Tea-source saccharomycopsis degrading citrinin and application thereof
By screening grape juice containing Hansenula polysaccharide LWJJ03 and Rhodotorula glutinis LWJJ06 from Liubao tea, and optimizing their fermentation conditions for degrading citrinin, a highly efficient and safe yeast composition or microbial preparation was provided, solving the problem of citrinin pollution control and achieving highly efficient degradation of citrinin.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUILIN UNIVERSITY OF TECHNOLOGY
- Filing Date
- 2026-04-22
- Publication Date
- 2026-07-14
Smart Images

Figure CN122381935A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and in particular to tea-derived yeasts that degrade citrinin and their applications. Background Technology
[0002] Citrinin (CIT) is a secondary metabolite produced by certain strains of the Penicillium and Aspergillus genera, among which *Penicillium citrinin* (CIT) is the most abundant. Pencillium citrinium Citrinin (CIT) is a marker bacterium for citrinin production. Numerous studies have reported the negative effects of CIT. Products contaminated with CIT have been reported to have nephrotoxic, hepatotoxic, immunosuppressive, and carcinogenic effects on humans and animals.
[0003] During growth, harvesting, transportation, and storage, grain products, food, and livestock feed can all be contaminated by CIT-producing fungi. From health, environmental, and economic perspectives, there is an urgent need to develop methods to eliminate CIT contamination in food and feed. Biocontrol is considered a highly promising strategy for controlling pathogens and mycotoxins and has received widespread attention in recent years.
[0004] The unique quality of Liubao tea largely stems from its crucial pile fermentation process. Under specific conditions of 40-60℃ and approximately 25% moisture content, the tea leaves rely on the synergistic action of various microorganisms to create Liubao tea's distinctive red, rich, and mellow flavor. However, this warm and humid fermentation environment is also conducive to the growth of fungi such as Penicillium, which produce citrinin, posing a potential food safety risk. It is worth noting that the complex fermentation micro-ecosystem of Liubao tea is itself a vast treasure trove of microbial resources, potentially containing functional strains capable of degrading citrinin. Screening for probiotics that can degrade citrinin and controlling citrinin contamination at its source is a feasible biocontrol method. Currently, there are no reports of using yeasts screened from Liubao tea to degrade citrinin. Summary of the Invention
[0005] The purpose of this invention is to provide tea-derived yeast strains for degrading citrinin and their applications, thereby addressing the problems existing in the prior art. The grape juice strains provided by this invention, containing *Hansenula polymorpha* LWJJ03 and *Rhodotorula glutinis* LWJJ06, exhibit high citrinin degradation efficiency, few byproducts, simple steps, high safety, and are environmentally friendly and pollution-free. This invention provides new microbial strains for degrading citrinin, offering technical support for the removal of citrinin from food and possessing broad application prospects.
[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a strain of grape juice containing Hansenula polymorpha ( Hanseniaspora uvarumLWJJ03, the grape juice containing Hansenula polymorpha LWJJ03, was deposited on July 3, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.35098, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0007] This invention provides a strain of red yeast ( Rhodotorula mucilaginosa LWJJ06, the Rhodotorula glutinis LWJJ06, was deposited on July 3, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.35099, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0008] The present invention also provides a yeast composition for degrading citrinin, comprising the above-mentioned *Hansenula polysaccharide* LWJJ03 and the above-mentioned *Rhodotorula glutinis* LWJJ06.
[0009] The present invention also provides the use of the above-mentioned grape juice containing Hansenula polymorpha LWJJ03, the above-mentioned Rhodotorula glutinis LWJJ06, or the above-mentioned yeast composition in the preparation of a product that degrades citrinin.
[0010] Furthermore, the product is a microbial preparation.
[0011] The present invention also provides a microbial preparation for degrading citrinin, wherein the active ingredient of the microbial preparation comprises at least one of the following (1)-(4): (1) The grape juice mentioned above contains Hansenula polymorpha LWJJ03; (2) The grape juice contains fermentation broth of Hansenula polymorpha LWJJ03; (3) The above-mentioned Rhodotorula glutinis LWJJ06; (4) The fermentation broth of the red yeast LWJJ06.
[0012] Furthermore, it also includes excipients acceptable for the degradation of fungal toxins.
[0013] The present invention also provides the application of the above-mentioned grape juice containing Hansenula polymorpha LWJJ03, the above-mentioned Rhodotorula glutinis LWJJ06, the above-mentioned yeast composition or the above-mentioned microbial preparation in the degradation of citrinin.
[0014] The present invention also provides a method for degrading citrinin, comprising the following steps: The sample containing citrinin was treated with the above-mentioned grape juice containing Hansenula polymorpha LWJJ03, the above-mentioned Rhodotorula glutinis LWJJ06, the above-mentioned yeast composition, or the above-mentioned microbial preparation.
[0015] Furthermore, the sample is food, medicine, or feed.
[0016] The present invention discloses the following technical effects: This invention isolated two tea-derived yeast strains from Liubao tea: *Hansenula polymorpha* LWJJ03 (CGMCC NO.35098) and *Rhodotorula glutinis* LWJJ06 (CGMCC NO.35099). Experimental results show that under optimal conditions, *Hansenula polymorpha* LWJJ03 can degrade 100 μg / mL of citrinin by up to 96% within 72 h, while *Rhodotorula glutinis* LWJJ06 can completely degrade 250 μg / mL of citrinin within 36 h. These strains exhibit high degradation efficiency, few byproducts, simple steps, high safety, and are environmentally friendly and pollution-free. This invention provides new microbial strains for the degradation of citrinin, offering technical support for the removal of citrinin from food and possessing broad application prospects. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 The results of colony morphology (A), methylene blue staining microscopy (B), and SEM scanning electron microscopy (C) of Hansenula polymorpha spores LWJJ03 in grape juice; Figure 2 The results of colony morphology (A), methylene blue staining microscopy (B), and scanning electron microscopy (C) of Rhodotorula glutinis LWJJ06 are shown. Figure 3 Phylogenetic tree diagram of LWJJ03; Figure 4 Phylogenetic tree diagram of Rhodotorula glutinis LWJJ06; Figure 5 Figure 1 shows the experimental results of the effect of fermentation temperature on the degradation of citrinin by *Hansenula polymorpha* LWJJ03 in grape juice. Figure 6 Figure showing the experimental results of how inoculum size affects the degradation of citrinin by *Hansenula polymorpha* LWJJ03 in grape juice; Figure 7 Figure 1 shows the experimental results of the effect of initial pH on the degradation of citrinin by *Hansenula polymorpha* LWJJ03 in grape juice. Figure 8 Figure 1 shows the experimental results of substrate concentration affecting the degradation of citrinin by *Hansenula polymorpha* LWJJ03 in grape juice. Figure 9 Figure showing the experimental results of how fermentation temperature affects the degradation of citrinin by Rhodotorula glutinis LWJJ06; Figure 10 Figure showing the experimental results of how inoculum size affects the degradation of citrinin by Rhodotorula glutinis LWJJ06; Figure 11 Figure 1 shows the experimental results of how initial pH affects the degradation of citrinin by Rhodotorula glutinis LWJJ06. Figure 12 The figure shows the experimental results of how substrate concentration affects the degradation of citrinin by Rhodotorula glutinis LWJJ06. Detailed Implementation
[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.
[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0024] The method for preparing the citrinin culture medium of the present invention is as follows: Weigh 2.6g of potato glucose liquid (PDB) culture medium, dissolve it in 100 mL of deionized water, autoclave, add citrinin after sterilization, so that the final concentration of citrinin in the culture medium is 10 μg / mL, and set aside for later use.
[0025] The method for detecting citrinin content in this invention is high-performance liquid chromatography (HPLC), and the specific operating steps are as follows: (1) Sample pretreatment method Citrusin is readily soluble in organic solvents. After mixing the prepared sample with acetonitrile (chromatographic grade) at a 1:1 ratio, centrifuge at 8000 rpm for 6 min, take the supernatant and filter it through a 0.22 µm filter membrane, and place it in a sample vial for testing.
[0026] (2) Liquid phase detection conditions The mobile phase consisted of acetonitrile and 1% acetic acid solution in a volume ratio of 8:2, with isocratic elution. A fluorescence detector was used, with an excitation wavelength of 331 nm and an emission wavelength of 500 nm. (C) 18 The chromatographic column was used with an injection volume of 10 µL and a detection time of 15 min. Before the sample was analyzed, the mobile phase was filtered through a membrane and sonicated for 15 min.
[0027] Example 1: Isolation of Saccharomyces citrinum-degrading yeast 1. Initial screening of yeasts that degrade citrinin The Liubao tea fermentation sample was soaked in sterilized deionized water and shaken on a shaker for 30 minutes. 1 mL of the shaken Liubao tea extract was inoculated into citrinin medium and placed in a constant temperature shaking incubator at 28℃ for enrichment culture for 2 days.
[0028] Weigh 9.5 g of yeast chromogenic medium, add 200 mL of distilled water, heat to dissolve while stirring constantly, boil for 1 min, cool in a water bath to 45-50℃, and pour into plates for later use.
[0029] One mL of bacterial culture was taken from the Liubao tea enrichment solution after two days of enrichment culture and serially diluted to obtain a final dilution factor of 10. 4 10 5 10 6 Gradient bacterial suspensions. Take 200 μL of bacterial suspensions of different concentrations and add them dropwise to the surface of yeast chromogenic medium. Spread the bacterial suspensions evenly using a spreader. Invert the spread petri dishes and incubate at 28°C.
[0030] From the single colonies obtained by plate culture, single colonies suspected to be yeast were selected, numbered, purified by streaking on potato agar medium, and incubated upside down in an incubator to obtain citrinin-degrading bacteria.
[0031] 2. Secondary screening of yeasts that degrade citrinin To further verify the degradation effect of the degrading bacteria obtained from the initial screening, the strains purified by streak plating were re-screened in shake flasks using citrinin medium. The specific operation steps are as follows.
[0032] Using an inoculation needle, numbered and purified bacterial strains were picked and inoculated into citrinin-containing medium and potato dextrose liquid medium without citrinin, respectively. The media were incubated in shake flasks at 28°C. On days 1, 2, 3, and 4 after incubation, 1 mL of culture was collected, refrigerated, and the changes in citrinin content were measured. The two strains with the most significant decrease in citrinin content were screened and named LWJJ03 and LWJJ06, respectively, and further purified and identified.
[0033] Example 2 Identification of Saccharomyces citrinum-degrading yeast 1. Morphological identification Visually observe the colony morphology of strains LWJJ03 and LWJJ06 on the culture medium; Methylene blue staining was performed on bacterial suspensions of strains LWJJ03 and LWJJ06, and the cell morphology of strains LWJJ03 and LWJJ06 was observed under an optical microscope. Strains LWJJ03 and LWJJ06 were fixed with 2.5% glutaraldehyde solution at 4℃ for 2-4 h. The cells were then washed with phosphate buffer and dehydrated in a gradient manner with ethanol solutions of different concentrations to ensure that the water was completely replaced by the organic solvent. The dehydrated cells were freeze-dried to obtain bacterial sample powder, and finally sputter-coated with gold. The morphology of strains LWJJ03 and LWJJ06 was observed under a scanning electron microscope.
[0034] The morphological identification results of strain LWJJ03 are as follows: Figure 1 As shown, the morphological identification results of strain LWJJ06 are as follows: Figure 2 As shown.
[0035] 2. Molecular identification Strains LWJJ03 and LWJJ06 were sent to Shenzhen MicroMed Technology Group Co., Ltd. for purification and sequencing analysis. The sequencing results of strain LWJJ03 are shown in SEQ ID NO.1, and the sequencing results of strain LWJJ06 are shown in SEQ ID NO.2. The results were logged into the NCBI website (http: / / blast.ncbi.nlm.nih.gov / ) for DNA BLAST alignment, and a phylogenetic tree was constructed using MEGA 5.0 software.
[0036] SEQ ID NO.1: TCCTTAATGCCTATCCTTGCCGAAGCGCAGTCCTCAATCCCGGCTAACAGTATTCCAAAAAGCTATAACACTACCGAAGTAGCTACATTCTTAATGATTTATCCTGCTGCCAAAATTGATGTTGGCCCAGTGAAATTTTTGAGAGGCCCAAGCCCACGAGAGGCGAGTGCATGCAAAAAACACCATGTCTGATCAAATGCCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCATCACTGTACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCCACTTTGAGCTGCATTCCCAAACAACTCGACTCTTCGAAAAAGTCTTACAGAGAAAAGGTATCCTCGCCAAACGGGATTCTCACCCTCTATGACGTCCTGTTCCAAGGAACATAGACAAGGACCTAATCAAAGACAAATTCTACAAATTACAACTCGGGCACTGAAAGTACCAGATTTCAAATTTGAGCTTTTACCGCTTCACTCGCCGTTACTAAGGTAATCCCAGTTGGTTTCTTTTCCTCCGCTACCCGGAAATTGAAAAATAAA。
[0037] SEQ ID NO.2: .
[0038] like Figure 3 As shown, based on the phylogenetic tree results, strain LWJJ03 was identified as *Hansenula polymorpha* from grape juice. Hanseniaspora uvarum ), and named it *Hansenula polymorpha* (grape juice spores). Hanseniaspora uvarum LWJJ03 was deposited on July 3, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.35098. The deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.
[0039] like Figure 4 As shown, based on the phylogenetic tree results, strain LWJJ06 was identified as Rhodotorula glutinis (…). Rhodotorula mucilaginosa ), and named it Red Yeast ( Rhodotorula mucilaginosa LWJJ06 was deposited on July 3, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCCNO.35099. The deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.
[0040] Example 3: Optimization of fermentation process for degradation of citrinin by *Hansenula polymorpha* LWJJ03 in grape juice 1. Initial system for the degradation of citrinin by *Hansenula polymorpha* LWJJ03 in grape juice The initial degradation system consisted of a 50 mL Erlenmeyer flask, 20 mL of citrinin culture medium, an initial citrinin concentration of 100 µg / mL, a natural initial pH, and an inoculum of 2 mL of LWJJ03 bacterial suspension (1×10⁻⁶). 9 The cells / mL were cultured at 28℃ in a constant temperature shaker at 180 rpm.
[0041] Based on this, the degradation conditions were optimized to achieve the best degradation effect.
[0042] 2. Effects of different temperature conditions on the degradation of citrinin by *Hansenula polymorpha* LWJJ03 in grape juice. Prepare three sets of 20 mL citrinin culture medium (citrinin concentration of 100 µg / mL), and add 2 mL of 1×10⁻⁶ citrinin-containing medium. 9 A suspension of *Hansenula polymorpha* LWJJ03 cells / mL was inoculated into the culture medium and cultured for 4 days at 20℃, 24℃, 28℃, 32℃, and 37℃ using a shaker at 180 rpm. 500 µL samples were taken at 0, 1, 2, and 3 days to determine the citrinin content in each sample.
[0043] Each experiment was performed in triplicate, and the entire experiment was repeated twice.
[0044] 3. Effects of different inoculum sizes on the degradation of citrinin by *Hansenula polymorpha* LWJJ03 in grape juice. Based on the optimized temperature (28℃), the effect of inoculum size on the degradation of citrinin by LWJJ03 was investigated.
[0045] Prepare three sets of 20 mL citrinin culture media (citrinin concentration of 100 µg / mL), and inoculate 2 mL of each medium with a concentration of 1×10⁻⁶. 9 1×10 8 1×10 7 1×10 6 1×10 5 A suspension of Saccharomyces hansenulatus LWJJ03 was prepared from grape juice and cultured in a constant temperature shaker at 28℃ and 180rpm for 4 days. Samples of 500 µL were taken at 0, 1, 2 and 3 days, and the content of citrinin in each sample was detected.
[0046] Each experiment was performed in triplicate, and the entire experiment was repeated twice.
[0047] 4. Effects of different pH conditions on the degradation of citrinin by *Hansenula polymorpha* LWJJ03 in grape juice. After optimization, the inoculum size (2 mL at a concentration of 1×10⁻⁶) was used. 9 Based on the results of using a suspension of *Hansenula polymorpha* LWJJ03 in grape juice (cells / mL) and an optimized temperature (28℃), this study investigated the effects of different pH conditions on the degradation of citrinin by *Hansenula polymorpha* LWJJ03 in grape juice.
[0048] Three 20 mL potato syrup culture media were prepared. The pH of the culture media was adjusted to 4.0, 5.0, 6.0, 7.0, and 8.0 using NaOH solution and HCl, respectively. Citrulline was added to a final concentration of 100 µg / mL. The optimal inoculum size of *Hansenula polymorpha* LWJJ03 suspension was added, and the media were then placed in a shaker at the optimal degradation temperature and cultured at 180 rpm for 4 days. 500 µL samples were taken on days 0, 1, 2, and 3, and the citrulline content in each sample was determined.
[0049] Each experiment was performed in triplicate, and the entire experiment was repeated twice.
[0050] 5. Effects of different substrate concentrations on the degradation of citrinin by *Hansenula polymorpha* LWJJ03 in grape juice. After optimization, the inoculum size (2 mL at a concentration of 1×10⁻⁶) was used. 9 Based on the optimized conditions of grape juice containing *Hansenula polymorpha* LWJJ03 suspension (cells / mL), temperature (28℃), and pH (4.0), the effects of different substrate concentrations on the degradation of citrinin by *Hansenula polymorpha* LWJJ03 in grape juice were investigated.
[0051] Three 20 mL potato syrup culture media were prepared. The pH of the culture medium was adjusted to 4.0 using NaOH solution and HCl. Citrulline was added to final concentrations of 50 µg / mL, 100 µg / mL, 150 µg / mL, 200 µg / mL, and 250 µg / mL, respectively. The optimal inoculum size of *Hansenula polymorpha* LWJJ03 suspension was added, and the media were then placed in a shaker at the optimal degradation temperature and cultured at 180 rpm for 4 days. 500 µL samples were taken on days 0, 1, 2, and 3, and the citrulline content in each sample was determined.
[0052] Each experiment was performed in triplicate, and the entire experiment was repeated twice.
[0053] 6. Experimental Results This embodiment uses single-factor experiments to investigate the effects of different fermentation conditions on the degradation efficiency of citrinin, and finally obtains the optimal degradation conditions for citrinin degradation by the grape juice Hansenula polymorpha strain LWJJ03.
[0054] like Figures 5-8 As shown in the results, the optimal culture conditions for the degradation of citrinin by *Hansenula polymorpha* LWJJ03 in grape juice were: temperature 28℃, pH 4.0, and final cell concentration of 1×10⁻⁶. 8 The concentration of citrinin was 100 µg / mL.
[0055] Under these conditions, *Hansenula polymorpha* LWJJ03 in grape juice achieved a degradation rate of 96% for 100 µg / mL citrinin within 72 h, demonstrating its effectiveness in degrading citrinin.
[0056] Example 4: Optimization of fermentation process for degradation of citrinin by Rhodotorula glutinis LWJJ06 1. Initial system for the degradation of citrinin by Rhodotorula glutinis LWJJ06 The initial degradation system consisted of a 50 mL Erlenmeyer flask containing 20 mL of citrinin culture medium, with an initial citrinin concentration of 10 µg / mL, a natural initial pH, and 1 mL of Rhodotorula glutinis LWJJ06 bacterial suspension (1×10⁻⁶). 8 The cells / mL were cultured at 28℃ in a constant temperature shaker at 180 rpm, and the degradation rate reached over 90% after 48 h.
[0057] Based on this, the degradation conditions were optimized to achieve the best degradation effect.
[0058] 2. Effects of different temperature conditions on the degradation of citrinin by Rhodotorula glutinis LWJJ06 Prepare three sets of 20 mL citrinin culture media, and add 1 mL of 1×10⁻⁶ citrinin-containing culture medium. 8 A suspension of Rhodotorula glutinis LWJJ06 cells / mL was inoculated into the culture medium and cultured for 4 days at 20℃, 28℃, and 37℃ with a shaker at 180 rpm. Samples of 500 µL were taken on days 0, 1, 2, 3, and 4, and the citrinin content in each sample was determined. Each experiment was performed in triplicate, and the entire experiment was repeated twice.
[0059] 3. Effects of different inoculum sizes on the degradation of citrinin by Rhodotorula glutinis LWJJ06 Based on the optimized temperature (28℃), the effect of inoculum size on the degradation of citrinin by Rhodotorula glutinis LWJJ06 was investigated.
[0060] Prepare three sets of 20 mL citrinin culture media, and inoculate 1 mL of each medium with a concentration of 1×10⁻⁶.8 1×10 7 1×10 6 A suspension of Rhodotorula glutinis LWJJ06 cells / mL was cultured at 28℃ and 180 rpm for 4 days. 500 µL samples were taken on days 0, 1, 2, 3 and 4, and the content of citrinin in each sample was detected.
[0061] Each experiment was performed in triplicate, and the entire experiment was repeated twice.
[0062] 4. Effects of different pH conditions on the degradation of citrinin by Rhodotorula glutinis LWJJ06 After optimization, the inoculation rate (1×10) 7 Based on the optimized temperature (28℃) and the cell / mL ratio, the effects of different pH conditions on the degradation of citrinin by Rhodotorula glutinis LWJJ06 were investigated.
[0063] Three 20 mL potato syrup culture media were prepared. The pH of the media was adjusted to 4.0, 6.0, and 8.0 using NaOH solution and HCl, respectively. Citrusin was added to a final concentration of 10 µg / mL. The optimal inoculum size of Rhodotorula glutinis LWJJ06 suspension was then added, and the media were incubated in a shaker at 180 rpm for 4 days at the optimal degradation temperature. 500 µL samples were taken on days 0, 1, 2, 3, and 4, and the citrusin content in each sample was determined.
[0064] Each experiment was performed in triplicate, and the entire experiment was repeated twice.
[0065] 5. Effects of different substrate concentrations on the degradation of citrinin by Rhodotorula glutinis LWJJ06 After optimization, the inoculation rate (1×10) 7 Based on the optimized values of cells / mL, pH (pH 4.0), and temperature (28℃), the effects of different substrate concentrations on the degradation of citrinin by Rhodotorula glutinis LWJJ06 were investigated.
[0066] Five 20 mL potato syrup culture media were prepared, and the pH was adjusted to 4.0. Citrusin was added to achieve final concentrations of 50 µg / mL, 100 µg / mL, 150 µg / mL, 200 µg / mL, and 250 µg / mL, respectively. The media were then inoculated with Rhodotorula glutinis suspension at the optimal inoculum size and incubated at 180 rpm for 4 days in a shaker at the optimal degradation temperature. 500 µL samples were taken on days 0, 1, 2, 3, and 4, and the citrusin content in each sample was determined.
[0067] Each experiment was performed in triplicate, and the entire experiment was repeated twice.
[0068] 6. Experimental Results This embodiment uses single-factor experiments to investigate the effects of different fermentation conditions on the degradation efficiency of citrinin by Rhodotorula glutinis LWJJ06, and finally obtains the optimal degradation conditions for citrinin degradation by Rhodotorula glutinis LWJJ06.
[0069] like Figures 9-12 As shown in the results, the optimal culture conditions for Rhodotorula glutinis LWJJ06 to degrade citrinin were: temperature 28℃, pH 4.0, and inoculum size 1×10⁻⁶. 7 Under these conditions, Rhodotorula glutinis LWJJ06 can completely degrade citrinin at concentrations up to 250 µg / mL, demonstrating its high degradation potential.
[0070] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A grape vine's juice contained Hansenula polymorpha ( Hanseniaspora uvarum LWJJ03, characterized in that, The grape juice containing Hansenula polymorpha LWJJ03 was deposited on July 3, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.35098, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
2. A strain of red yeast ( Rhodotorula mucilaginosa LWJJ06, characterized in that, The Rhodotorula glutinis LWJJ06 was deposited on July 3, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.35099, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
3. A yeast composition for degrading citrinin, characterized in that, It includes the grape juice containing Hansenula polysaccharide LWJJ03 as described in claim 1 and the red yeast rice LWJJ06 as described in claim 2.
4. The use of a grape juice containing Hansenula polysaccharide LWJJ03 as described in claim 1, Rhodotorula glutinis LWJJ06 as described in claim 2, or a yeast composition as described in claim 3 in the preparation of a product that degrades citrinin.
5. The application as described in claim 4, characterized in that, The product is a microbial preparation.
6. A microbial preparation for degrading citrinin, characterized in that, The active ingredient of the microbial preparation includes at least one of the following (1)-(4): (1) The grape juice according to claim 1 contains Hansenula polymorpha LWJJ03; (2) The grape juice contains fermentation broth of Hansenula polymorpha LWJJ03; (3) The Rhodotorula glutinis LWJJ06 as described in claim 2; (4) The fermentation broth of the red yeast LWJJ06.
7. The microbial preparation according to claim 6, characterized in that, It also includes excipients acceptable for the degradation of fungal toxins.
8. The use of the grape juice containing Hansenula polymorpha LWJJ03 as described in claim 1, Rhodotorula glutinis LWJJ06 as described in claim 2, the yeast composition as described in claim 3, or the microbial preparation as described in claim 6 or 7 in the degradation of citrinin.
9. A method for degrading citrinin, characterized in that, Includes the following steps: Samples containing citrinin were treated with grape juice according to claim 1 containing Hansenula polymorpha LWJJ03, Rhodotorula glutinis LWJJ06 according to claim 2, the yeast composition according to claim 3, or the microbial preparation according to claim 6 or 7.
10. The method as described in claim 9, characterized in that, The samples are food, medicine, or feed.