Clostridium permanent fixed carbon gas and its application in producing alcohol and bacterial protein

Abstract

This invention relates to a Clostridium yongdarii strain that fixes one-carbon gas and its application in the production of alcohols and bacterial proteins, belonging to the field of industrial microbial synthesis technology. The Clostridium yongdarii strain is named Clostridium yongdarii GG8 and classified as follows: Clostridium ljungdahlii This strain, deposited at the China General Microbiological Culture Collection Center, was obtained from the wild-type strain *Clostridium yongdarii* DSM13528 through adaptive laboratory evolution and sorting. Compared with the wild-type strain, *Clostridium yongdarii* GG8 enhances the ability to produce ethanol and cell protein using carbon-1 gas as a carbon source. In batch fermentation, *Clostridium yongdarii* GG8 can accumulate cell biomass OD600 ≥ 20, ethanol concentration ≥ 50 g / L, and acetic acid concentration ≥ 5 g / L. In single-tank continuous fermentation, GG8 can maintain stable fermentation for more than 5 months, with an ethanol production intensity exceeding 2 g / L / h, which helps improve the economics of gas fermentation.

Description

Technical Field

[0001] This invention belongs to the field of industrial microbial synthesis technology, specifically relating to a Clostridium yongdarii strain that fixes one-carbon gas and its application in the production of alcohols and bacterial proteins. Background Technology

[0002] Biosynthesis is a green process for producing bulk products. Compared to chemical synthesis, it offers milder and more controllable reaction conditions with fewer byproducts, demonstrating unique advantages in the utilization of carbon-1 gases. Carbon-1 gases such as carbon dioxide and carbon monoxide can be directly converted into carbon-containing organic matter by carbon-fixing microorganisms through their life activities, generating economic benefits by transforming them into high-value chemicals. Clostridium aerogenes, a group of strictly anaerobic Gram-positive bacteria, can reduce carbon-1 gases (CO / CO2) to acetyl-CoA via the Wood-Ljungdahl carbon fixation pathway, achieving carbon absorption and fixation. Subsequently, various products are synthesized through different metabolic pathways, such as acetic acid, ethanol, butyric acid, butanol, and hexanol. Clostridium aerogenes possesses a complete carbon fixation pathway and a diverse product spectrum, making it one of the most promising microbial groups for industrial applications. Currently reported promising aerobic Clostridium species include *Clostridium ljungdahli*, *Clostridium autoethanoqenum*, and *Clostridium carboxidivorans*. *Clostridium ljungdahli* has the ability to produce ethanol through fermentation using carbon-1 gas; however, this strain suffers from slow cell growth, low biomass accumulation, low ethanol yield and production intensity, and poor stability during continuous fermentation. These issues result in low economic viability for large-scale industrial applications, making it difficult to meet actual production demands.

[0003] This invention obtains evolved strains with higher C1 gas conversion efficiency, higher ethanol yield and production intensity, and better fermentation stability through screening. This is of great significance for improving the economics of gas fermentation and promoting the industrial conversion and utilization of C1 gas. Summary of the Invention

[0004] Technical problems solved: In view of the shortcomings of existing aerobic Clostridium (especially Clostridium yundal) in industrial applications, such as low biomass, insufficient product concentration and production intensity, and poor long-term stability, this invention proposes a Clostridium yundal strain that fixes one-carbon gas and its application in the production of alcohol and microbial protein. This strain can use one-carbon gas as a carbon source, adapt to different proportions of CO gas source, and has a high capacity for producing ethanol and microbial protein under growth conditions without organic nitrogen sources such as yeast powder. At the same time, it can achieve continuous fermentation in a single tank for more than 5 months without performance degradation.

[0005] Technical solution: The first objective of this invention is to provide a Clostridium ljungdahlii GG8 strain that fixes one carbon gas, with accession number CGMCC No. 37895.

[0006] Instructions for the preservation of biological materials:

[0007] The Clostridium ljungdahlii GG8 strain provided by this invention is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences; accession number: CGMCC No. 37895; deposit date: March 11, 2026.

[0008] Preferably, the nucleotide sequence of the 16S rDNA of Clostridium yongdarii GG8 with fixed carbon gas is shown in SEQ ID No. 1.

[0009] Preferably, the Clostridium yongdarii GG8 can grow and ferment using a carbon gas as the sole carbon source, wherein the carbon gas is at least one of CO and CO2.

[0010] The second objective of this invention is to provide a microbial inoculant containing the aforementioned Clostridium yongdarii GG8.

[0011] A third objective of this invention is to provide the application of the above-mentioned Clostridium yunnanense GG8, which fixes one carbon gas, or the above-mentioned microbial inoculum, in the gaseous fermentation production of alcohols and / or microbial proteins.

[0012] Preferably, the alcohol is ethanol.

[0013] The fourth objective of this invention is to provide a method for producing alcohols and / or bacterial proteins, wherein the above-mentioned Clostridium yongdarii GG8 with fixed carbon gas or the above-mentioned microbial agent is inoculated into a fermentation medium containing a carbon source for anaerobic fermentation culture, and the alcohols and / or bacterial proteins produced by fermentation are collected, wherein the carbon source is at least one of CO and CO2.

[0014] Preferably, the carbon source is CO and CO2.

[0015] Preferably, the volume ratio of CO to CO2 is 20-92:0-40.

[0016] Preferably, the fermentation is continuous, with a stable fermentation time of more than 150 days and an ethanol production intensity of more than 2 g / L / h.

[0017] Beneficial effects: Compared with wild-type strains, the Clostridium yongdarii GG8 strain provided by this invention improves the ability to produce ethanol and cell protein using carbon-1 gas as a carbon source, simplifies the culture medium composition, significantly reduces raw material costs, and helps to improve the economics of gas fermentation.

[0018] Experiments have shown that, during batch fermentation, the Clostridium yongdarii GG8 strain provided by this invention can accumulate a cell biomass OD600 ≥ 20, an ethanol concentration ≥ 53 g / L, and an acetic acid concentration ≥ 5 g / L, which are significantly higher than those of wild-type Clostridium yongdarii.

[0019] During single-tank continuous fermentation, the Clostridium yongdarii GG8 provided by this invention can maintain stable fermentation for more than 5 months, with an ethanol production intensity exceeding 2 g / L / h. Attached Figure Description

[0020] Figure 1 The image shows the microscopic morphology of Clostridium yongdarii GG8 in Example 2 of this invention;

[0021] Figure 2 The figure shows the curves of biomass (OD600) of Clostridium yongdarii GG8 and the original Clostridium yongdarii during gas fermentation in a fermenter over time in Example 3 of the present invention.

[0022] Figure 3 The figure shows the curve of the product of gas fermentation of Clostridium yongdarii GG8 in a fermenter over time in Example 3 of the present invention.

[0023] Figure 4 The figure shows the curve of the product of gas fermentation of wild Yongdar strain in a fermenter over time in Example 3 of the present invention.

[0024] Figure 5 The figure shows the curves of biomass (OD600) and product changes over time in batch gas fermentation of Clostridium yongdarii GG8 in a fermenter in Example 4 of the present invention.

[0025] Figure 6 The figure shows the curve of biomass (OD600) product of Clostridium yongdarii GG8 in a fermenter during continuous gas fermentation over time in Example 5 of the present invention.

[0026] Figure 7 The figure shows the curve of biomass (OD600) product of wild Yongda in a fermenter during continuous gas fermentation in a fermenter as a function of time in Comparative Example 1 of this invention.

[0027] Figure 8 The figure shows the curves of biomass (OD600) products of Clostridium yongdarii GG8 in continuous gas fermentation of the present invention over time with different proportions of carbon source. Detailed Implementation

[0028] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.

[0029] Unless otherwise specified, the technical means used in the following embodiments are all conventional means well known to those skilled in the art, and the experimental methods without specific conditions are all conventional methods in the art.

[0030] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0031] ATCC 1754 medium: ammonium chloride 1 g / L, potassium chloride 0.1 g / L, magnesium sulfate heptahydrate 0.2 g / L, sodium chloride 0.8 g / L, potassium dihydrogen phosphate 0.1 g / L, calcium chloride dihydrate 0.04 g / L, cysteine ​​0.5 g / L, trace metals 2 mL / L, vitamin stock solution 1 mL / L. Adjust pH to 6.0 with NaOH solution, sterilize at 121℃ for 20 min.

[0032] YTF medium: yeast extract 10 g / L, peptone 16 g / L, fructose 10 g / L, cysteine ​​0.5 g / L, sodium chloride 4 g / L, trace metals 2 mL / L, vitamin stock solution 1 mL / L, pH adjusted to 6.0. YTF solid medium supplemented with 1.5 wt% agar.

[0033] Trace element stock solution: 10 g / L nitric acid triacetic acid, 0.5 g / L cobalt chloride hexahydrate, 2 g / L manganese sulfate, 0.1 g / L nickel chloride hexahydrate, 0.2 g / L ferric sulfate, 0.1 g / L sodium selenite, 1 g / L zinc sulfate, 0.1 g / L copper chloride, 0.1 g / L sodium molybdate, and 0.1 g / L sodium tungstate.

[0034] Vitamin stock solution: Calcium pantothenate 50 mg / L, lipoic acid 50 mg / L, vitamin B6 100 mg / L, thiamine 50 mg / L, vitamin B2 50 mg / L, biotin 20 mg / L, folic acid 20 mg / L, para-aminobenzoic acid 50 mg / L, nicotinic acid 50 mg / L, vitamin B12 50 mg / L.

[0035] Example 1: Domestication and isolation of Clostridium yongdarii GG8

[0036] Adaptive laboratory evolution (ALE) yielded Clostridium yongdarella GG8:

[0037] Clostridium yongdarii DSM13528 (purchased from the German Microbial Culture Collection (DSMZ) website) was activated using YTF and 1.5 mL was transferred to a 125 mL serum bottle containing 30 mL of ATCC175 medium with 0.5 g / L yeast extract. The serum bottle was filled with 1 bar of syngas (syngas composition 30% CO, 5% CO2, 65% H2, % are volume fractions) and incubated on a shaker at 37°C and 100 rpm for 48 h. The culture was then transferred once more to the same medium, followed by transfers to ATCC 1754 medium containing 0.3 g / L, 0.1 g / L, 0.05 g / L, 0.02 g / L, 0.01 g / L, and 0 g / L yeast extract, with each transfer performed twice, until stable growth was achieved in ATCC 1754 medium. The syngas composition was then changed to 60% CO, 10% CO2, and 30% H2 (% by volume), while other conditions remained constant. The culture was cultured for three generations to obtain the final culture. The culture was then diluted 10... -5 The culture was spread onto YTF medium solid plates and anaerobic incubated at 37°C for 3-5 days. Single colonies were picked and purified by streak plating in four zones. This process was repeated 3 times to obtain a pure culture strain, which was named Clostridium yongdarii GG8.

[0038] Example 2: Identification of Clostridium yongdarii GG8

[0039] (1) Morphological identification

[0040] Microscopic observation revealed that the Clostridium yongdarii GG8 cells in Example 1 were rod-shaped, Gram-positive, 0.6-0.8 μm × 2.2-8.1 μm, and arranged singly or in pairs. The microscopic morphology of Clostridium yongdarii GG8 is shown in [Figure number missing]. Figure 1 .

[0041] (2) 16S rDNA identification

[0042] Clostridium yongdar GG8 was inoculated into YTF medium and anaerobic cultured at 37℃ for 24 h. After centrifugation at 8000 rpm for 5 min, 1 mL of culture was collected, and the genome of Clostridium yongdar GG8 was extracted using a bacterial genome extraction kit (Sangon Biotech B610423).

[0043] The 16S rDNA of Clostridium yongdarii GG8 was amplified using primers 27F and 1492R. The sequences of primers 27F and 1492R are as follows:

[0044] Primer 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID No. 2);

[0045] Primer 1492R: GGTTACCTTGTTACGACTT (SEQ ID No. 3).

[0046] PCR amplification system (total 50 μL): 25 μL 2×PCR premix, 1 μL primer 27F (10 μmol / L), 1 μL primer 1492R (10 μmol / L), 2 μL bacterial genomic DNA, and pure water to 50 μL.

[0047] Amplification program: 94℃ pre-denaturation for 5 min, 98℃ denaturation for 10 s, 55℃ annealing for 45 s, 72℃ extension for 1.5 min, for a total of 30 cycles; 72℃ extension for 10 min; 4℃ to terminate the reaction.

[0048] 16S rDNA sequencing: The PCR products were detected by gel electrophoresis and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The 16S rDNA sequence of Clostridium yongdarii GG8 was obtained as shown in SEQ ID No. 1.

[0049] The 16S rDNA sequence of Clostridium yongdarii GG8 (SEQ ID No. 1):

[0050]

[0051] Example 3: Advantages of Clostridium yongdarii GG8 and wild strains in gas fermentation

[0052] Batch fermentation: Clostridium yongdar GG8 and the original control strain (wild-type Clostridium yongdar DSM13528, WT) were inoculated into YTF medium test tubes and cultured anaerobically at 37°C until the logarithmic growth phase. Then, they were transferred to serum bottles (Clostridium yongdar GG8 in the serum bottles was cultured on ATCC 1754 medium, and the wild-type Clostridium yongdar strain was cultured on ATCC 1754 medium with 0.5 g / L yeast extract). The serum bottles were filled with 1 bar of syngas (30% CO, 5% CO2, 65% H2, % are volume fractions) and cultured until the logarithmic growth phase. Then, they were transferred to 3 L stirred fermenters. A 3 L fermenter was filled with 2 L of ATCC 1754 medium. The fermentation was carried out at 100 rpm. Approximately 1 g / L of acetic acid was added beforehand to ensure sufficient substrate. The pH was adjusted to 5.5 with ammonia. N2 was purged beforehand to remove oxygen. The fermenter was inoculated at a rate of 5% (v / v). After inoculation, syngas (30% CO, 5% CO2, 65% H2, % is volume fraction) was continuously purged during fermentation. The aeration rate was 30 mL / min for the first 24 h, and then gradually increased to 120 mL / min. The mixture was stirred at 400 rpm and kept stable. Biomass and products were sampled periodically until they no longer changed. The pH was adjusted to 5.0 ± 0.1 with ammonia during fermentation.

[0053] Product detection: After centrifugation at 12,000 rpm, the supernatant was filtered through a 0.22 μm membrane and then analyzed by HPLC (Agilent 1260). The chromatographic column was Bio-Rad HPX-87H (300 × 7.8 mm, 9 μm), the mobile phase was 5 mM sulfuric acid aqueous solution, the flow rate was 0.9 mL / min, the column temperature was 30℃, the differential detector temperature was 45℃, and the injection volume was 10 μL.

[0054] The results are as follows Figure 2 As shown, during batch fermentation, compared with WT Clostridium yongdarense, Clostridium yongdarense GG8 exhibited a significant advantage in growth rate and biomass. The OD600 of Clostridium yongdarense GG8 ultimately reached approximately 6.5, while the OD600 of WT Clostridium yongdarense ultimately reached 2. The biomass of Clostridium yongdarense GG8 was 3.2 times that of the original strain.

[0055] In terms of metabolic processes, *Clostridium yongdarii* GG8 also showed significant advantages. The final product concentrations of *Clostridium yongdarii* GG8 were 13 g / L for ethanol and 5 g / L for acetic acid (e.g.,...). Figure 3 As shown); the final product of the laboratory control strain, the original Yongdar strain, had an ethanol concentration of 4 g / L and an acetic acid concentration of 5.8 g / L (as shown). Figure 4 (As shown). The ethanol production of Clostridium yongdarii GG8 was 3.25 times that of the original strain.

[0056] The above experimental results show that Clostridium yongdarii GG8 has a much higher growth rate and ethanol yield than wild Clostridium yongdarii strain in fermentation production.

[0057] Example 4: Application of Clostridium yongdarii GG8 in gaseous fermentation

[0058] Clostridium yongdarii GG8 was inoculated into YTF medium test tubes and cultured anaerobicly at 37℃ until it reached the logarithmic growth phase. Then, it was transferred to serum bottles containing ATCC 1754 medium without yeast extract. The serum bottles were filled with 1 bar of syngas (60% CO, 10% CO2, 30% H2, % by volume) and cultured until the logarithmic growth phase. After reaching the logarithmic growth phase, the culture was transferred to 20 L stirred fermenters containing 10 L of ATCC 1754 medium, pre-added with approximately 1 g / L acetic acid, and the pH adjusted to 5.5 with ammonia. N2 was pre-purged for deoxygenation. Inoculation was performed at a rate of 5% (v / v). During fermentation, syngas (60% CO, 10% CO2, 30% H2, % by volume) was continuously purged at 100 rpm. For the first 12 hours, the aeration rate was 50 mL / min, gradually increasing to 25 mL / time, then increasing to 800 mL / min and maintaining a stable rate. The fermentation speed was then reduced to 600 rpm. The fermentation process was carried out at rpm, with the pH adjusted to 5.0 by ammonia water with fluctuations of 0.05. The fermentation was carried out for 5 days, and samples were taken regularly to monitor the biomass and products in the fermenter.

[0059] The results are as follows Figure 5 Clostridium yongdarii GG8 grew rapidly after inoculation, with a final cumulative biomass of about 20 g / L. The product had an ethanol concentration of about 53 g / L and an acetic acid concentration of about 6 g / L. During this fermentation process, it was observed that GG8 had a good growth rate and a strong ethanol production capacity.

[0060] Example 5: Single-tank continuous fermentation of Clostridium yongdarii GG8 and production of microbial protein

[0061] Clostridium yongdarii GG8 was inoculated into YTF medium test tubes and cultured anaerobicly at 37°C until it reached the logarithmic growth phase. Then, it was transferred to serum bottles in ATCC 1754 medium without yeast extract. The serum bottles were filled with 1 bar of syngas (60% CO, 10% CO2, 30% H2, % by volume) and cultured until the logarithmic growth phase. Afterward, the culture was transferred to 20 L stirred fermenters containing 10 L of ATCC 1754 medium, pre-added with approximately 1 g / L acetic acid, and the pH adjusted to 5.5 with ammonia. N2 was pre-purged for deoxygenation. Inoculation was performed at a rate of 5% (v / v). During fermentation, syngas (60% CO, 10% CO2, 30% H2, % by volume) was continuously purged at 150 rpm. The aeration rate was 50 mL / min for the first 12 hours, gradually increasing from 25 mL / blow to 1100 mL / min, while the rotation speed was gradually increased to 600 rpm. The fermentation process was carried out at rpm, with the pH adjusted to 5.0±0.1 using ammonia. After the OD600 reached 3, continuous fermentation was started at a daily dilution rate D=0.3 (dilution rate D=feeding rate*24 / reactor volume). As the OD600 remained stable and gradually increased, the dilution rate was gradually increased by 0.2 per cycle, eventually maintaining a dilution rate of 2.0.

[0062] The results are as follows Figure 6 Clostridium yongdarii GG8 exhibited advantages during continuous fermentation. After running continuously for over 150 days, at a dilution rate of 2, Clostridium yongdarii GG8 maintained a cell biomass OD600 of over 21, an acetic acid concentration of approximately 5 g / L, an ethanol concentration of 25 g / L, and an ethanol production intensity exceeding 2 g / L / h.

[0063] The fermentation broth was separated and dried to obtain cell protein. The total nitrogen content was measured using the Kjeldahl method. The nitrogen content was converted into protein content using a conversion factor of 6.25. The crude protein content was approximately 83.28%, which is a higher proportion of protein than soybean (38.6%), fish (17.8%), and meat (21.2%).

[0064] Comparative Example 1: Continuous fermentation of wild Clostridium yongdarii

[0065] Using the same operating method as in Example 5, the original Clostridium yongdarii DSM13528 (WT) was inoculated, and 0.5 g / L yeast powder was added during the operation to maintain growth.

[0066] During continuous fermentation, the WT strain exhibited significant fluctuations, not only in biomass but also in acetic acid and ethanol production. See also Figure 7During continuous fermentation, due to the low biomass level, the dilution rate is maintained at a maximum of D=1, the ethanol production intensity is around 0.3 g / L / h, the biomass is around 5, acetic acid is 6 g / L, and ethanol is 7 g / L. This method is not suitable for industrial production.

[0067] Example 6: Growth of Clostridium yongdarii GG8 in syngas at different ratios

[0068] Clostridium yongdarii GG8 was inoculated into YTF medium test tubes and cultured anaerobicly at 37°C until it reached the logarithmic growth phase. Then, it was transferred to serum bottles in ATCC 1754 medium without yeast extract. The serum bottles were filled with 1 bar of syngas (60% CO, 10% CO2, 30% H2, % by volume) and cultured until the logarithmic growth phase. Afterward, the culture was transferred to 20 L stirred fermenters containing 10 L of ATCC 1754 medium, pre-added with approximately 1 g / L acetic acid, and the pH adjusted to 5.5 with ammonia. N2 was pre-purged for deoxygenation. Inoculation was performed at a rate of 5% (v / v). During fermentation, syngas (60% CO, 10% CO2, 30% H2, % by volume) was continuously purged at 150 rpm. The aeration rate was 50 mL / min for the first 12 hours, gradually increasing from 25 mL / time to 700 mL / min, while the rotation speed was gradually increased to 600 rpm. The fermentation process was carried out at rpm, with the pH adjusted to 5.0 ± 0.1 using ammonia. After the OD600 reached 3, continuous fermentation was started with a daily dilution rate D = 0.3 (dilution rate D = feed rate * 24 / reactor volume), gradually increasing the dilution rate by 0.2 per cycle, eventually maintaining a dilution rate of 1.5. At 124 h, the gas composition was replaced with 92% CO, 4% H2, and 4% N2 (volume fraction), and the gas rate was proportionally reduced to 450 mL / min. At 180 h, the gas composition was replaced with 30% CO, 5% CO2, and 65% H2 (volume fraction), and the gas rate was proportionally adjusted to 1200 mL / min. At 230 h, the gas composition was replaced with 20% CO, 40% CO2, and 40% H2 (volume fraction), and the gas rate was proportionally adjusted to 1800 mL / min.

[0069] like Figure 8As shown, under 60% CO culture conditions, *Clostridium yongdarii* GG8, at a dilution ratio D=1.5, exhibited a biomass OD600 of approximately 7, acetic acid concentration of approximately 6 g / L, and ethanol concentration of approximately 14 g / L. After 124 h, when the gas composition was replaced with 92% CO gas (higher CO content), the bacterial cells maintained a consistent biomass and product concentration. After 180 h, when the gas composition was replaced with 30% CO, 5% CO2, and 65% H2, the bacterial cells still maintained the product concentration. After 230 h, when the gas composition was replaced with an even lower CO ratio (20% CO, 40% CO2, 40% H2), the bacterial cells maintained the previous biomass and product concentrations, demonstrating good growth and production activity. *Clostridium yongdarii* GG8 exhibits good robustness under different syngas ratios.

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Clostridium ljungdahlii GG8 strain, characterized in that, Its accession number is CGMCCNo. 37895.

2. The Clostridium perfringens GG8 strain according to claim 1, characterized in that, The Clostridium yongdarii GG8 can grow and ferment using a carbon gas as the sole carbon source, wherein the carbon gas is CO, or a mixture of CO and CO2.

3. A microbial inoculant, characterized in that, It includes Clostridium yongdarii GG8 as described in claim 1.

4. The application of the Clostridium yongdarii GG8 of claim 1 or the microbial agent of claim 3 in the fermentation production of alcohol and / or cell protein in a fermentation medium with a carbon gas as the sole carbon source, wherein the carbon gas is CO, or a mixture of CO and CO2, and the alcohol is ethanol.

5. A method for producing alcohols and / or bacterial proteins, characterized in that, The Clostridium yongdarii GG8 strain of claim 1 or the microbial agent of claim 3 is inoculated into a fermentation medium with one carbon gas as the sole carbon source for anaerobic fermentation. The alcohol and / or bacterial protein produced by fermentation are collected, wherein the one carbon gas is CO or a mixture of CO and CO2, and the alcohol is ethanol.

6. A method for producing alcohols and / or bacterial proteins according to claim 5, characterized in that, The fermentation is continuous, with a stable operation time of more than 150 days and an ethanol production intensity of more than 2 g / L / h.

Images