Long-chain nucleic acid-based probiotic microcapsules and uses thereof

Abstract

The application discloses long-chain nucleic acid-based probiotic microcapsules and application thereof. Specifically, the application provides long-chain nucleic acid-based probiotic microcapsules, which comprise: (a) probiotics; (b) long-chain nucleic acids connected to the surface of the probiotics, and the long-chain nucleic acids are complexed with Ca 2+ to form a microcapsule protective layer covering the surface of the probiotics. The probiotic microcapsules of the application can effectively protect the probiotics from corrosion by gastric acid, and can improve the swimming ability and intestinal mucus layer penetration ability of the probiotics in the intestinal tract, so that the probiotic microcapsules can be used for effectively treating intestinal tract-related diseases.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine or probiotic preparations, specifically relating to a probiotic microcapsule based on long-chain nucleic acid and its application. Background Technology

[0002] Gut health plays a crucial role in maintaining nutrient absorption and homeostasis. However, influenced by factors such as changes in dietary structure, faster pace of life, and environmental pollution, the global incidence of chronic intestinal diseases continues to rise. Ulcerative colitis (UC), a type of inflammatory bowel disease (IBD), often manifests as gut microbiota imbalance, immune dysregulation, and metabolic abnormalities, severely impacting patients' quality of life. Furthermore, epidemiological studies show that the longer the duration of UC, the higher the risk of progression to colitis-associated colorectal cancer (CAC), with an overall incidence reaching 18%. Therefore, controlling chronic inflammation and regulating pathogen abundance holds promise for improving outcomes in UC patients and effectively preventing CAC.

[0003] Currently, active ulcerative colitis (UC) is mainly managed with glucocorticoids, immunosuppressants, and 5-aminosalicylic acid (5-ASA). However, effective long-term management strategies are lacking during remission, which easily leads to recurrent inflammation and CAC progression. Therefore, developing innovative interventions for remission-phase UC to reduce chronic inflammation is of significant clinical value for the prevention of UC and its cancerous transformation.

[0004] In recent years, probiotics have been widely used in clinical practice to alleviate intestinal inflammation and control pathogenic bacterial infections. Compared with traditional drug therapies, probiotics have advantages such as low toxicity and side effects, high cost-effectiveness, and good patient compliance, making them very suitable for long-term intervention during the remission phase of UC.

[0005] Currently, probiotics used in the treatment of intestinal diseases mainly include Bifidobacterium, Lactobacillus, and Escherichia coli Nissle 1917 (EcN). Oral probiotics effectively suppress abnormal inflammation and immune responses in UC patients by remodeling the gut microbiota and promoting the production of beneficial metabolites. However, oral administration of probiotics faces significant challenges, such as the harsh gastrointestinal environment and low intestinal mucosal colonization efficiency. To improve the intestinal activity and mucosal colonization ability of probiotics, researchers have proposed delivery strategies such as cell membrane encapsulation, protection with natural materials, and chemical modification, but the oral delivery efficacy of these methods remains limited.

[0006] Therefore, developing a novel engineered delivery system that protects the activity of probiotics while enabling precise colonization of probiotics at intestinal lesion sites and exploring their anti-inflammatory mechanisms is crucial for promoting the application of probiotics in the treatment of UC and CAC. Summary of the Invention

[0007] This invention provides a probiotic microcapsule based on long-chain nucleotides and its application.

[0008] In a first aspect of the present invention, a probiotic microcapsule based on a long-chain nucleic acid is provided, comprising: (a) Probiotics; (b) A long-chain nucleic acid linked to the surface of the probiotic, and the long-chain nucleic acid interacting with Ca 2+ The complexation forms a protective layer covering the surface of the probiotics.

[0009] In another preferred embodiment, the probiotic microcapsules have one or more features selected from the group consisting of: (i) Resistant to stomach acid corrosion; (ii) Significantly enhanced intestinal motility; (iii) Significantly enhanced mucus penetration ability; (iv) Intestinal colonization capacity.

[0010] In another preferred embodiment, the long nucleic acid is attached to the surface of the probiotic via a primer attached to the surface of the probiotic.

[0011] In another preferred embodiment, the length of the long nucleic acid chain is 100 nt to 10,000 nt; more preferably, 100 to 800 nt; even more preferably, 100 to 500 nt.

[0012] In another preferred embodiment, the probiotics are selected from one or more strains of Escherichia coli, Lactobacillus, Bifidobacterium, Enterococcus, Bacillus, Clostridium butyricum, and Saccharomyces.

[0013] In another preferred embodiment, the probiotic is selected from the group consisting of Escherichia coli Nissle 1917 (EcN), Bacillus subtilis, lactic acid bacteria, Bifidobacterium, Akkermania, or combinations thereof.

[0014] In another preferred embodiment, the long nucleic acid is long DNA or long RNA.

[0015] In another preferred embodiment, the long nucleic acid is a long multivalent nucleic acid aptamer.

[0016] In another preferred embodiment, the nucleic acid aptamer is as shown in SEQ ID NO: 1.

[0017] In another preferred embodiment, the multivalent nucleic acid aptamer is a nucleic acid aptamer with a valence of 1-100; more preferably, a nucleic acid aptamer with a valence of 1-80; and even more preferably, a nucleic acid aptamer with a valence of 1-50.

[0018] In another preferred embodiment, the nucleic acid aptamer can target and bind to inflammatory cytokines.

[0019] In another preferred embodiment, the inflammatory cytokines include: TNF-α, IL-1β, IL-6, IL-23, IL-7, IFN-γ, or combinations thereof.

[0020] In another preferred embodiment, the nucleic acid aptamer is a TNF-α nucleic acid aptamer. In another preferred embodiment, when the long-chain nucleic acid is a long-chain multivalent nucleic acid aptamer, the preparation method of the probiotic microcapsules is as follows: (s1) The 5'-amino-modified primer and probiotics were subjected to an amidation reaction under the catalysis of EDC and NHS, and the 5'-amino-modified primer was used to modify the surface of the probiotics to obtain probiotics with primers on the surface. (s2) Add the circular template of the nucleic acid aptamer and the phi29 enzyme, and maintain at 30°C for 1.5-3 hours to achieve rolling circle amplification modification of the multivalent nucleic acid aptamer on the surface of the probiotic modified with primers; thereby obtaining probiotics with long-chain multivalent nucleic acid aptamers on their surface. (s3) Optionally, the solution containing probiotics with surface-modified long-chain polyvalent nucleic acid aptamers is centrifuged, and the lower layer of probiotics with surface-modified long-chain polyvalent nucleic acid aptamers is collected; and (s4) Add extra Ca 2+ The probiotics modified with long-chain polyvalent nucleic acid aptamers were reconstituted in DPBS solution and left to stand overnight to prepare probiotic microcapsules based on long-chain polyvalent nucleic acid aptamers.

[0021] In another preferred embodiment, the sequence of the 5'-amino-entrained primer is shown in SEQ ID NO: 2.

[0022] In another preferred embodiment, the circular template for the nucleic acid aptamer is prepared as follows: (i) A linear template-primer dimer is formed by pairing a 5'-phosphorylated linear DNA template containing a nucleic acid aptamer coding sequence with a primer sequence in PBS solution via an annealing step; (ii) Add T4 DNA ligase and incubate overnight at 16°C to achieve DNA template circularization; (iii) Heat the solution to 75°C and maintain for 8-12 minutes to inactivate T4 DNA ligase, and then purify the circular template-primer dimer using an ultrafiltration device; (iv) Add ExoIII and ExoI enzymes to the purified circular template-primer dimer, maintain at 37°C for 50-70 minutes, and purify using an ultrafiltration device to obtain the circular template.

[0023] In another preferred embodiment, the sequence of the 5'-phosphorylated linear DNA template is shown in SEQ ID NO: 1.

[0024] In a second aspect of the present invention, a method for preparing probiotic microcapsules based on long-chain multivalent nucleic acid aptamers is provided, comprising the steps of: (s1) The 5'-amino-modified primer and probiotics were subjected to an amidation reaction under the catalysis of EDC and NHS, and the 5'-amino-modified primer was used to modify the surface of the probiotics to obtain probiotics with primers on the surface. (s2) Add the circular template of the nucleic acid aptamer and the phi29 enzyme, and maintain at 30°C for 1.5-3 hours to achieve rolling circle amplification modification of the multivalent nucleic acid aptamer on the surface of the probiotic modified with primers; thereby obtaining probiotics with long-chain multivalent nucleic acid aptamers on their surface. (s3) Optionally, the solution containing probiotics with surface-modified long-chain polyvalent nucleic acid aptamers is centrifuged, and the lower layer of probiotics with surface-modified long-chain polyvalent nucleic acid aptamers is collected; and (s4) Add extra Ca 2+ The probiotics modified with long-chain polyvalent nucleic acid aptamers were reconstituted in DPBS solution and left to stand overnight to prepare probiotic microcapsules based on long-chain polyvalent nucleic acid aptamers.

[0025] In another preferred embodiment, the sequence of the 5'-amino-entrained primer is shown in SEQ ID NO: 2.

[0026] In another preferred embodiment, the circular template for the nucleic acid aptamer is prepared as follows: (i) A linear template-primer dimer is formed by pairing a 5'-phosphorylated linear DNA template containing a nucleic acid aptamer coding sequence with a primer sequence in PBS solution via an annealing step; (ii) Add T4 DNA ligase and incubate overnight at 16°C to achieve DNA template circularization; (iii) Heat the solution to 75°C and maintain for 8-12 minutes to inactivate T4 DNA ligase, and then purify the circular template-primer dimer using an ultrafiltration device; (iv) Add ExoIII and ExoI enzymes to the purified circular template-primer dimer, maintain at 37°C for 50-70 minutes, and purify using an ultrafiltration device to obtain the circular template.

[0027] In a third aspect of the invention, the use of the probiotic microcapsules described in the first aspect of the invention is provided for the preparation of formulations or compositions having intestinal probiotic effects.

[0028] In another preferred embodiment, the composition is selected from the group consisting of: pharmaceutical compositions, food compositions, health product compositions, feed compositions, or combinations thereof.

[0029] In another preferred embodiment, the gut-benefiting effect includes the treatment of intestinal diseases.

[0030] In another preferred embodiment, the formulation or composition may be used to treat intestinal diseases.

[0031] In another preferred embodiment, the intestinal disease includes ulcerative colitis.

[0032] In another preferred embodiment, the formulation is selected from the group consisting of food additives, health product additives, drug additives, feed additives, or combinations thereof.

[0033] In a fourth aspect of the invention, a pharmaceutical composition is provided, comprising: (1) The probiotic microcapsules described in the first aspect of the present invention; (2) Optionally, a pharmaceutically acceptable carrier.

[0034] In another preferred embodiment, the dosage form of the pharmaceutical composition is selected from the group consisting of solid dosage forms, semi-solid dosage forms, liquid dosage forms, or combinations thereof.

[0035] In another preferred embodiment, the dosage form of the pharmaceutical composition is an oral formulation.

[0036] In a fifth aspect of the invention, a treatment method is provided, comprising: The probiotic microcapsules described in the first aspect of the invention or the pharmaceutical composition described in the fourth aspect of the invention are administered to subjects in need.

[0037] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0038] Figure 1 The preparation process of microcapsules based on long-chain multivalent nucleic acid aptamers for probiotic protection is shown.

[0039] Figure 2The changes on the bacterial surface after probiotic microcapsule construction are shown. (a) Transmission electron microscopy characterization results of EcN before and after microcapsule encapsulation; (b) Energy dispersive X-ray spectral distribution of calcium on the bacterial surface before and after microcapsule encapsulation of EcN; (c) Calcium chlorophyll fluorescence staining detection results of microcapsule calcium ions on the bacterial surface after microcapsule encapsulation of EcN; (d) Changes in zeta potential of BS after rolling circle amplification and microcapsule encapsulation; (e) Transmission electron microscopy characterization results of BS before and after microcapsule encapsulation; (f) Energy dispersive X-ray spectral distribution of calcium on the bacterial surface before and after microcapsule encapsulation of BS; (g) Calcium chlorophyll fluorescence staining detection results of microcapsule calcium ions on the bacterial surface after microcapsule encapsulation of BS; (h) Changes in zeta potential of BS after rolling circle amplification and microcapsule encapsulation.

[0040] Figure 3 The study demonstrates the protective effect of probiotic microcapsules on probiotic activity. (a) Plate coating results of EcN@pApt / Ca and EcN after incubation in simulated gastric fluid at different time points in vitro, compared with (b) bacterial count results. (c) Plate coating results of BS@pApt / Ca and BS after incubation in simulated gastric fluid at different time points in vitro, compared with (d) bacterial count results.

[0041] Figure 4 The results showed that probiotic microcapsules increased bacterial motility and mucus layer penetration. (a) Probiotic microcapsule protection increased the motility rate of probiotics after in vitro treatment with simulated gastric juice. (b) Probiotic microcapsule protection increased the efficiency of probiotics in penetrating the cell mucus layer model after in vitro treatment with simulated gastric juice.

[0042] Figure 5 The study demonstrates how probiotic microcapsules alleviate UC. (a) Oral administration of probiotic microcapsules alleviates a DSS-induced acute intestinal UC model. (b) Oral administration of probiotic microcapsules alleviates a DSS-induced chronic intestinal UC model. Detailed Implementation

[0043] Through extensive and in-depth research and screening, the inventors unexpectedly developed a probiotic microcapsule based on long-chain nucleic acid. This microcapsule exhibits resistance to gastric acid corrosion and enteric coagulation, allowing for oral delivery of probiotics into the intestines. Experiments show that the probiotic microcapsules of this invention (e.g., EcN@pApt / Ca, BS@pApt / Ca) significantly enhance resistance to gastric acid corrosion, increase bacterial motility and mucus penetration, and effectively alleviate ulcerative colitis (UC). Furthermore, when the long-chain nucleic acid is a long-chain multivalent nucleic acid aptamer, the probiotic microcapsule can also target and colonize the probiotics in the intestines after reaching them. Based on these findings, this invention was completed.

[0044] the term To facilitate a clearer understanding of this disclosure, certain terms are first defined. As used herein, unless otherwise expressly specified herein, each of the following terms shall have the meaning given below. Other definitions are set forth throughout the application.

[0045] The term “about” can refer to a value or composition within an acceptable margin of error for a particular value or composition as determined by a person skilled in the art, depending in part on how the value or composition is measured or determined. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101.

[0046] As used herein, the terms “containing” or “including (comprise)” can be open-ended, semi-closed, or closed. In other words, the terms also include “consistently made of” or “composed of”.

[0047] As used herein, unless otherwise stated, any concentration range, percentage range, proportion range, or integer range shall be understood to include any integer value within the range and, where appropriate, its fractional value (e.g., one-tenth and one-hundredth of an integer).

[0048] As used herein, the term “and / or” refers to and covers any and all possible combinations of one or more of the related listed items.

[0049] As used herein, the terms "aptamer," "nucleic acid aptamer," and "nucleic acid aptamer" have the same meaning and can be used interchangeably. They all refer to a single-stranded DNA or RNA oligonucleotide sequence (usually composed of 20-80 bases) obtained through in vitro screening technology (SELEX) that can bind to specific target molecules with high specificity and high affinity. The nucleic acid aptamer used in this invention is a DNA aptamer.

[0050] Ulcerative colitis Ulcerative colitis (UC), a type of inflammatory bowel disease (IBD), is characterized by gut microbiota imbalance, immune dysregulation, and metabolic abnormalities, severely impacting patients' quality of life. Furthermore, epidemiological studies show that the longer the duration of UC, the higher the risk of progression to colitis-associated colorectal cancer (CAC), with an overall incidence rate reaching up to 18%.

[0051] Elevated levels of reactive oxygen species (ROS) in a chronic inflammatory environment not only lead to DNA damage and inhibit the expression of tumor suppressor genes, but also promote the transformation of ulcerative colitis (UC) to chronic atrophic inflammatory syndrome (CAC) by continuously activating inflammatory pathways. Simultaneously, abnormal proliferation of pathogens can bind to pattern recognition receptors (TLR4, TLR5, etc.) on the surface of intestinal epithelial cells or immune cells (such as macrophages and dendritic cells) through virulence factors (such as lipopolysaccharide LPS and flagellin), activating signaling pathways such as NF-κB, MAPK, and STAT3, leading to excessive proliferation of intestinal epithelial cells.

[0052] Furthermore, pathogenic bacteria competitively inhibit the growth of beneficial bacteria (such as Bifidobacteria and Lactobacilli), reducing the production of intestinal metabolites such as short-chain fatty acids (SCFAs) and indoles, thereby promoting inflammation and reducing the immune system's ability to clear abnormally proliferating cells. Therefore, controlling chronic inflammation and regulating pathogen abundance may improve outcomes for UC patients and effectively prevent CAC.

[0053] Probiotics and Microencapsulation Technology Probiotics are a class of live beneficial microorganisms that colonize the human gut and reproductive system, producing definite health benefits, thereby improving the host's microecological balance and exerting beneficial effects on the gut. Increasing clinical evidence shows that probiotics can effectively improve human health, including inhibiting pathogens and regulating intestinal diseases through the normalization of gut microbiota composition; lowering serum cholesterol through immune regulation; improving lactose tolerance; and alleviating food allergy symptoms in infants. With further research, probiotics are widely used in fermented foods, dairy products, and functional beverages. However, probiotics are highly sensitive to environmental factors such as temperature, oxygen, humidity, and pH, and their survival rate is easily reduced during production, processing, and storage. Furthermore, only when a sufficient number of live bacteria (≥10⁻⁶) are probiotics produced can they survive. 6 Probiotics (CFU / g) can only exert their beneficial effects after reaching the human gut. Therefore, in order to improve the survival rate of probiotics and achieve colonization and targeted release in the human gut, probiotics need to be protected, and microencapsulation technology is one of the most effective methods currently available.

[0054] Microencapsulation technology is an advanced technique that encapsulates active ingredients within a wall material to provide protection and control their release. In the field of probiotics, microencapsulation technology is widely used to improve the stability of probiotics during processing, transportation, and storage to effectively exert their health benefits. However, commonly used wall materials in existing microencapsulation technologies (such as proteins, polysaccharides, and lipids) have certain limitations in terms of protective efficacy, encapsulation efficiency, and biocompatibility.

[0055] Compositions and their applications The present invention also provides a composition, preferably a pharmaceutical composition. The composition comprises an effective amount of probiotic microcapsules of the first aspect of the present invention. In another preferred embodiment, the probiotic microcapsules may comprise a variety of microcapsules, such as probiotic microcapsules containing *Escherichia coli* (EcN), probiotic microcapsules containing *Bacillus subtilis*, probiotic microcapsules containing *Bifidobacterium*, probiotic microcapsules containing lactic acid bacteria, etc. In another preferred embodiment, the composition further comprises prebiotics selected from the group consisting of fructooligosaccharides (FOS), galactooligosaccharides (GOS), xylooligosaccharides (XOS), lactulose oligosaccharides (LACT), soybean oligosaccharides (SOS), inulin, or combinations thereof.

[0056] In a preferred embodiment, the composition is a liquid formulation, a solid formulation, or a semi-solid formulation.

[0057] In a preferred embodiment, the liquid formulation is selected from the group consisting of solution products or suspension products.

[0058] In a preferred embodiment, the dosage form of the composition is selected from the group consisting of powders, granules, tablets, sugar-coated tablets, capsules, granules, suspensions, solutions, syrups, drops, and sublingual tablets.

[0059] The pharmaceutical compositions of the present invention can be administered in any form, such as tablets, injections, or capsules. The pharmaceutical formulation includes excipients, drug-permitted media, and carriers, which may be selected according to the route of administration. The pharmaceutical formulations of the present invention may further comprise auxiliary active ingredients.

[0060] Lactose, glucose, sucrose, sorbitol, mannose, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, fine crystalline cellulose, polyvinylpyrrolidone (PVP), cellulose, water, syrup, methylcellulose, methylparaben, propylparaben, talc, magnesium stearate, or mineral oil can all be used as carriers, excipients, or diluents for the pharmaceutical composition in this invention.

[0061] Furthermore, the pharmaceutical compositions of the present invention may further include lubricants, wetting agents, emulsifiers, suspension stabilizers, preservatives, sweeteners, and flavorings. The pharmaceutical compositions of the present invention can be produced as enteric-coated formulations using various known methods, so that the active ingredient of the pharmaceutical composition, i.e., the microorganism, can pass smoothly through the stomach without being destroyed by gastric acid.

[0062] In another preferred embodiment, the probiotic microcapsules may or may not contain an additional casing.

[0063] The pharmaceutical compositions of the present invention can be formulated into enteric-coated tablets for oral administration. The term "enteric-coated" as used in this application includes all coatings permitted for use in conventional pharmaceuticals that are not degraded by gastric acid but are readily decomposed in the small intestine, rapidly releasing the microorganisms of the present invention. The enteric-coated tablets of the present invention can be maintained at 36-38°C for more than 2 hours in synthetic gastric acid such as an HCl solution with pH=1, and preferably decompose within 1 hour in synthetic intestinal fluid such as a buffer solution with pH=7.0.

[0064] The casings of this invention are coated with approximately 16-30 mg per tablet, preferably 16-25 mg, and more preferably 16-20 mg. The casing thickness in this invention is 5-100 μm, ideally 20-80 μm. The casing components are selected from conventionally known polymers.

[0065] The preferred casings of the present invention are prepared from a copolymer of cellulose acetate phthalate polymer or trimellitate polymer and isobutylene acid (e.g., a copolymer of isobutylene acid containing more than 40% isobutylene acid and isobutylene acid containing methylcellulose phthalate hydroxypropyl ester or its ester derivative).

[0066] The cellulose phthalate acetate used in the casings of this invention has a viscosity of approximately 45-90 cp, an acetyl content of 17-26%, and a phthalic acid content of 30-40%. The cellulose trimellitate acetate used in the casings has a viscosity of approximately 5-21 cs and an acetyl content of 17-26%. The cellulose trimellitate acetate is produced by Eastman Kodak and can be used in the casing materials of this invention.

[0067] The hydroxypropyl methylcellulose phthalate used in the casings of this invention has a molecular weight of generally 20,000-130,000 Daltons, with an ideal molecular weight of 80,000-100,000 Daltons. The hydroxypropyl content is 5-10%, the methoxy content is 18-24%, and the phthaloyl content is 21-35%.

[0068] The hydroxypropyl methylcellulose phthalate used in the casings of this invention is HP50, manufactured by Shin-Etsu Chemidnl Co., Ltd. of Japan. HP50 contains 6-10% hydroxypropyl, 20-24% methoxy, and 21-27% propyl, with a molecular weight of 84,000 Daltons. Another casing material is HP55, which contains 5-9% hydroxypropyl methylcellulose phthalate, 18-22% methoxy, and 27-35% phthalic acid, with a molecular weight of 78,000 Daltons.

[0069] The sausage casings of this invention are prepared as follows: a casing solution is sprayed onto the core using conventional methods. All solvents used in this casing coating method are alcohols (such as ethanol), ketones (such as acetone), halogenated hydrocarbon compounds (such as dichloromethane), or combinations thereof. A softener, such as di-n-butyl phthalate and triacetin, is added to the casing solution in a ratio of 1 part casing to approximately 0.05 parts or approximately 0.3 parts softener. The spraying method is preferably performed continuously, and the amount of material sprayed can be controlled according to the conditions used for coating. The spraying pressure can be adjusted arbitrarily; generally, ideal results can be obtained at an average pressure of 1-1.5 bar.

[0070] The term "effective amount of drug" in the instructions refers to an amount that can produce function or activity in humans and / or animals and is acceptable to humans and / or animals. For example, in this invention, a drug containing 1×10⁻¹⁰ to 1×10⁻¹⁰⁻¹ can be prepared. 20 CFU / ml or CFU / g (specifically, may contain 1×10⁻⁶ CFU / ml). 4 -1×10 15 cfu / ml or cfu / g; more specifically, it may contain 1×10 6 -1×10 11 Probiotic microcapsule formulations of probiotics (cfu / ml or cfu / g).

[0071] When used in the preparation of pharmaceutical compositions, the effective dose of the probiotic microcapsules can vary depending on the mode of administration and the severity of the disease to be treated. For example, due to the urgency of the treatment condition, several separate doses may be given daily, or the dose may be reduced proportionally.

[0072] The probiotic microcapsules can be administered orally or otherwise. Solid carriers include starch, lactose, dicalcium phosphate, microcrystalline cellulose, sucrose, and kaolin, while liquid carriers include culture media, polyethylene glycol, nonionic surfactants, and edible oils (such as corn oil, peanut oil, and sesame oil), provided they are suitable for the characteristics of Bacteroides fragilis T70 or its metabolites and the desired specific route of administration. Adjuvants commonly used in the preparation of pharmaceutical compositions may also be advantageously included, such as flavoring agents, colorings, preservatives, and antioxidants such as vitamin E, vitamin C, BHT, and BHA.

[0073] From the perspective of ease of preparation and administration, preferred pharmaceutical compositions are solid compositions, especially tablets and solid-filled or liquid-filled capsules. Oral administration is preferred.

[0074] The composition of the invention is administered to the individual once or more daily. Dosage units represent doses that are formally divisible and applicable to human or all other mammalian individuals. Each unit contains a drug-permitted carrier and an effective therapeutic amount of the inventive microorganism. Dosage varies depending on the patient's weight and degree of obesity, the included supplemental active ingredients, and the microorganisms used. Furthermore, it can be administered separately if possible, and continuously if necessary. Therefore, the dosage does not limit the invention. Moreover, the term "composition" in this invention means not only a pharmaceutical product but also a product suitable as a functional food and health supplement. In a preferred embodiment, the composition includes: beverages, food, pharmaceuticals, animal feed, etc.

[0075] Treatment methods for ulcerative colitis This invention provides a method for treating ulcerative colitis, the method comprising: administering to a subject in need a probiotic microcapsule based on a long-chain multivalent nucleic acid aptamer, a pharmaceutical composition, a food composition, or a combination thereof. The subject may be a human or a non-human mammal. In another preferred embodiment, the non-human mammal is preferably a rodent or rabbit.

[0076] The main advantages of this invention include: (a) This invention utilizes cell surface DNA molecular engineering methods to construct long-chain multivalent DNA aptamers and calcium ions (Ca). 2+ The complexed protective layer enables the innovative design of multiple oral delivery systems for probiotics. This design's protective mechanism not only effectively resists the damaging effects of the gastric acid environment, but also, in the intestinal environment, the exposed multivalent aptamers bind to highly expressed inflammatory cytokines at sites of inflammation, thereby enhancing the colonization of probiotics at intestinal inflammatory sites.

[0077] (c) The long-chain nucleic acid or long-chain nucleic acid aptamer of the present invention can also simulate the flagellar motion effect, significantly improving the penetration and colonization efficiency of probiotics in the mucus layer.

[0078] (d) The modified probiotics of the present invention have a hydrophilic negatively charged surface that further reduces the non-specific adsorption between probiotics and intestinal mucoproteins, thereby enhancing colonization efficiency.

[0079] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0080] Example 1: Preparation of probiotic microcapsules based on long-chain nucleotide aptamers The preparation process of the probiotic microcapsules based on long-chain nucleotide aptamers in this embodiment is detailed in [link to documentation]. Figure 1 .

[0081] 1.1 Fabrication of the Ring Module To achieve the modification of multivalent aptamers on the surface of probiotics, this invention first prepares a circular template. The aptamer can be any effective aptamer targeting intestinal inflammatory factors (e.g., TNF-α, IL-1β, IL-6, etc.).

[0082] Specifically, it includes the following steps: (1) A 5μM 5'-phosphorylated linear DNA template containing an aptamer coding sequence (taking the TNF-α aptamer coding sequence as an example) is paired with a 10μM primer sequence in PBS solution by an annealing step to form a linear template-primer dimer.

[0083] The TNF-α aptamer coding sequence or the 5'-phosphorylated linear DNA template sequence is shown below: CGTATGCATGCTGCGGCCCACCTATTCGAATGGCAGCTCCCCTGTAGTGGCGCGTCTCGTAGCTA(SEQ ID NO: 1); The primer sequences are shown below: TTTTTTTTAGCATGCATACGTAGCTACGAGAC (SEQ ID NO: 2).

[0084] (2) Add T4 DNA ligase (2 U / μl) and incubate overnight at 16°C to achieve DNA template circularization.

[0085] (3) Heat the solution to 75°C and maintain for 10 minutes to inactivate T4 DNA ligase, and then use an ultrafiltration device to purify the circular template-primer dimer.

[0086] (4) Add ExoIII enzyme (1 U / μL) and ExoI enzyme (2 U / μL) to the purified circular template-primer dimer, maintain at 37°C for 60 minutes, and purify using an ultrafiltration device to obtain the circular template.

[0087] 1.2 Preparation of Probiotic Microcapsules The preparation of the probiotic microcapsules of the present invention specifically includes the following steps: (1) Mix 10 μM of 5'-amino-treated primer with 1 × 10 8 CFUs probiotics undergo amidation under the catalysis of EDC and NHS, with 5'-amino-modified primers applied to the surface of the probiotics; The specific sequence of the 5'-amino-enhanced primer is shown in SEQ ID NO: 2.

[0088] (2) Add the purified circular template (1 μM) and phi29 enzyme (2 U / μL) obtained in step 1.1, and maintain at 30°C for 2 hours to achieve rolling circle amplification modification of TNF-α multivalent aptamers on the surface of probiotics. Thus, probiotics modified with multivalent nucleic acid aptamers (Probiotic@pApt) are obtained.

[0089] (3) The probiotic solution modified with multivalent nucleic acid aptamers was centrifuged at 6000 rpm / min and the lower layer of bacteria was collected.

[0090] (4) Add extra Ca 2+ Probiotics modified with multivalent nucleic acid aptamers were reconstituted in 20 mM DPBS solution and allowed to stand overnight to prepare bacterial microcapsules (Probiotic@pApt / Ca).

[0091] In this embodiment, probiotic microcapsules containing different probiotics were prepared through the steps in 1.1 and 1.2 above. These included probiotic microcapsules containing *Escherichia coli* (EcN), named *EcN@pApt / Ca*, and probiotic microcapsules containing *Bacillus subtilis*, named *BS@pApt / Ca*.

[0092] 1.3 Characterization of probiotic microcapsules To determine the characterization information of the probiotic microcapsules obtained above, the following experiments were conducted, and the specific experimental procedure was explained using probiotic microcapsules containing Escherichia coli (EcN) as an example.

[0093] An oligonucleotide labeled Cy5 (FON-Cy5, 1 μM) that is complementary to the bases of the aptamer coding sequence was added to EcN and EcN@pApt / Ca solutions that had been treated with simulated gastric juice. After mixing, the mixture was incubated at 37 °C for 1 hour, followed by centrifugation at 6000 rpm / min. The supernatant was discarded and the mixture was reconstituted with DPBS.

[0094] The bacterial solution was then added to the cell slide and incubated for 1 hour to prepare EcN+FON-Cy5 and EcN@pApt / FON-Cy5 samples.

[0095] Untreated EcN samples were used as a control. The fluorescence intensity of Cy5 cells surrounding the bacteria was detected using Confocl imaging. Furthermore, the fluorescence intensity of the EcN, EcN+FON-Cy5, and EcN@pApt / FON-Cy5 groups was quantitatively analyzed using flow cytometry.

[0096] To investigate the effect of calcium ion intervention on probiotic microcapsule formation, transmission electron microscopy (TEM, JEM-2100F, NEC Corporation) was used to evaluate the morphological changes of probiotics before and after microcapsule formation. Since the probiotic microcapsules are rich in calcium ions, a probiotic concentration of 1×10⁻⁶ was used. 8 Calcein (3 μM, Sigma-Aldrich) was added to a CFU / mL solution to stain the protective layer of the microcapsules. The fluorescently stained probiotic microcapsules were then added to cell slides to prepare samples.

[0097] Subsequently, the fluorescence intensity of the microcapsule protective layer on the bacterial surface was characterized using Confocl (Stellaris 8, Leica, Germany), with untreated probiotics serving as the control group.

[0098] Subsequently, energy dispersive X-ray spectroscopy (EDX) was used to analyze the distribution of calcium on the surface of probiotics before and after microcapsule protection.

[0099] Because the microcapsule protection on the surface of probiotics also affects the surface potential of bacteria, the concentration of probiotics at 1 × 10⁻⁶... 8 Under the condition of CFUs / mL, this invention studied the potential changes on the surface of probiotics at different surface modification stages by dynamic light scattering (DLS, ZS90, Malvern).

[0100] Experimental results: The results are as follows Figure 2 As shown, compared to EcN, the surface of EcN@pApt / Ca encapsulated with microcapsules exhibits a significant microcapsule protective layer formation. Figure 2a); Compared to EcN, the calcium element strength in the EcN@pApt / Ca surface protective layer after microencapsulation was significantly increased ( Figure 2 b); Compared to EcN, the fluorescence intensity of EcN@pApt / Ca encapsulated in microcapsules was stronger after calcein staining. Figure 2 c); After modification with multivalent nucleic acid aptamers, the surface Zeta potential of EcN@pApt decreased compared to EcN, and the surface Zeta potential decreased further after the formation of probiotic microcapsules EcN@pApt / Ca. Figure 2 d); Compared to BS, the surface of BS@pApt / Ca after microencapsulation exhibits a significant microcapsule protective layer formation ( Figure 2 e); Compared to BS, the calcium element strength in the surface protective layer of BS@pApt / Ca after microencapsulation was significantly increased ( Figure 2 f); Compared to BS, the fluorescence intensity of BS@pApt / Ca encapsulated in microcapsules was stronger after calcein staining. Figure 2 g); After modification with multivalent nucleic acid aptamers, the surface Zeta potential of BS@pApt decreased compared to BS, and the surface Zeta potential further decreased after the formation of probiotic microcapsules BS@pApt / Ca. Figure 2 h).

[0101] Example 2: Determination of Probiotic Activity Protection To verify the protective effect of constructing microcapsules on the surface of probiotics on probiotic activity, the present invention treated unprotected probiotics (e.g., EcN and Bacillus subtilis) and probiotic microcapsules (e.g., EcN@pApt / Ca and BS@pApt / Ca) in simulated gastric fluid for 0 minutes, 5 minutes, 30 minutes and 60 minutes, respectively.

[0102] Subsequently, probiotics and probiotic microcapsules at different time points were plate-coated, and the differences in bacterial activity were determined by the number of colonies.

[0103] The results are as follows Figure 3 As shown in the figure, the results indicated that unprotected probiotics completely lost their activity after 30 minutes, while some bacteria protected by the probiotic microcapsules remained active after immersion in simulated gastric fluid for 60 minutes. Furthermore, statistical analysis of bacterial colony counts showed no significant difference in activity retention between probiotics and probiotic microcapsules during the first five minutes of simulated gastric fluid treatment. However, as the time increased to half an hour, the activity of the probiotic microcapsules was significantly higher than that of probiotics alone.

[0104] Example 3: Flagellar effect of long-chain nucleic acid aptamers on the surface of probiotics To evaluate whether modifications to long-chain nucleic acids or multivalent nucleic acid aptamers affect the surface of probiotics and thus increase their motility, the following experiment was conducted using *Escherichia coli* (EcN) as an example: EcN, EcN surface-modified with monovalent aptamers (EcN@Apt), EcN surface-modified with random long-chain nucleic acids (DNA) forming a protective layer (EcN@RS / Ca), and EcN@pApt / Ca were added to simulated gastric fluid to achieve a colony concentration of 1×10⁻⁶. 8 / mL, all of these EcNs used in the experiments expressed the fluorescent protein mCherry. The preparation of EcN@RS / Ca was identical to that in Example 1 of this invention, except for the DNA module used.

[0105] After 15 minutes of treatment with simulated gastric fluid, the bacteria in each group were centrifuged at 6000 rpm for 1 minute, and then the upper layer of simulated gastric fluid was discarded and reconstituted with DPBS.

[0106] Subsequently, four different bacterial suspensions were dropped onto glass slides, and the movement of the bacteria was recorded over one minute using an inverted confocal laser scanning microscope. Furthermore, the movement trajectories and rates of the bacteria in each group were analyzed using ImageJ.

[0107] The results are as follows Figure 3 As shown. The results indicated that EcN exhibited obvious viable colonies after incubation in simulated gastric fluid for 0 min and 5 min, with the colony count decreasing over time. After incubation for 30 min and 60 min, viable colonies were no longer observable on the agar plate. Viable colonies could be observed on the agar plate after incubation of EcN@pApt / Ca in simulated gastric fluid for 0, 5, 30, and 60 min. Figure 3 a); Statistical results of bacterial counts of EcN@pApt / Ca and EcN after incubation in simulated gastric fluid at different time points. The colony counts of both EcN@pApt / Ca and EcN decreased after incubation in simulated gastric fluid for 0, 5, 30, and 60 min, but the decrease in EcN@pApt / Ca was less than that of EcN, and there were significant differences between the two at 30 min and 60 min. Figure 3 b); Results of BS@pApt / Ca and BS incubated in simulated gastric fluid at different time points before plating. BS showed obvious viable colonies after 0 min and 5 min of incubation in simulated gastric fluid, with the colony count decreasing over time. After 30 min and 60 min of incubation, viable colonies were not observable on the agar plate. BS@pApt / Ca showed viable colonies on the agar plate after incubation in simulated gastric fluid for 0, 5, 30, and 60 min. Figure 3 c); Statistical results of bacterial counts of BS@pApt / Ca and BS after incubation in simulated gastric fluid at different time points. The colony counts of both BS@pApt / Ca and BS decreased after incubation in simulated gastric fluid for 0, 5, 30, and 60 min, but the decrease in BS@pApt / Ca was less than that of BS, and there were significant differences between the two at 5, 30, and 60 min. Figure 3 d).

[0108] Example 4: Improved colonization ability of probiotics in the intestines To further verify the colonization ability of probiotic microcapsules of the present invention in the intestine after delivery, the following experiment was conducted using probiotic microcapsules containing Escherichia coli (EcN) as an example: EcN, EcN with surface-modified aptamers but without a protective layer (EcN@Apt), EcN with surface-modified random long-chain nucleic acids and with a protective layer (EcN@RS / Ca), and EcN@pApt / Ca bacteria were cultured at 1×10⁻⁶. 8 CFUs were administered orally to each UC mouse (ulcerative colitis mouse model). Twelve hours after administration, fluorescence imaging of the mouse abdomen was performed using a small animal imaging system.

[0109] Subsequently, the mice were euthanized, dissected, and their colons were separated. The fluorescence intensity of the colon was then analyzed using a small animal imaging system.

[0110] To demonstrate the superior intestinal colonization and gastric acid resistance of EcN@pApt / Ca, bacteria from both the EcN and EcN@pApt / Ca groups were cultured at a concentration of 1×10⁻⁶. 8 CFUs were administered to UC mice via gavage. One hour after gavage, bacteria from the stomach were collected and plated on LB agar to count the number of probiotic colonies in the stomach. Bacteria from the small intestine, cecum, and colon of the mice were collected at 2, 12, and 36 hours after gavage and plated to count the number of intestinal colonies.

[0111] The results are as follows Figure 4 As shown, the probiotic microcapsule protection enhanced the motility of probiotics after in vitro treatment with simulated gastric juice. Specifically, the average motility of EcN@RS / Ca and EcN@pApt / Ca was significantly better than that of EcN or EcN@Apt alone (P < 0.0001). Figure 4 a). Furthermore, the probiotic microcapsule protection increased the efficiency of probiotics in penetrating the cell mucus layer model after in vitro treatment with simulated gastric juice. Specifically, EcN@RS / Ca and EcN@pApt / Ca penetrated the mucus layer to a significantly greater depth than EcN or EcN@Apt alone. Figure 4 b).

[0112] Example 5: Probiotic microcapsules relieve intestinal inflammation This invention establishes DSS-induced acute UC and chronic UC models in mice for pharmacodynamic evaluation of the probiotic microcapsules of this invention. Specifically, in this embodiment, a probiotic microcapsule containing Escherichia coli (EcN) (EcN@pApt / Ca) is used as an example for pharmacodynamic evaluation experiments.

[0113] 5.1 Pharmacodynamic evaluation of probiotic microcapsules in a mouse model of acute UC (1) Grouping: Male C57BL / 6 mice after acclimatization were randomly divided into five groups (n=6 in each group), including normal group, model group, EcN group, calcium carbonate protected EcN group (EcN / CaCO3) and EcN@pApt / Ca group.

[0114] The preparation method of EcN / CaCO3 is as follows: Bacterial cells were dispersed in 1.5 mL of deionized water containing PVP (2 mg / mL). At room temperature, 0.2 mL of 0.33 mol / L calcium chloride (CaCl2) solution was added to the bacterial suspension. After stirring for 20 min, an equal volume of 0.33 mol / L sodium carbonate (Na2CO3) aqueous solution was added to the mixture. After stirring for 1 h, the mineralized bacteria were separated by centrifugation (6000 rpm / min, 1 min) and washed three times with PBS buffer.

[0115] (2) Experimental methods Mice in the model group, EcN group, EcN / CaCO3 group, and EcN@pApt / Ca group had their drinking water replaced with 3% DSS solution from day 0 until the end of the experiment to establish a DSS-induced fractional UC model. Mice in the normal group received no water treatment during the experiment and served as the control group.

[0116] Starting from the second day after modeling, the model group mice were administered physiological saline via gavage as a control, while the other groups of mice received the corresponding intervention regimens via gavage. The dose administered each time was 1×10⁻⁶ based on the EcN bacterial count. 8 Each CFUS animal was treated once daily for 6 consecutive days in each experimental group.

[0117] Mice body weight was recorded daily, and a Disease Activity Index (DAI) score was calculated based on the sum of three indicators: weight loss, fecal consistency, and fecal blood. Each indicator was scored from 0 to 4 points, ranging from low to high severity. On the last day of the experiment, mice were anesthetized and euthanized, and the colon tissue was dissected and the length of the intestinal tissue in each group was recorded.

[0118] 5.2 Pharmacodynamic evaluation of probiotic microcapsules in a mouse model of chronic UC Since ulcerative colitis (UC) has a chronic maintenance phase, it is necessary to evaluate the therapeutic effect of EcN@pApt / Ca using a chronic UC model. Therefore, a DSS-induced chronic UC model in C57BL / 6 mice was used to evaluate the intervention effect of probiotic microcapsules (e.g., EcN@pApt / Ca) on UC.

[0119] (1) Grouping: After acclimatization, male C57BL / 6 mice were randomly divided into four groups (n=6 in each group), including normal group, model group, EcN group and EcN@pApt / Ca group.

[0120] (2) Experimental methods Mice in the model group, EcN group, and EcN@pApt / Ca group had their drinking water replaced with 2% DSS solution for 5 consecutive days starting from day 0, followed by 5 days of normal diet. This pattern was repeated for 45 days to establish the model.

[0121] The administration cycle consisted of mice drinking water containing a 2% DSS solution. During this period, the model group mice were administered physiological saline via gavage as a control, while the other groups received their respective intervention regimens via gavage. The dose administered each time was 1 × 10⁻⁶ based on the EcN bacterial count. 8 Each CFUS animal was administered the drug once daily in each experimental group.

[0122] Mice body weight was recorded daily, and a Disease Activity Index (DAI) score was calculated based on the sum of indicators including weight loss, fecal consistency, and fecal blood. On the last day of the experiment, mice were anesthetized and euthanized, and colonic tissue was dissected and the length of intestinal tissue in each group was recorded.

[0123] The results are as follows Figure 5 As shown. Figure 5 The results showed that oral administration of probiotic microcapsules reduced the weight loss in mice induced by DSS-induced acute ulcerative colitis (UC). The weight loss in the EcN@pApt / Ca group was less than that in the model group, the EcN group, and the EcN@CaCO3 group protected by ordinary calcium carbonate. Oral administration of probiotic microcapsules also significantly reduced colonic atrophy in mice induced by acute UC. Length statistics showed that the colonic length in the EcN@pApt / Ca group was significantly longer than that in the model group, the EcN group, and the EcN@CaCO3 group protected by ordinary calcium carbonate.

[0124] Figure 5Results showed that oral administration of probiotic microcapsules reduced body weight loss in mice with DSS-induced chronic ulcerative colitis (UC). The body weight loss in the EcN@pApt / Ca group was less than that in the model group and the EcN group. Oral administration of probiotic microcapsules also significantly reduced colonic atrophy in mice induced by chronic UC. Length statistics showed that the colonic length in the EcN@pApt / Ca group was significantly greater than that in the model group and the EcN group.

[0125] discuss This invention proposes a universal probiotic surface multifunctional DNA-engineered protective microcapsule technology. Specifically, this invention utilizes cell surface DNA molecular engineering methods to construct long-chain nucleic acids, particularly long-chain multivalent DNA aptamers, and reacts them with calcium ions (Ca). 2+ The complexed protective layer enables the innovative design of various oral delivery systems for probiotics.

[0126] This protective mechanism not only effectively resists the destructive effects of gastric acid, but also, in the intestinal environment, the exposed multivalent aptamers enhance the colonization of probiotics at sites of inflamed gut by interacting with highly expressed inflammatory cytokines. Long-chain nucleic acid aptamers can also mimic flagellar motility, significantly improving the penetration and colonization efficiency of probiotics in the mucus layer. Furthermore, the modified probiotics possess a hydrophilic, negatively charged surface that further reduces non-specific adsorption between probiotics and intestinal mucins, enhancing colonization efficiency.

[0127] This invention is the first to use rolling circle amplification to modify long-chain multivalent nucleic acid aptamers on the surface of probiotics, and the aptamer modification can improve the motility and mucus penetration ability of probiotics in the intestine. This invention is the first to use calcium ions to complex with long-chain multivalent nucleic acid aptamers, thus endowing them with probiotic activity protection capabilities.

[0128] This invention is the first to use microcapsules based on long-chain multivalent nucleic acid aptamers for the protective treatment of ulcerative colitis with probiotics.

[0129] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A probiotic microcapsule based on long-chain nucleic acid, characterized in that, include: (a) Probiotics; (b) A long-chain nucleic acid linked to the surface of the probiotic, and the long-chain nucleic acid interacting with Ca 2+ The complexation forms a protective layer covering the surface of the probiotics.

2. The probiotic microcapsule as described in claim 1, characterized in that, The probiotic microcapsules have one or more characteristics selected from the group consisting of: (i) Resistant to stomach acid corrosion; (ii) Significantly enhanced intestinal motility; (iii) Significantly enhanced mucus penetration ability; (iv) Intestinal colonization capacity.

3. The probiotic microcapsule as described in claim 1, characterized in that, The length of the long nucleic acid chain is 100nt-10000nt; preferably, 100-800nt; more preferably, 100-500nt.

4. The probiotic microcapsule as described in claim 1, characterized in that, The probiotics are selected from one or more strains of Escherichia coli, Lactobacillus, Bifidobacterium, Enterococcus, Bacillus, Clostridium butyricum, and Saccharomyces.

5. A method for preparing probiotic microcapsules based on long-chain multivalent nucleic acid aptamers, characterized in that, Including the following steps: (s1) The 5'-amino-modified primer and probiotics were subjected to an amidation reaction under the catalysis of EDC and NHS, and the 5'-amino-modified primer was used to modify the surface of the probiotics to obtain probiotics with primers on the surface. (s2) Add the circular template of the nucleic acid aptamer and the phi29 enzyme, and maintain at 30°C for 1.5-3 hours to achieve rolling circle amplification modification of the multivalent nucleic acid aptamer on the surface of the probiotic modified with primers; thereby obtaining probiotics with long-chain multivalent nucleic acid aptamers on their surface. (s3) Optionally, the solution containing probiotics with surface-modified long-chain polyvalent nucleic acid aptamers is centrifuged and the lower layer of probiotics with surface-modified long-chain polyvalent nucleic acid aptamers is collected. and (s4) Add extra Ca 2+ The probiotics modified with long-chain polyvalent nucleic acid aptamers were reconstituted in DPBS solution and left to stand overnight to prepare probiotic microcapsules based on long-chain polyvalent nucleic acid aptamers.

6. The method as described in claim 5, characterized in that, The method for preparing the circular template of the nucleic acid aptamer is as follows: (i) A linear template-primer dimer is formed by pairing a 5'-phosphorylated linear DNA template containing a nucleic acid aptamer coding sequence with a primer sequence in PBS solution via an annealing step; (ii) Add T4 DNA ligase and incubate overnight at 16°C to achieve DNA template circularization; (iii) Heat the solution to 75°C and maintain for 8-12 minutes to inactivate T4 DNA ligase, and then purify the circular template-primer dimer using an ultrafiltration device; (iv) Add ExoIII and ExoI enzymes to the purified circular template-primer dimer, maintain at 37°C for 50-70 minutes, and purify using an ultrafiltration device to obtain the circular template.

7. The use of the probiotic microcapsule according to claim 1, characterized in that, Used to prepare formulations or compositions with intestinal probiotic effects.

8. The use as described in claim 7, characterized in that, The composition is selected from the group consisting of: pharmaceutical compositions, food compositions, health product compositions, feed compositions, or combinations thereof.

9. A pharmaceutical composition, characterized in that, include: (1) The probiotic microcapsules as described in claim 1; (2) Optionally, a pharmaceutically acceptable carrier.

10. The pharmaceutical composition according to claim 9, characterized in that, The dosage form of the pharmaceutical composition is an oral preparation.

Images