCGGCCTTGTGCC; HER2 R: TTAGATGAGGATCCCAAAGACCA.
[0199] 8) KRAS G12C F: ATGACTGAATATAAACTTG; KRAS G12C R: TTACATTATAATGCATTTT.
[0200] The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 2.
[0201] Table 2. Recombinant oncolytic viruses and small molecule anticancer drugs prepared in Examples 11-19
[0202] Preparation Examples 20-23 Preparation Examples 20-23 respectively provide a drug for the combined treatment of tumors using a recombinant oncolytic virus and a small molecule anticancer drug.
[0203] This drug utilizes a combination of recombinant oncolytic virus and small molecule anticancer drugs to treat tumors.
[0204] The difference between the above preparation example and preparation example 11 is that the recombinant oncolytic virus includes not only M protein, G protein, N protein, P protein, L protein and antigen, but also cytokines. The mutation sites of the M protein, G protein, N protein, P protein and L protein are the same as the corresponding mutation sites in preparation example 2.
[0205] The differences lie in the types of cytokines and small molecule anticancer drugs. Table 3 shows the mutation sites, antigen types, cytokine types, and small molecule anticancer drug types for each protein.
[0206] The method for constructing the recombinant oncolytic virus provided in the above preparation example is the same as the method for constructing the virus in preparation example 2. The specific differences in the construction methods are as follows: Between step (1) constructing the vector and step (2) virus rescue, the following steps are also included: inserting a foreign gene encoding a cytokine, specifically referring to the steps for inserting a foreign gene encoding an antigen. The antigen and cytokine are inserted between the G protein and the L protein. The insertion order can be either inserting the cytokine first and then the antigen, or inserting the antigen first and then the cytokine. In this application, the cytokine is inserted first, followed by the antigen.
[0207] Step (3) also includes sequencing of cytokines. Viral genomic RNA was extracted using a Trizol kit, reverse transcription was performed using random primers, and PCR was performed on the reverse-transcribed cDNA using primers designed for cytokine gene sequences; The primer sequences designed from the gene sequences encoding cytokines are as follows: IL12 F: CCCTCGAGATGTGGCCCCCTGGGT, IL12 R: CGGCTAGCTTAACTGCAGGGCACAGATG.
[0208] IL-18 F: CCCTCGAGATGGCTGCTGAACCAGTAG, IL-18 R: CGGCTAGCCTAGTCTTCGTTTTGAAC.
[0209] The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 3.
[0210] Table 3. Recombinant oncolytic viruses and small molecule anticancer drugs prepared in Examples 20-23
[0211] Preparation Examples 24-32 Preparation Examples 24-32 each provide a method for treating tumors using recombinant oncolytic viruses.
[0212] The recombinant oncolytic viruses in the above preparation examples are the recombinant oncolytic viruses in preparation examples 11-13 and 15-19, respectively. See Table 4 for details. The differences lie in the type of antigen expressed by the recombinant oncolytic viruses (e.g., preparation examples 24-30, 32) or the recombinant oncolytic viruses not expressing any antigen (e.g., preparation example 31).
[0213] Table 4 Recombinant oncolytic viruses in Preparation Examples 24-32
[0214] Preparation Examples 33-34 Preparation Examples 33-34 respectively provide a drug for treating tumors using small molecule anticancer drugs.
[0215] The small molecule anticancer drugs in the above preparation examples are the same as those in Preparation Examples 11-12. See Table 5 for details. The difference lies in the type of small molecule anticancer drug.
[0216] Table 5 Small molecule anticancer drugs prepared in Examples 33-34 Example
[0217] In this embodiment, animal experiments were conducted using the recombinant oncolytic virus and / or small molecule anticancer drugs provided in Examples 1-34 for the treatment of tumors.
[0218] Balb / c mice were prepared and inoculated with H22 cells (mouse liver cancer cells) at a concentration of 5 × 10^5 / 0.1 mL / animal. The mice were inoculated when the average tumor size reached 50 mm. 3 The mice were grouped, and the day of grouping was designated Day 0. Administering medication was done on the day of grouping. Mice were weighed three times a week and observed daily. The body weight (g) and tumor volume (mm³) of the mice were recorded throughout the experiment. 3 The changes in ).
[0219] Mice should be euthanized if the following conditions are met: 1. Tumor volume reaches 2000 mm². 3 2. The mouse's body weight decreased by more than 20%; 3. The tumor surface was ulcerated; 4. The mouse became paralyzed, etc.
[0220] Recombinant oncolytic viruses can be administered via various routes. In this application, the administration routes for both wild-type and recombinant oncolytic viruses are intratumoral injection (IT) and / or intravenous injection (IV), with a dosage of 3e8 PFU / animal. The IT administration volume is 2.5 ml / kg. The IV administration volume is 5 ml / kg, administered every 2 days for 6 consecutive times (Q2D*6).
[0221] The administration method for small molecule anticancer drugs is oral (PO). The dosage is related to the type of small molecule anticancer drug. The administration volume is 10 ml / kg, and the administration frequency is once a day for 12 consecutive days (QD*12); or, the administration frequency is twice a day for 12 consecutive days (BID*12).
[0222] In the Vehicle Control (blank control) study, (10% DMSO + 40% PEG300 + 5% Tween-80 + 45% saline) was used instead of small molecule anticancer drugs. The administration route was oral (PO), the dosage was N / A, the administration volume was 10 ml / kg, and the administration frequency was once daily for 12 consecutive days (QD*12).
[0223] I. Animal studies on the small molecule anticancer drug Mobocertinib Animal experiments were conducted using the methods provided in Examples 1-10, 11, 13, 15-19, 20, 22, 24-31, and 33 for the preparation of recombinant oncolytic viruses and / or small molecule anticancer drugs for the treatment of tumors. Specific details of the experiments are shown in Table 6.
[0224] The test results are as follows Figure 1 As shown.
[0225] Table 6 Animal studies of the small molecule anticancer drug Mobocertinib
[0226] II. Animal studies on the small molecule anticancer drug Sotorasib Animal experiments were conducted using the methods provided in Examples 12, 14, 21, 23, 27, 32, 31, and 34 for the preparation of recombinant oncolytic viruses and / or small molecule anticancer drugs for the treatment of tumors. Specific details of the experiments are shown in Table 7.
[0227] The test results are as follows Figure 2 As shown.
[0228] Table 7 Animal trials of the small molecule anticancer drug Sotorasib
[0229] Test results as follows Figures 1-2 As shown.
[0230] As shown in the accompanying figures, the drug for treating tumors using a combination of recombinant oncolytic virus and small-molecule anticancer drugs provided in this application has a significant inhibitory effect on tumor growth. Furthermore, the experimental results of treating tumors with the recombinant oncolytic virus directly combined with small-molecule anticancer drugs are superior to those of treating tumors with the recombinant oncolytic virus alone or with small-molecule anticancer drugs alone; the experimental results of treating tumors with the recombinant oncolytic virus combined with antigen and then with small-molecule anticancer drugs are superior to those of treating tumors with the recombinant oncolytic virus directly combined with small-molecule anticancer drugs or with the recombinant oncolytic virus directly combined with antigen. Therefore, the drug for treating tumors using a combination of recombinant oncolytic virus and small-molecule anticancer drugs provided in this application further effectively improves the therapeutic effect on tumor cells.
[0231] Furthermore, in the drug for treating tumors using a combination of recombinant oncolytic virus and small molecule anticancer drug described in this application, the experimental results when the recombinant oncolytic virus contains a target that pairs with the small molecule anticancer drug are superior to the experimental results when the recombinant oncolytic virus does not contain a target that pairs with the small molecule anticancer drug. Further, the experimental results when the recombinant oncolytic virus contains a target that pairs with the small molecule anticancer drug and expresses cytokines are superior to the experimental results when the recombinant oncolytic virus contains a target that pairs with the small molecule anticancer drug but does not express cytokines.
[0232] The test results above indicate that the drug proposed in this application, which combines recombinant oncolytic virus and small molecule anticancer drug for the treatment of tumors, exhibits good inhibitory ability on tumor cell growth. It can be concluded that the drug proposed in this application, which combines recombinant oncolytic virus and small molecule anticancer drug for the treatment of tumors, also has good inhibitory ability on other cancer cells and has broad clinical application prospects.
[0233] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.
Claims
1. A drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug, characterized in that, The combined treatment of tumors using small molecule anticancer drugs and recombinant oncolytic viruses; The small molecule anticancer drugs include small molecule anticancer drugs that target KRAS; The recombinant oncolytic virus includes M protein, G protein, N protein, P protein, and L protein; Compared with the amino acid sequence shown in SEQ ID NO 1, the site mutation of the M protein includes any one or more of M51R, V221F, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, knocking out the base encoded by leucine at position 111, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; Or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; Compared with the amino acid sequence shown in SEQ ID NO 12, the site mutations of the G protein include any one or more of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; Compared with the amino acid sequence shown in SEQ ID NO 14, the site mutation of the N protein includes any one or more of I14V, R155K, and S353N; Compared with the amino acid sequence shown in SEQ ID NO 16, the site mutations of the P protein include any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D; Compared to the amino acid sequence shown in SEQ ID NO 18, the site mutations of the L protein include any one or more of S87P and I487T.
2. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 1, characterized in that, The recombinant oncolytic virus includes any one or more of the following: rod-shaped virus, poxvirus, herpes simplex virus, measles virus, Semlikie Forest virus, poliovirus, reovirus, Seneca Valley virus, echovirus, Coxsackie virus, Newcastle disease virus, and Malaba virus.
3. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 2, characterized in that, The rod-shaped viruses include vesicular stomatitis viruses.
4. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 1, characterized in that: The recombinant oncolytic virus also includes antigens encoded by exogenous genes.
5. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 1, characterized in that: The antigens are selected from hematologic tumor antigens and solid tumor antigens.
6. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 5, characterized in that: The solid tumor antigens include, but are not limited to, 5T4, ROR1, EGFR, FcγRI, FcγRIIa, FcγRIIb, CD28, CD137, CTLA-4, HER2, HER3, FAS, FAP, LGR5, C5aR1, A2AR, FGFR1, FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related protein, LTβR, TRAIL receptor 1, TRAIL receptor 2, prostate-specific membrane antigen protein, prostate stem cell antigen protein, tumor-associated protein carbonic anhydrase IX, EGFR1, EGFRvIII, ErbB3, folate receptor, liver glycoprotein receptor, PDGFRa, Er bB-2, CD2, CD40, CD74, CD80, CD86, CCAM5, CCAM6, p53, MET, HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6 , DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, Tyrosine Enzymes, TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC2, β-cadherin, myosin, Cripto, MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin I I, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, Mesothelin (MSLN), DR5, PD-1, PD-L1, IGF-1R, CXCR4, neurociliacin 1, phosphatidylinositol proteoglycans, EphA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGFR-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP2, FOLR1, AXL, Claude 18.2, MUC1, TPBG, CEA, EpCAM; The hematologic tumor antigens include, but are not limited to, BCMA, CD4, CD5, CD7, CD10, FcγRIIIa, FcγRIIIb, CD19, CD20, CD22, CD23, CD30, CD33, CD34, CD37, CD38, CD44, CD47, CD56, CD70, CD117, CD123, CD138, CD174, CLL-1, ROR1, NKG2DL1 / 2, IL1R3, FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR8, SHP2, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, c-Kit, SLAMF3, SLAMF7, TCR B-chain, ITGB7, k-1gG, TACI, TRBCI, and LeY.
7. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 6, characterized in that: The antigen is selected from any one or more of the following: CD19, CD22, BCMA, MUC1, NY-ESO-1, MAGE A4, MET, Claude 18.2, MSLN, EGFR, VEGFR2, HER2, TPBG, AFP, MAGE-A10.
8. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 4, characterized in that: The recombinant oncolytic virus expresses at least one or more antigens.
9. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 1, characterized in that, The small molecule anticancer drugs targeting KRAS include, but are not limited to, small molecule anticancer drugs targeting KRAS G12A, KRAS G12C, KRAS G12D, KRAS G12R, KRAS G12V, KRAS G13D, KRAS Q61L, and KRAS Q61H. The small molecule anticancer drugs targeting KRAS G12C include, but are not limited to, Sotorasib and Adagrasib.
10. The method for combined treatment of tumors with recombinant oncolytic virus and small molecule anticancer drug according to claim 1, characterized in that, The small molecule anticancer drugs are selected from any one or more of the following: Small molecule anticancer drugs indicated for melanoma, including but not limited to Vemurafenib, Dabrafenib, Encorafenib, Trametinib, Binimetmib, and Cobimetinib; Small molecule anticancer drugs indicated for cell tumors or sarcomas, including but not limited to Pexidartinib, tazemetostat, Pazopanib, and Anlotinib; Small molecule anticancer drugs indicated for leukemia, including but not limited to Imatinib, Bosutinib, Nilotinib, Gilteritinib, and Ivosidenib; Small molecule anticancer drugs indicated for NSCLC, including but not limited to Sotorasib, Capmatinib, Tepotinib, Savolitinib, Pralsetinib, selpercatinib, Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Lorlatinib, Afatinib, Dacomitinib, Erlotinib, Gefitinib, Icotinib, Mobocertinib, Osimertinib, Rybrevant, and Befotinib.
11. The method for combined treatment of tumors with recombinant oncolytic virus and small molecule anticancer drug according to claim 1, characterized in that, The small molecule anticancer drug is selected from any one or more of the following: tivazanib, Everolimus, Sirolimus, Temsirolimus, Midostaurin, Ripretinib, Selumetinib, Larotrectinib, Lurbinectedin, and Olverembatinib.
12. The method for combined treatment of tumors with recombinant oncolytic virus and small molecule anticancer drug according to claim 1, characterized in that, The small molecule anticancer drugs are selected from any one or more of the following: Drugs: Lorlatinib, Acalabrutinib, Ibrutinib, Zanubrutinib, Erlotinib, Gefitinib, Icotinib, Osimertinib, Rybrevant, Erdafitinib, Infigratin ib、Pemazyre、Pemigatinib、Pyrotinib、Tucatinib、Avapritinib、Fluzoparib、Niraparib、Olaparib、Rucaparib、linperlisib、Apatinib、Abemaciclib、Dalpiciclib、Palbociclib ib, Ribociclib, Vemurafenib, Dabrafenib, Encorafenib, Trametinib, Binimetmib, Cobimetinib, Pexidartinib, tazemetostat, Gilteritinib, Ivosidenib, Sotorasib, Capmatinib, Tepotinib, Savolitinib, Pralsetinib, selpercatinib, Everolimus, Sirolimus, Temsirolimus, Midostaurin, Ripretinib, Selumetinib, Larotrectinib, Lurbinectedin; Multi-targeted small molecule anticancer drugs, including but not limited to: Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Afatinib, Dacomitinib, Lapatinib, Mobocertinib, Dasatinib, Neratinib, duvelisib, Axitinib, Lenvatinib, Pazopanib, Regorafenib, Anlotinib, Cabozantinib, Sunitinib, Vandetanib, Ponatinib, Sorafenib, Imatinib, Bosutinib, Nilotinib, tivazanib.
13. The method for combined treatment of tumors with recombinant oncolytic virus and small molecule anticancer drug according to claim 1, characterized in that, The small molecule anticancer drugs are selected from any one or more of the following: Ceritinib, Ibrutinib, Afatinib, Dacomitinib, Icotinib, Lenvatinib, Pazopanib, Anlotinib, Pyrotinib, Niraparib, Olaparib, Regorafenib, Palbociclib, Vemurafenib, Savolitinib, Everolimus, Mobocertinib, and Sotorasib.
14. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 1, characterized in that: The recombinant oncolytic virus also includes cytokines encoded by exogenous genes.
15. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 14, characterized in that: The cytokines are selected from interleukins, interferons, tumor necrosis factor, colony-stimulating factor, transforming growth factor β, and chemokine families.
16. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 15, characterized in that: The cytokines are selected from any one or more of the following: GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN-β, IFN-γ, IFN-β, TGF-β, and TNF-α.
17. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 16, characterized in that: The cytokines are selected from any one or more of the following: GM-CSF, IL-2, IL-12, IL-15, IL-18, IFN-β, TNF-α.
18. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 1, characterized in that, The recombinant oncolytic virus comprises a nucleic acid molecule; the nucleic acid molecule comprises a nucleic acid sequence encoding the M protein with the site mutation, a nucleic acid sequence encoding the G protein with the site mutation, a nucleic acid sequence encoding the N protein with the site mutation, a nucleic acid sequence encoding the P protein with the site mutation, and a nucleic acid sequence encoding the L protein with the site mutation.
19. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 18, characterized in that, The nucleic acid molecule further includes a nucleic acid sequence encoding a cytokine; and / or, the nucleic acid molecule further includes a nucleic acid sequence encoding an antigen.
20. The medicament for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 19, characterized in that, The nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein with the site mutation and the nucleic acid sequence encoding the L protein with the site mutation; and / or, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the G protein with the site mutation and the nucleic acid sequence encoding the L protein with the site mutation.
21. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 1, characterized in that, The combination of recombinant oncolytic virus and small molecule anticancer drug for the treatment of tumors is used to continuously kill abnormally proliferating cells.
22. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 21, characterized in that, The abnormally proliferating cells are selected from tumor cells or related cells of tumor tissue.
23. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 21, characterized in that, The tumors include solid tumors or hematologic malignancies.
24. The drug for the combined treatment of tumors using recombinant oncolytic virus and small molecule anticancer drug according to claim 21, characterized in that, The tumors mentioned include, but are not limited to, acute lymphoblastic leukemia, acute B-lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-Hodgkin's lymphoma, anal cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma, sensory neuroblastoma, Ewing sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumors, and hepatocellular carcinoma. Cancer, hypopharyngeal cancer, Kaposi's sarcoma, kidney cancer, Langerhans cell carcinoma, laryngeal cancer, liver cancer, lung cancer, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary adenoma, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous neck cancer, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and vascular tumors.
25. A composition, characterized in that, The composition comprises the recombinant oncolytic virus of claim 1 and a small molecule anticancer drug.