Multifunctional embolization microspheres, and preparation method and application thereof

Abstract

The application provides a multifunctional embolization microsphere and a preparation method and application thereof, and relates to the technical field of tumor treatment drugs.The multifunctional embolization microsphere comprises a carrier microsphere, a tracer, a nucleic acid aptamer and a therapeutic drug; the tracer is loaded on the carrier microsphere and is used for tracing the carrier microsphere; the nucleic acid aptamer is connected with the carrier microsphere through a disulfide bond and is used for targeting target cells; and the therapeutic drug is coupled with the nucleic acid aptamer. The multifunctional embolization microsphere has good stability, can realize spatiotemporal positioning during embolization, specific identification of target cells and controllable release of drugs, and can be used for the treatment of liver cancer and other tumors.

Description

Technical Field

[0001] This invention relates to the field of antitumor drug technology, and in particular to a multifunctional embolization microsphere, its preparation method, and its application. Background Technology

[0002] Interventional embolization therapy for tumors, especially transcatheter arterial chemoembolization (TACE), has become a first-line minimally invasive treatment for unresectable malignant tumors such as liver cancer. Its core objective is to precisely block the tumor's blood supply and achieve high-concentration drug delivery locally within the lesion, thus achieving a synergistic effect of both "starving" and "poisoning" the tumor. However, existing embolization material systems still have significant limitations in achieving precise spatiotemporal localization and intelligent targeted drug delivery, restricting further improvements in TACE efficacy and its individualized application.

[0003] Current embolization materials used in clinical practice and research, such as coils and liquid embolic agents, are often limited by issues such as recanalization, ectopic embolization, or procedural complexity. Among these, particulate embolization microspheres (such as polymer microspheres) are considered a more ideal carrier due to their good biocompatibility, size controllability, and drug loading potential. However, traditional embolization microspheres have three main limitations that restrict their therapeutic efficacy and safety: First, intraoperative and postoperative visualization and localization are difficult. To achieve image guidance, current methods typically involve temporarily mixing embolization microspheres with free iodine contrast agent before injection. However, in the complex hemodynamic environment, contrast agent molecules readily separate from the microspheres and rapidly diffuse and dilute in the blood. This directly leads to blurred X-ray imaging and unclear embolization boundaries during the procedure, making it difficult for the surgeon to accurately determine the embolization endpoint. Furthermore, it makes long-term, stable imaging follow-up and evaluation of the microsphere distribution and retention in the body impossible after the procedure, affecting the assessment of treatment efficacy.

[0004] Second, the drug delivery efficiency is low and the tumor targeting is lacking. Microspheres, as drug delivery platforms, offer the advantage of local drug administration. However, in current technologies, microspheres are mostly loaded with chemotherapy drugs through physical adsorption or simple encapsulation. This method has problems such as limited drug loading capacity and uncontrollable drug release, making it impossible to maintain a long-term effective therapeutic concentration at the tumor site. It often still requires systemic administration or multiple interventional treatments, which is not only complicated to operate but also increases the risk of systemic side effects such as cardiotoxicity caused by DOX (doxorubicin). More importantly, these microspheres themselves do not have the ability to actively recognize tumor cells. The released drugs diffuse non-specifically in the lesion area, causing damage to normal tissues, i.e., "embolism without targeting."

[0005] Third, the poor uniformity of microsphere size leads to uncontrollable embolization effects. Many traditional methods produce microspheres with a wide particle size distribution. This inhomogeneity can cause serious clinical problems: excessively large microspheres may prematurely embolize larger proximal vessels, making it difficult to reach the tumor's terminal nourishing vessels, resulting in incomplete embolization and the formation of collateral circulation; while excessively small microspheres may penetrate the tumor's capillary network or enter the systemic circulation via arteriovenous fistulas, causing accidental ectopic embolization of non-target organs (such as the lungs and brain), posing safety risks. The uncontrollable particle size directly reduces the predictability of the embolization process and outcome.

[0006] In view of this, the present invention is hereby proposed. Summary of the Invention

[0007] The primary objective of this invention is to provide a multifunctional embolization microsphere to solve the aforementioned technical problems.

[0008] The second objective of this invention is to provide a method for preparing the above-mentioned multifunctional embolic microspheres.

[0009] A third objective of this invention is to provide the application of the above-mentioned multifunctional embolic microspheres in the preparation of tumor therapeutic drugs.

[0010] To achieve the above objectives, the following technical solution is adopted: In a first aspect, the present invention provides a multifunctional embolization microsphere, comprising a carrier microsphere, a tracer, a nucleic acid aptamer, and a therapeutic drug; The tracer is loaded onto the carrier microspheres and is used for tracing the carrier microspheres; The nucleic acid aptamer is connected to the carrier microspheres via disulfide bonds, which is used to target the target cells; The therapeutic drug is linked, bound, or loaded with the nucleic acid aptamer.

[0011] As a further technical solution, the carrier microspheres include hydrogel microspheres; the raw materials of the hydrogel microspheres include one or more of the following: polyacrylamide, alginate, silk fibroin, gelatin, or polyethylene glycol; The tracers include one or more of the following: AIE nanoparticles with near-infrared fluorescence properties, quantum dots, rare earth-doped nanoparticles, carbon dots, or single-walled carbon nanotubes. The target cells targeted by the nucleic acid aptamer include tumor cells; the tumor cells include liver cancer cells. The therapeutic agents include chemotherapy drugs; the chemotherapy drugs include one or more of doxorubicin, dexamethasone, docetaxel, 5-fluorouracil, ifosfamide, styromycin, chromomycin, or actinomycin D.

[0012] As a further technical solution, the nucleic acid aptamer includes EpCAM aptamer, GPC3 aptamer, or LY-1 aptamer; Preferably, the 5' end and 3' end of the nucleic acid aptamer are respectively connected to a first nucleic acid segment and a second nucleic acid segment; the bases of the first nucleic acid segment and the second nucleic acid segment are mainly composed of G and C, and the two bases are complementary to form a double strand; the proportion of G and C in the first nucleic acid segment and the second nucleic acid segment is more than 60%; Preferably, the 5' end of the nucleic acid aptamer or the 5' end of the first nucleic acid segment is sequentially modified with the disulfide bond and acrylamide or methacrylamide, wherein the acrylamide is chemically coupled to the carrier microspheres.

[0013] Secondly, the present invention provides a method for preparing the above-mentioned multifunctional embolic microspheres, comprising the following steps: a. Prepare a first dispersed aqueous solution containing acrylamide, a crosslinking agent, a first initiator, and a nucleic acid aptamer; wherein the 5' and 3' ends of the nucleic acid aptamer are respectively connected to a first nucleic acid segment and a second nucleic acid segment; the bases of the first nucleic acid segment and the second nucleic acid segment are composed of G and C, and the two bases are complementary to form a double strand; the modification of the 5' end of the first nucleic acid segment includes disulfide bond and acrylamide in sequence; b. Prepare a second dispersed aqueous solution containing acrylamide, a crosslinking agent, a second initiator, and a tracer; c. A mixture of a first and a second dispersed phase aqueous solution was prepared using a microfluidic chip, and then cross-linked to obtain polyacrylamide hydrogel microspheres loaded with tracers and nucleic acid aptamers. d. The polyacrylamide hydrogel microspheres obtained in step c are dispersed in a solution of the therapeutic drug. After incubation, the therapeutic drug binds to the first and second nucleic acid segments of the aptamer to prepare multifunctional embolization microspheres.

[0014] As a further technical solution, the crosslinking agent includes N,N-bisacryloylcysteine; The concentrations of the crosslinking agent in the first and second dispersed aqueous phases are each independently 0.5%-8%.

[0015] As a further technical solution, the first initiator includes tetramethylethylenediamine; the concentration of the first initiator in the first dispersed aqueous phase is 0.5%-2%; The second initiator includes ammonium persulfate; the concentration of the second initiator in the second dispersed aqueous phase is 0.5%-2%.

[0016] As a further technical solution, in the first dispersed aqueous phase, the concentration of acrylamide is 6%-24%, and the concentration of nucleic acid aptamers is 0.625-625 μM; In the second dispersed aqueous phase, the concentration of acrylamide is 24%, and the tracer is AIE nanoparticles with a concentration of 0.5-5 mg / mL.

[0017] As a further technical solution, the concentration of the therapeutic drug is 0.25-250 μM; The incubation temperature is 35-39℃, and the incubation time is 0.5-2h.

[0018] Thirdly, the present invention provides the application of the above-mentioned multifunctional embolization microspheres in the preparation of tumor therapeutic drugs.

[0019] As a further technical solution, the tumor includes liver cancer.

[0020] Compared with existing technologies, the multifunctional embolization microspheres provided by this invention have the following beneficial effects: 1. Achieving Spatiotemporal Localization of Embolization: This invention stably encapsulates the tracer within a hydrogel network framework of microspheres. This design ensures that the imaging component and the embolization carrier become an inseparable whole, fundamentally avoiding "drug-image separation." Furthermore, using AIE molecules as the tracer, they emit strong near-infrared II (NIR-II) fluorescence in the microsphere aggregated state. This wavelength exhibits deep tissue penetration and low background interference. This method provides precise embolization localization and endpoint determination, and also enables non-invasive, long-term efficacy follow-up and monitoring post-operatively.

[0021] 2. Achieving Controlled Drug Release: This invention constructs a smart release system based on glutathione (GSH) response. The tumor microenvironment typically has abnormally high concentrations of GSH. The microspheres of this invention achieve nucleic acid aptamer loading through disulfide bonds. When the microspheres accumulate in the tumor region, the high concentration of GSH triggers the cross-linking network and the disulfide bond breaking and degradation of the nucleic acid aptamer, thereby releasing the aptamer drug.

[0022] 3. Achieving Tumor Cell-Specific Recognition: This invention specifically modifies the surface of microspheres with aptamers that target specific cells. When the microspheres embolize tumor blood vessels and release drugs, the surface aptamers act like "intelligent navigation," actively recognizing and tightly binding to receptors on the tumor cell membrane. Through receptor-mediated endocytosis, the encapsulated therapeutic drugs are efficiently and massively internalized into the tumor cells. This active targeting mechanism greatly increases the concentration of drugs within the lesion cells while reducing exposure to surrounding normal tissues. Attached Figure Description

[0023] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0024] Figure 1 Preparation and characterization of multifunctional microcapsules; (A) Optical images of multifunctional microcapsules (AIE@APT / DOX@MS); (B) SEM images of hydrogel microspheres (treated with 0 / 10 mM GSH), where images 1 and 2 from the left are before treatment, and images 3 and 4 from the left are after treatment; (C) Surface morphology of multifunctional microcapsules (AIE@APT / DOX@MS); (D) Effect of oil phase flow rate on droplet and microsphere diameters; Figure 2 Characterization of AIE luminescence stability; fluorescence images (A) and quantitative fluorescence diagram (B) of AIE nanoparticles and AIE fluorescent dyes in microcapsules within 30 days; Figure 3 Characterization of aptamer's resistance to degradation; APT@MS fluorescence dynamic monitoring map (A) and fluorescence quantitative map (B); Figure 4 For stability characterization; (A) Optical images of microcapsules after natural air drying and freeze drying followed by reconstitution; (B) Optical images and particle size distribution after resuspension in serum; Figure 5 Compatibility analysis of multifunctional microcapsules; (A) Cell viability results of LO2 cells incubated with different concentrations of MS, AIE@MS and AIE@APT@MS for 24 h, 48 h and 72 h; (B) CLSM images of LO2 cells after incubation with MS, AIE@MS and AIE@APT@MS for 24 h; (C) Hemolysis assay of MS, AIE@MS and AIE@APT@MS; Figure 6 Characterization of the tracer properties of multifunctional microcapsules; PL spectrum (A) and physical image (B) of near-infrared II AIE fluorescent nanoparticles (AIE) under 720nm excitation; near-infrared images of tumors in the AIE@APT / DOX@MS group and control group after TACE; Figure 7Characterization of targeted drug delivery for multifunctional microcapsules; (A) Schematic diagram of APT / DOX release from microspheres treated with different GSH concentrations; (B) Drug release curve of multifunctional microcapsules; (C) Schematic diagram of AIE@APT / DOX@MS targeting and killing cells; (D) Cell viability results of LO2 cells (i) and HepG2 cells (ii) after incubation with AIE@APT / DOX@MS at different GSH concentrations for 24 h, 48 h, and 72 h; (E) CLSM images of HepG2 cells and cells incubated with AIE@APT@MS, AIE@RS@MS, free DOX, AIE@RS / DOX@MS, and AIE@APT / DOX@MS for 24 h; (F) Cell apoptosis results; (G) Comparison of cell sphere and tumor sphere viability curves; (H) Live and dead cell staining images of LO2 (i) and HepG2 (ii) cells after co-incubation with multifunctional microcapsules for 48 hours; Figure 8 (A) Schematic diagram of animal studies; (B) CT images of each group (from left to right: iodized oil, AIE@APT / DOX@MS, AIE@RS / DOX@MS, AIE@APT@MS, saline); (CD) Tumor volume statistics; (E) Histopathological HE staining analysis; (F) Histopathological Masson staining analysis. Detailed Implementation

[0025] The embodiments and examples of the present invention will be described in detail below. However, those skilled in the art will understand that the following embodiments and examples are for illustrative purposes only and should not be considered as limiting the scope of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Unless otherwise specified, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0026] In a first aspect, the present invention provides a multifunctional embolization microsphere, comprising a carrier microsphere, a tracer, a nucleic acid aptamer, and a therapeutic drug; The tracer is loaded (the loading method can be, for example, embedding, doping, etc.) onto the carrier microspheres for tracing the carrier microspheres; The nucleic acid aptamer and the carrier microspheres are connected by disulfide bonds (it should be noted that the present invention does not impose specific restrictions on the connection method between the nucleic acid aptamer and the carrier microspheres, for example, the nucleic acid aptamer can be modified with disulfide bonds, and the disulfide bonds can then be coupled to the carrier microspheres through chemical cross-linking), for targeting target cells; The therapeutic drug is connected, bound, or loaded with the nucleic acid aptamer (it can be loaded onto multifunctional embolization microspheres through nucleic acid intercalation, physical adsorption, electrostatic interaction, covalent coupling, or encapsulation).

[0027] This multifunctional embolization microsphere has good stability and can achieve spatiotemporal localization of embolization, specific recognition of target cells, and controlled drug release, making it suitable for the treatment of tumors such as liver cancer.

[0028] This invention does not impose specific limitations on the raw materials used in the preparation of hydrogel microspheres. In some optional embodiments, the carrier microspheres include hydrogel microspheres; the raw materials of the hydrogel include, but are not limited to, polyacrylamide, alginate, silk fibroin, gelatin, or polyethylene glycol, preferably polyacrylamide.

[0029] Soluble acrylamide hydrogel microspheres possess excellent biocompatibility, morphological integrity, and elasticity. Their three-dimensional hydrophilic network structure can be designed as intelligent systems responsive to tumor microenvironments (such as high-concentration glutathione GSH). This provides a multifunctional platform for the stable doping of AIE molecules, site-specific modification of aptamers, and the controllable loading and release of drugs such as DOX.

[0030] In some optional embodiments, the tracer includes, but is not limited to, one or more of the following: AIE nanoparticles, quantum dots, rare earth-doped nanoparticles, carbon dots, or single-walled carbon nanotubes with near-infrared fluorescence properties, preferably AIE nanoparticles.

[0031] Aggregation-induced emission (AIE) materials exhibit significantly enhanced fluorescence in the aggregated state and possess characteristics such as good photostability, large Stokes shift, and especially deep penetration into near-infrared luminescent tissues. They are ideal optical materials for constructing endogenous imaging microspheres that can be used for real-time fluorescence navigation and long-term tracking. Therefore, this invention preferably uses AIE nanoparticles as tracer materials.

[0032] In some alternative implementations, the target cells targeted by the nucleic acid aptamer include tumor cells; the tumor cells include, but are not limited to, liver cancer cells; In some alternative embodiments, the therapeutic agent includes a chemotherapy drug; the chemotherapy drug includes, but is not limited to, one or more of doxorubicin, dexamethasone, docetaxel, 5-fluorouracil, ifosfamide, styromycin, chromomycin, or actinomycin D.

[0033] In some alternative embodiments, the nucleic acid aptamer is coupled to the therapeutic drug in the form of physical coupling (e.g., by designing the GC region to achieve physical coupling with therapeutic drugs such as doxorubicin) or chemical coupling (e.g., by introducing carboxyl (-COOH) or maleimide (MAL) groups through chemical modification to covalently bind the therapeutic drug to the aptamer).

[0034] In some alternative embodiments, the nucleic acid aptamers include, but are not limited to, EpCAM aptamers (targeting epithelial cell adhesion molecule (EpCAM), see 10.3389 / fbioe.2024.1443843), GPC3 aptamers (targeting phosphatidylinositol proteoglycan-3 (GPC3), see https: / / doi.org / 10.2967 / jnumed.123.266766), or LY-1 aptamers (targeting membrane proteins on the surface of highly metastatic liver cancer cells (such as HCCLM9 cells), see 10.18632 / oncotarget.6988), or other nucleic acid aptamers well known to those skilled in the art.

[0035] Preferably, the 5' end and 3' end of the nucleic acid aptamer are respectively connected to a first nucleic acid segment and a second nucleic acid segment; the bases of the first nucleic acid segment and the second nucleic acid segment are mainly composed of G and C, and the two bases are complementary to form a double strand; the proportion of G and C in the first nucleic acid segment and the second nucleic acid segment is more than 60%; Preferably, the 5' end of the nucleic acid aptamer or the 5' end of the first nucleic acid segment is sequentially modified with the disulfide bond and acrylamide or methacrylamide, wherein the acrylamide is chemically coupled to the carrier microspheres.

[0036] Nucleic acid aptamers, as artificially synthesized single-stranded oligonucleotides, possess advantages such as high target affinity, strong specificity, good stability, and ease of modification and synthesis. This invention modifies the aptamer to include GC-enriched regions (the first and second nucleic acid segments, capable of physical coupling with chemotherapeutic drugs such as doxorubicin), endowing microspheres with the ability to efficiently load chemotherapeutic drugs and actively recognize and anchor tumor cells, achieving precise drug delivery at the cellular level.

[0037] Secondly, the present invention provides a method for preparing the above-mentioned multifunctional embolic microspheres, comprising the following steps: a. Prepare a first dispersed aqueous solution containing acrylamide, a crosslinking agent, a first initiator, and a nucleic acid aptamer; wherein the 5' and 3' ends of the nucleic acid aptamer are respectively connected to a first nucleic acid segment and a second nucleic acid segment; the bases of the first nucleic acid segment and the second nucleic acid segment are composed of G and C, and the two bases are complementary to form a double strand; the modification of the 5' end of the first nucleic acid segment includes disulfide bond and acrylamide in sequence; b. Prepare a second dispersed aqueous solution containing acrylamide, a crosslinking agent, a second initiator, and a tracer; c. A mixture of a first and a second dispersed phase aqueous solution was prepared using a microfluidic chip, and then cross-linked to obtain polyacrylamide hydrogel microspheres loaded with tracers and nucleic acid aptamers. d. The polyacrylamide hydrogel microspheres obtained in step c are dispersed in a solution of the therapeutic drug. After incubation, the therapeutic drug binds to the first and second nucleic acid segments of the aptamer to prepare multifunctional embolization microspheres.

[0038] Microfluidic droplet technology utilizes precise fluid dynamics control of two-phase fluids within microchannels to continuously and efficiently generate droplet templates with uniform size and height. By adjusting the channel structure and flow rate, precise and flexible control of the droplet diameter can be achieved. This platform allows for the uniform mixing of functional components such as polymer precursors, AIE molecules, and aptamers in a continuous phase before droplet generation. This enables in-situ and uniform encapsulation of each functional element during the droplet solidification process to form microspheres, fundamentally ensuring the consistency of microsphere performance and the integrity of its functions. Accordingly, this invention employs microfluidic droplet technology to efficiently, uniformly, and reproducibly integrate the aforementioned multifunctional modules (polyacrylamide hydrogel microspheres, AIE nanoparticles, and aptamers) into uniformly sized microspheres, addressing the shortcomings of traditional batch synthesis methods in controlling microsphere monodispersity, uniformity of functional component distribution, and batch stability.

[0039] The preparation method of the present invention has the following advantages: 1. Multifunctionality: The multifunctional embolic microspheres prepared by this method have good stability, including aptamer drug stability, AIE luminescence stability and drying-reconstitution stability, and simple storage conditions; they also have good biocompatibility, including cell compatibility and blood compatibility, providing a reliable platform for subsequent animal and clinical studies.

[0040] 2. High controllability: The preparation of multifunctional embolization microspheres using this technology has extremely high controllability. The size of the microspheres and the drug concentration can be controlled by changing the size of the microfluidic chip and the amount of aptamer drug added, which is beneficial for synthesizing microspheres for different lesion sites and different blood vessel sizes.

[0041] 3. Excellent product uniformity: The embolic microspheres prepared by the fluid focusing microchannel of the droplet microfluidic chip are morphologically intact, uniform in size, and have good elasticity. The high degree of size uniformity fundamentally avoids the unpredictability of embolization caused by excessive particle size differences, ensuring that the microspheres can consistently reach and embolize the target blood vessels.

[0042] 4. Multi-dimensional validation of in vitro and in vivo efficacy: In vitro, its specific targeting ability, efficient tumor cell killing effect, and controllable drug release behavior were confirmed through traditional two-dimensional cell culture and three-dimensional tumor spheroid models. In animal models, its in vivo imaging tracing clarity, precise tumor vessel embolization effect, and significant tumor-suppressing efficacy were further validated, with overall performance significantly superior to traditional embolization materials.

[0043] In some alternative embodiments, the crosslinking agent includes, but is not limited to, N,N-bisacryloylcysteine, or other crosslinking agents as described by those skilled in the art; The concentrations of the crosslinking agent in the first and second dispersed aqueous phases are each independently 0.5%-8%, for example, but not limited to 0.5%, 2% or 8%.

[0044] In this scheme, the crosslinking reaction is initiated by a first initiator and a second initiator. In some optional embodiments, the first initiator includes tetramethylethylenediamine; the concentration of the first initiator in the first dispersed aqueous phase is 0.5%-2%, for example, but not limited to 0.5%, 1.4%, or 2%; The second initiator includes, but is not limited to, ammonium persulfate; the concentration of the second initiator in the second dispersed aqueous phase is 0.5%-2%, for example, but not limited to 0.5%, 1.4% or 2%.

[0045] In some optional embodiments, the concentration of acrylamide in the first dispersed aqueous phase may be, for example, but not limited to, 6%, 12% or 24%, and the concentration of nucleic acid aptamers may be, for example, but not limited to, 0.625 μM, 6.25 μM, 62.5 μM or 625 μM. In the second dispersed aqueous phase, the concentration of acrylamide is 24%, and the tracer is AIE nanoparticles, the concentration of which can be, for example, but not limited to, 0.5 mg / mL, 2.5 mg / mL or 5 mg / mL.

[0046] In some alternative embodiments, the concentration of the therapeutic drug may be, for example, but not limited to, 0.25 μM, 25 μM, or 250 μM; The incubation temperature can be, for example, but not limited to, 35°C, 37°C or 739°C, and the incubation time can be, for example, but not limited to, 0.5h, 1h or 2h.

[0047] Thirdly, the present invention provides the application of the above-mentioned multifunctional embolization microspheres in the preparation of tumor therapeutic drugs.

[0048] The multifunctional embolic microspheres provided by this invention can target and recognize tumor cells and trigger degradation under high GSH conditions, thereby releasing aptamer drugs. Therefore, these multifunctional embolic microspheres can be used to prepare drugs for treating tumors.

[0049] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.

[0050] Example 1 A multifunctional embolization microsphere (AIE@APT / DOX@MS) is prepared by the following method: 1. A certain amount of droplets are used to generate oil as the continuous phase; 2. A certain amount of acrylamide (AM), N,N-bisacryloylcysteamine (BAC), tetramethylethylenediamine (TEMED), and aptamer (APT, sequence shown in SEQ ID NO.1, with dithiol disulfide bond and acrylamide sequentially modified at its 5' end) were used as dispersed phase 1; a certain amount of acrylamide (AM), N,N-bisacryloylcysteamine (BAC), ammonium persulfate (APS), and AIE nanoparticles were used as dispersed phase 2; wherein, the final concentrations of AM, BAC, APS, and TEMED were 24%, 2%, 1.4%, and 1.4%, respectively; the final concentration of AIE nanoparticles was 1 mg / mL; and the concentration of APT was 62.5 μM. CGCGCGCCGCACGUAUCCCUUUUCGCGUGCGGCGCGCG (SEQ ID NO. 1).

[0051] 3. Add the continuous phase solution and the two dispersed phase solutions separately into the liquid-carrying syringe, setting the flow rate ratio to 3:1:1, to generate droplets in the droplet microfluidic chip and collect them in the EP tube; 4. Place the droplets collected in step 3 in a 37°C constant temperature oven for polymerization for 0.5 h; 5. After polymerization, centrifuge the sample at 4000 rpm for 20 seconds, discard the lower continuous phase, add an appropriate amount of HFE-7100 to reconstitute, mix gently, centrifuge at 4000 rpm for 1 minute, discard the lower layer solution, and repeat twice. Reconstitute in hexafluorobutanol, mix well, centrifuge at 4000 rpm for 1 minute, discard the supernatant, and repeat the washing step twice. Finally, reconstitute in 1×PBS, mix well, centrifuge at 4000 rpm for 1 minute, discard the supernatant, and repeat the washing step twice.

[0052] 6. After washing, the sample was redispersed in DOX solution (25 μM) and incubated in a constant temperature incubator at 37 °C for 1 h to allow DOX to bind to the GC enrichment region of the aptamer, thus preparing multifunctional embolic microspheres.

[0053] Example 2 A microsphere (MS) differs from Example 1 in that it is not loaded with APT, AIE, and drugs.

[0054] Example 3 A microsphere (AIE@MS) differs from Example 1 in that it is not loaded with APT and drugs.

[0055] Example 4 A microsphere (AIE@APT@MS) differs from Example 1 in that it is not loaded with a drug.

[0056] Example 5 A microsphere (APT@MS) differs from Example 1 in that it is not loaded with AIE and drugs.

[0057] Example 6 A microsphere (AIE@RS / DOX@MS) differs from Example 1 in that APT is replaced with the non-targeting aptamer RS.

[0058] Experimental Example 1 1. Microcapsule characterization: The multifunctional embolic microspheres prepared in Example 1 of this invention were observed, and the results are as follows: Figure 1 As shown.

[0059] The morphology of the microspheres was observed using an inverted fluorescence microscope. Successful loading of the aptamer, DOX, and AIE was verified under excitation at wavelengths of 488 nm, 555 nm, and 710 nm, respectively. Figure 1 (A) SEM images clearly demonstrate that the multifunctional embolic microspheres, at a concentration of 10 mM GSH, exhibit an increased network structure, which is beneficial for the release of aptamer drugs. Figure 1 (B in the text). The surface morphology of the multifunctional microcapsules is as follows: Figure 1 As shown in Figure C, S and Cl elements are uniformly dispersed on the surface of the microspheres, where S comes from AIE molecules and Cl comes from DOX. This further indicates that AIE molecules and DOX have been successfully combined with the acrylamide hydrogel microspheres. Figure 1 (C in the middle).

[0060] The effect of oil phase flow rate on microsphere preparation was then investigated. When the flow rate in the inner liquid (two dispersed phases) was 0.4 μm / mL, the particle size of the emulsion could be precisely adjusted by controlling the flow rate of the outer liquid (oil phase). The particle size range of the emulsion was 182.71±2.61~279.76±3.28 μm, and the particle size range of the microspheres was 234.57±8.85~344.09±5.18 μm. The coefficient of variation (CV) for both the emulsion and microspheres prepared at different flow rates was less than 5%. Figure 1 The D in the figure indicates that they are uniform in size and have good monodispersity.

[0061] 2. Microcapsule stability: 2.1 AIE luminescence stability: The prepared AIE nanoparticles@MS and AIE fluorescent dye@MS were stored in PBS. The fluorescence intensity of the microspheres was monitored over 30 days using an inverted fluorescence microscope (red light excitation, 500 ms), and the fluorescence intensity values ​​were statistically analyzed using ImageJ.

[0062] The results are as follows Figure 2As shown in the figure, the luminescence of the multifunctional embolic microspheres was monitored under a near-infrared spectrometer. The luminescence intensity remained constant, indicating that it has good luminescence efficiency and stability.

[0063] 2.2 Aptamer resistance to degradation: The results are as follows Figure 3 As shown in the figure. Using FAM-labeled aptamers, we constructed fluorescently traced APT@MS (APT-loaded hydrogel microspheres) to evaluate their resistance to DNase-I degradation. Co-incubation with 10 U / μL DNase-I at 37 °C for up to 10 days showed stable fluorescence intensity, further confirming that the microspheres provide effective protection for the aptamers against enzymatic degradation.

[0064] 2.3 Storage stability: The effects of two commonly used microsphere drying methods, air drying and freeze drying, on multifunctionality were investigated. The average particle size of the air-dried AIE@APT / DOX@MS microspheres was 100 μm, but due to their irregular shape, the diameter of the freeze-dried microspheres could not be calculated. Figure 4 (A) This is because, during the freeze-drying process, ice crystals formed inside the microspheres disrupted the integrity of their gel network. Therefore, they lost their sphericity after freeze-drying. The dried microcapsules could all recover their original spherical shape within 1 minute in PBS, exhibiting a uniform size distribution, both due to the high hydrophilicity of the microcapsules. To assess the long-term stability of the microcapsules, they were stored in fetal bovine serum for three months, and changes in particle size were monitored. The results showed ( Figure 4 The emboli in B) all have good storability and can quickly restore their functional state after rehydration, which indicates that they have the potential to be used as delivery carriers in actual clinical applications.

[0065] 3. Good biocompatibility: The viability of LO2 cells co-cultured with 2 mg / mL MS, AIE@MS, and AIE@APT@MS for 24, 48, and 72 hours was determined using the CCK-8 assay. The results showed that cell viability was consistently above 90%. Figure 5 The "A" in the diagram (from left to right: MS, AIE@MS, and AIE@APT@MS) indicates that the prepared microcapsules exhibit relatively low cytotoxicity. Furthermore, the survival of LO2 cells co-cultured with different microspheres was assessed using live / dead cell staining. Figure 5 As shown in Figure B, the cells exhibited good adhesion and normal growth morphology, with live cells (green fluorescence) making up the vast majority, and only a few dead cells (red fluorescence) observed. Cell compatibility assays indicated that all three types of microspheres were non-toxic to cells and safe for in vivo embolization.

[0066] For embolic agents that come into contact with blood, the induction of hemolysis after reconstitution is a critical prerequisite for safe application. Therefore, we systematically evaluated the hemolytic behavior of MS, AIE@MS, and AIE@APT@MS after co-incubation with fresh blood. Figure 5 As shown in C, the hemolysis rate of the three microspheres is less than 2%, which is within the national safety standard for biomaterials (≤5%).

[0067] 4. In vitro and in vivo NIR-II visibility verification: In vitro: Photoluminescence (PL) spectra were analyzed using steady-state / transient fluorescence spectroscopy. The excitation wavelength was 720 nm. Multifunctional microcapsules AIE@APT / DOX@MS were prepared according to the above scheme, and macroscopic NIR-II luminescence data of the multifunctional microcapsules were measured using infrared thermal imaging.

[0068] In vivo: Liver tissue was taken for near-infrared imaging after TACE treatment in the AIE@APT / DOX@MS experimental group and the saline control group.

[0069] The PL spectrum of near-infrared II AIE fluorescent nanoparticles (AIE) under 720 nm excitation is shown below. Figure 6 As shown in A; in vitro luminescence characteristics are as follows Figure 6 As shown in B; in vivo experimental rabbit liver tumors showed clear fluorescence signals in the near-infrared II region in optical characterization. Figure 6 (C in the middle).

[0070] 5. Validation using traditional cells and 3D cells: Regarding drug release, the DOX release behavior of multifunctional microcapsules in different GSH concentration buffers at 37°C for 10 days was investigated. 10 mM was used to simulate the highly reducing microenvironment of tumor tissue, while 1–2 mM corresponded to the physiological levels in the normal vascular system. Figure 7 A in the example. Figure 7 As shown in B, the release behavior of DOX exhibits a significant GSH concentration dependence.

[0071] 2D cell culture: The CCK-8 assay was used to analyze the effects of different incubation times and GSH concentrations on the proliferation of LO2 (normal human hepatocytes) and HepG2 (human hepatocellular carcinoma cells). Figure 7 (C in the text). For example, Figure 7As shown in Figure D (cell viability results of LO2 cells (i) and HepG2 cells (ii) after incubation with different concentrations of AIE@APT / DOX@MS for 24 h, 48 h, and 72 h), under different concentrations of GSH, AIE@APT / DOX@MS showed a more significant inhibitory effect on the proliferation of HepG2 cells compared to LO2 cells. In contrast, AIE@APT@MS without the drug did not show significant toxicity in any experimental group, and the cell viability remained above 80%, except for interference from the toxicity of the carrier material itself. Live / dead cell staining results showed that the AIE@APT / DOX@MS treatment group had the highest proportion of dead cells, exhibiting the strongest cytotoxicity; while the free DOX and AIE@RS / DOX@MS groups (where RS is a non-targeted random aptamer) also induced some cell death, but the degree was significantly lower than that of the targeted group ( Figure 7 The killing effect of all drug-loaded groups was significantly higher than that of the unloaded AIE@RS@MS and AIE@APT@MS control groups, confirming that cell death mainly originated from DOX activity rather than the carrier itself. FITC-Annexin V / PI flow cytometry further confirmed that AIE@APT / DOX@MS treatment (apoptosis rate 43.94%) significantly induced HepG2 cell apoptosis compared to free DOX (apoptosis rate 26.89%) and non-targeted AIE@RS / DOX@MS (apoptosis rate 23.4%), effectively triggering programmed cell death in tumor cells. Figure 7 (F in the text).

[0072] 3D cell spheroid model: Figure 7 The G in the figure indicates that after AIE@APT / DOX@MS treatment, the growth viability of tumor spheres was lower than that of cell spheres. In the control group (AIE@APT@MS), the growth status of tumor spheres and cell spheres was not significantly different. Furthermore, we injected cell spheres and tumor spheres into a simulated chip, then introduced multifunctional microcapsules, and incubated them for 48 hours. Live / dead staining results ( Figure 7 In the H) culture, consistent with 2D cell culture, tumor spheres showed poorer growth status than cell spheres. All results indicate that our multifunctional microcapsules have the potential to target anti-tumor cells.

[0073] 6. Animal verification: A rabbit tumor (liver cancer) model was constructed. After successful establishment, the experimental rabbits were randomly divided into 6 groups of 3 rabbits each: saline group, AIE@MS group, AIE@RS / DOX@MS group, AIE@APT / DOX@MS group, and iodized oil / DOX group. Isoflurane was used to maintain anesthesia during the operation.

[0074] Next, AIE@MS was dispersed in 2 mL of physiological saline. AIE@RS@MS and AIE@APT@MS were dispersed in 2 mL of DOX solution (4 mg / mL). -1 AIE@RS / DOX@MS and AIE@APT / DOX@MS were obtained, and the drug dose for each group was calculated based on the DOX concentration to ensure that the DOX concentration and the total dose were basically the same.

[0075] The experimental rabbit was then fixed in a supine position on the operating table. After skin preparation and disinfection, surgical draping was performed sequentially in the right groin area. An incision was made at the site of the most prominent femoral artery pulsation, exposing the femoral artery 3-4 cm. A small incision was made in the exposed femoral artery segment, and a guidewire and catheter sheath were continuously introduced through the small incision, then the catheter sheath was fixed. The catheter sheath was slowly introduced, followed by the microguidewire and microcatheter. When the microcatheter was inserted into the abdominal aorta, contrast agent was injected, and digital subtraction angiography was performed. The abdominal vascular distribution was observed to locate the blood supply artery to the liver tumor. The microcatheter was slowly advanced to the blood supply artery to the liver tumor, and angiography was performed again to carefully observe the tumor's blood supply, preparing for further treatment. A follow-up examination showed that most of the tumor staining had disappeared, indicating satisfactory embolization. The microguidewire and microcatheter were slowly withdrawn, and the two ends of the vessel were sutured end-to-end. The surgical wound was sutured layer by layer, and the area was disinfected. Real-time CT scans were used to monitor tumor growth.

[0076] Enhanced CT ( Figure 8 The results showed that on day 14 post-treatment, tumor volume increased in both the control and AIE@MS groups, while the growth rates in the iodized oil + DOX group, AIE@RS / DOX@MS group, and AIE@APT / DOX@MS group were lower than those in the control group. Specifically, the AIE@APT / DOX@MS group showed a smaller growth rate than the clinically common iodized oil + DOX group, while the AIE@RS / DOX@MS group showed a larger growth rate than both. This is because, in liver cancer treatment, although the AIE@RS / DOX@MS group can control tumor growth to some extent, it cannot effectively eliminate the tumor by targeting tumor cells. The AIE@APT / DOX@MS group showed the slowest tumor shrinkage, indicating its superior efficacy compared to traditional chemoembolization with iodized oil combined with DOX. Next, tumor tissue was collected for pathological examination. In the AIE@RS / DOX@MS group, most of the tumor tissue was necrotic, while in the AIE@APT / DOX@MS group and the iodized oil + DOX group, the tumor tissue was completely necrotic; the other three groups showed a significant amount of residual tumor parenchyma. These results further confirm the potential of the AIE@APT / DOX@MS group as a permanent drug-loaded embolized microsphere in TACE treatment of liver cancer.

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A multifunctional embolic microsphere, characterized in that, Including carrier microspheres, tracers, nucleic acid aptamers, and therapeutic drugs; The tracer is loaded onto the carrier microspheres and is used for tracing the carrier microspheres; The nucleic acid aptamer is connected to the carrier microspheres via disulfide bonds, which is used to target the target cells; The therapeutic drug is linked, bound, or loaded with the nucleic acid aptamer.

2. The multifunctional embolic microspheres according to claim 1, characterized in that, The carrier microspheres include hydrogel microspheres; the raw materials for the hydrogel microspheres include one or more of the following: polyacrylamide, alginate, silk fibroin, gelatin, or polyethylene glycol; The tracers include one or more of the following: AIE nanoparticles with near-infrared fluorescence properties, quantum dots, rare earth-doped nanoparticles, carbon dots, or single-walled carbon nanotubes. The target cells targeted by the nucleic acid aptamer include tumor cells; the tumor cells include liver cancer cells. The therapeutic agents include chemotherapy drugs; the chemotherapy drugs include one or more of doxorubicin, dexamethasone, docetaxel, 5-fluorouracil, ifosfamide, styromycin, chromomycin, or actinomycin D.

3. The multifunctional embolic microspheres according to claim 1, characterized in that, The nucleic acid aptamers include EpCAM aptamers, GPC3 aptamers, or LY-1 aptamers; Preferably, the 5' end and 3' end of the nucleic acid aptamer are respectively connected to a first nucleic acid segment and a second nucleic acid segment; the bases of the first nucleic acid segment and the second nucleic acid segment are mainly composed of G and C, and the two bases are complementary to form a double strand; the proportion of G and C in the first nucleic acid segment and the second nucleic acid segment is more than 60%; Preferably, the 5' end of the nucleic acid aptamer or the 5' end of the first nucleic acid segment is sequentially modified with the disulfide bond and acrylamide or methacrylamide, wherein the acrylamide is chemically coupled to the carrier microspheres.

4. The method for preparing the multifunctional embolic microspheres according to claim 1, characterized in that, Includes the following steps: a. Prepare a first dispersed aqueous solution containing acrylamide, a crosslinking agent, a first initiator, and a nucleic acid aptamer; wherein the 5' and 3' ends of the nucleic acid aptamer are respectively connected to a first nucleic acid segment and a second nucleic acid segment; the bases of the first nucleic acid segment and the second nucleic acid segment are composed of G and C, and the two bases are complementary to form a double strand; the modification of the 5' end of the first nucleic acid segment includes disulfide bond and acrylamide in sequence; b. Prepare a second dispersed aqueous solution containing acrylamide, a crosslinking agent, a second initiator, and a tracer; c. A mixture of a first and a second dispersed phase aqueous solution was prepared using a microfluidic chip, and then cross-linked to obtain polyacrylamide hydrogel microspheres loaded with tracers and nucleic acid aptamers. d. The polyacrylamide hydrogel microspheres obtained in step c are dispersed in a solution of the therapeutic drug. After incubation, the therapeutic drug binds to the first and second nucleic acid segments of the aptamer to prepare multifunctional embolization microspheres.

5. The preparation method according to claim 4, characterized in that, The crosslinking agent includes N,N-bisacryloylcysteamine; The concentrations of the crosslinking agent in the first and second dispersed aqueous phases are each independently 0.5%-8%.

6. The preparation method according to claim 4, characterized in that, The first initiator comprises tetramethylethylenediamine; the concentration of the first initiator in the first dispersed aqueous phase is 0.5%-2%; The second initiator includes ammonium persulfate; the concentration of the second initiator in the second dispersed aqueous phase is 0.5%-2%.

7. The preparation method according to claim 4, characterized in that, In the first dispersed aqueous phase, the concentration of acrylamide is 6%-24%, and the concentration of nucleic acid aptamers is 0.625-625 μM; In the second dispersed aqueous phase, the concentration of acrylamide is 24%, and the tracer is AIE nanoparticles with a concentration of 0.5-5 mg / mL.

8. The preparation method according to claim 4, characterized in that, The concentration of the therapeutic drug is 0.25-250 μM; The incubation temperature is 35-39℃, and the incubation time is 0.5-2h.

9. The use of the multifunctional embolic microspheres according to any one of claims 1-3 in the preparation of tumor therapeutic drugs.

10. The application according to claim 9, characterized in that, The tumors include liver cancer.

Images