Escherichia coli engineering bacteria with high production of streptonigrin and construction method and application thereof

Abstract

The application discloses an escherichia coli engineering bacterium with high production of antraquinone, a construction method and application thereof. After the recombinant plasmid pHT01-crtEB-crtI-BsRBS is transformed into escherichia coli BL21 (DE3), it is found that the obtained engineering bacterium has the characteristics of high production of antraquinone, the yield reaches 9.5 mg / g of cell dry weight, and accounts for 99% of total products. For the first time, it is confirmed that the arrangement order of the crtE, crtB and crtI genes has a significant influence on the yield of antraquinone, through construction of engineering bacteria with six different gene arrangements and yield detection, the optimal gene arrangement combination is crtI-crtB-crtE, and different gene arrangement orders can influence the synthesis efficiency of antraquinone. The engineering bacterium provides a new technical scheme for green and low-cost biological manufacturing of antraquinone, and has a wide application prospect in the fields of food additives, cosmetic raw materials and health product development.

Description

Technical Field

[0001] This invention belongs to the field of synthetic biology and microbial metabolic engineering technology, specifically relating to a method for constructing an engineered Escherichia coli strain that produces high levels of streptorubin, and finding the optimal gene sequence for streptorubin production by optimizing the gene arrangement sequence. It also relates to the application of this engineered strain in streptorubin biosynthesis. Background Technology

[0002] Neurosporene is a C40 carotenoid whose molecular backbone is composed of 8 isoprene units, with the molecular formula C40. 40 H 58 Structurally, it possesses nine conjugated double bonds. This structural feature not only determines its orange-yellow spectral characteristics but also forms the molecular basis for its role as a key precursor in the carotenoid biosynthesis pathway. It exhibits excellent thermal stability and potent antioxidant, anti-inflammatory, and antitumor bioactivities, demonstrating significant application potential and market value in functional foods, pharmaceuticals, and high-end cosmetics. Currently, research and reports on streptosporin are relatively limited. Modifying microorganisms using genetic engineering techniques to introduce carotenoid synthesis-related genes into host bacteria and achieve efficient expression is a key method for producing and improving streptosporin yield.

[0003] Escherichia coli, due to its rapid growth, clear genetic background, strong metabolic capacity, and mature genetic manipulation tools, has become one of the most widely used microbial hosts for heterologous synthesis of terpenoids, showing significant potential in industrial production. However, wild-type E. coli lacks a complete carotenoid synthesis pathway. To achieve heterologous synthesis of streptorubin, it is necessary to introduce exogenous geranylgeranyl pyrophosphate synthase genes (crtE), phytopene synthase genes (crtB), and phytopene dehydrogenase genes (crtI), utilizing the MEP pathway inherent in E. coli to construct a complete synthetic pathway from central metabolic precursors to target products.

[0004] When introducing the aforementioned genes into heterologous host bacteria such as *E. coli*, the choice of vector, construction method, and gene sequence all affect gene expression efficiency and product synthesis yield. Existing research shows that engineered streptorubin bacteria generally suffer from low yields and low product proportions, and the optimal arrangement of the three key genes, crtE, crtB, and crtI, remains unclear, severely hindering the industrial biosynthesis of streptorubin. Therefore, developing an efficient method for constructing engineered streptorubin bacteria, determining the optimal gene sequence, and achieving high-yield and high-purity synthesis of streptorubin are of great significance for promoting its green and low-cost industrial production. Summary of the Invention

[0005] In order to overcome the shortcomings and deficiencies of the prior art, the primary objective of this invention is to provide an engineered Escherichia coli strain that produces high levels of streptorubin.

[0006] Another objective of this invention is to provide a method for constructing the above-mentioned high-yield *E. coli* engineered strain. By using Gibson Assembly technology to achieve efficient assembly of key genes for carotenoid synthesis, it was discovered incidentally that the resulting engineered strain can achieve high production of *E. coli*, with a relatively high product percentage. The influence of the order of the *crtE*, *crtB*, and *crtI* genes on product yield was further clarified, and the optimal gene arrangement was determined.

[0007] Another object of the present invention is to provide the application of the above-mentioned engineered Escherichia coli in the biosynthesis of streptorubin.

[0008] The objective of this invention is achieved through the following technical solution:

[0009] In a first aspect, the present invention provides an engineered Escherichia coli strain that produces high levels of streptorubin, the metabolic pathway of which is as follows: Figure 1 As shown, the precursors isopentenyl pyrophosphate (IPP) and dimethylallyl diphosphate (DMAPP) are generated using the MEP pathway inherent in *E. coli*. A streptococcalin synthesis gene cluster is then introduced exogenously. This gene cluster comprises, in tandem, geranylgeranyl pyrophosphate synthase (crtE), phytoene synthase (crtB), and phytoene dehydrogenase (crtI). The crtE and crtB genes are derived from *Rhodobacter capsulatus*, and the crtI gene is derived from *Cereibacter sphaeroides*. Preferably, the engineered bacterium uses *E. coli* BL21(DE3) as the host, and the gene cluster is carried and expressed by the recombinant expression plasmid pHT01-crtEB-crtI-BsRBS.

[0010] Furthermore, this invention also protects a specific gene combination used to achieve the above-mentioned function, namely a gene cluster consisting of the crtE and crtB genes derived from *Rhodops capsulatum* and the crtI gene derived from *Rhodops spheroidae*, which is used for heterologous expression in *Escherichia coli* to synthesize streptorubin. During the experimental process, this invention accidentally discovered that this engineered bacterium can efficiently synthesize streptorubin, and subsequent testing showed that its streptorubin yield can reach 9.5 mg / g cell dry weight, far exceeding the yield level of existing conventional engineered bacteria.

[0011] Based on the aforementioned high-yield streptorubin engineered bacteria, this invention further discovered that different gene sequences of crtE, crtB, and crtI significantly affect streptorubin production. Based on this, a method for optimizing streptorubin production was developed. Testing revealed that among the six engineered bacteria with different gene sequences, the strain with the gene sequence crtI-crtB-crtE produced the highest streptorubin yield, representing the optimal gene sequence for streptorubin production optimization.

[0012] Preferably, the high-streptolysin-producing *E. coli* engineered strain is obtained by performing any of the following operations on the *E. coli* starting strain using a pHT series vector as the starting vector:

[0013] (a) Sequential heterologous expression of the crtI, crtB, and crtE genes;

[0014] (b) Sequential heterologous expression of the crtI, crtE, and crtB genes;

[0015] (c) Sequential heterologous expression of the crtB, crtI, and crtE genes;

[0016] (d) Sequential heterologous expression of the crtE, crtI, and crtB genes;

[0017] (e) Sequential heterologous expression of the crtB, crtE, and crtI genes;

[0018] (f) The crtE, crtB and crtI genes were expressed heterologously in sequence.

[0019] Among them, crtE is the geranylgeranyl pyrophosphate synthase gene (crtE) derived from Rhodobacter capsulatus. The nucleotide sequence of the crtE gene is shown in SEQ ID NO: 1, and the amino acid sequence it encodes is shown in SEQ ID NO: 2.

[0020] crtB is a phytoene synthase gene (crtB) derived from Rhodobacter capsulatus. The nucleotide sequence of the crtB gene is shown in SEQ ID NO: 3, and the amino acid sequence it encodes is shown in SEQ ID NO: 4.

[0021] crtI is the phytoene dehydrogenase gene (crtI) of Cereibacter sphaeroides. The nucleotide sequence of the crtI gene is shown in SEQ ID NO: 5, and the amino acid sequence it encodes is shown in SEQ ID NO: 6.

[0022] Furthermore, the originating strain of Escherichia coli includes, but is not limited to, Escherichia coli BL21(DE3).

[0023] Furthermore, the starting carrier includes, but is not limited to, pHT01, etc.

[0024] Furthermore, the above genes are used to construct gene expression cassettes using the promoters Pgrac or PT7; where PT7 refers to the T7 promoter.

[0025] Furthermore, when the above-mentioned genes are expressed heterologously, they may also include a ribosome binding site RBS1 that controls the expression of the crtE gene, a ribosome binding site RBS2 that controls the expression of the crtB gene, and a ribosome binding site RBS3 that controls the expression of the crtI gene; wherein, RBS includes BsRBS derived from Bacillus subtilis or EcRBS derived from Escherichia coli.

[0026] Specifically, when the above-mentioned genes are expressed heterologously, they may also include ribosome binding sites BsRBS1 (taaaggaggaa) or EcRBS1 (GATTTTTAGGAACAGTTAAGGAGGTTAATA) controlling the expression of the crtE gene, ribosome binding sites BsRBS2 (AAAGGAGGTG) or EcRBS2 (GAGTACAATAGAAATTAAAATCAGGAGGTCAACA) controlling the expression of the crtB gene, and ribosome binding sites BsRBS3 (ATATTAAGAGGAGGAG) or EcRBS3 (AGATTTTAAATAACAATACTAAGGAGGTGCAAC) controlling the expression of the crtI gene.

[0027] Secondly, the present invention provides the recombinant expression plasmid, which comprises a pHT01 plasmid backbone and randomly tandemly linked crtE, crtB, and crtI genes inserted into its multiple cloning site, wherein the tandem sequence is crtE→crtB→crtI. An assembly diagram is shown below. Figure 2 As shown.

[0028] Thirdly, the present invention provides a method for constructing the above-mentioned engineered Escherichia coli strain that produces high levels of streptorubin, comprising the following steps:

[0029] (1) Construct recombinant plasmids, such as the spectrum of recombinant plasmid pHT01-crtEB-crtI-BsRBS, as shown in the figure. Figure 3 As shown;

[0030] (2) Transform the recombinant plasmid into Escherichia coli BL21(DE3) competent cells;

[0031] (3) Screen and verify to obtain positive transformants containing the correct recombinant plasmid, thus obtaining the engineered Escherichia coli.

[0032] The plasmid construction preferably uses the Gibson Assembly seamless cloning technology. For details on the specific steps and primer sequences used, please refer to the specific implementation method.

[0033] Fourthly, the present invention provides an application of the above-mentioned engineered Escherichia coli in the biosynthesis of streptorubin.

[0034] Fifthly, the present invention provides a method for producing streptorubin using the engineered Escherichia coli strain, comprising the step of fermentation culture using the engineered Escherichia coli strain.

[0035] Includes the following steps:

[0036] The above-mentioned engineered Escherichia coli was fermented and cultured, and the fermentation products were collected.

[0037] Extract streptorubin from the fermentation product.

[0038] Sixthly, the present invention also provides the application of the above-mentioned engineered Escherichia coli in the preparation of streptorubin, as well as food additives, cosmetic raw materials or health products containing streptorubin.

[0039] The present invention has the following advantages and effects compared with the prior art:

[0040] (1) This invention achieves efficient assembly of the crtE, crtB, and crtI genes with the pHT01 vector through Gibson Assembly multi-fragment splicing technology. After the recombinant plasmid pHT01-crtEB-crtI-BsRBS is transformed into Escherichia coli BL21(DE3), it is accidentally discovered that the resulting engineered bacteria have high production characteristics of streptorubin. The yield reaches 9.5 mg / g cell dry weight without IPTG induction, accounting for 99% of the total product. This achieves high-purity synthesis of streptorubin, which is far higher than that of existing conventional engineered bacteria, providing an efficient engineered strain for the biosynthesis of streptorubin.

[0041] (2) This invention first clarified that the order of the crtE, crtB, and crtI genes has a significant impact on the production of streptorubin. By constructing six engineered bacteria with different gene arrangements and conducting yield tests, the optimal gene arrangement combination was determined to be crtI-crtB-crtE. Different gene arrangements can affect the synthesis efficiency of streptorubin, providing an important theoretical basis and technical guidance for further optimizing the gene arrangement of engineered bacteria that synthesize carotenoids.

[0042] (3) The engineered bacteria construction method of the present invention is simple to operate and has good reproducibility. The three-level verification system for positive clone screening can effectively ensure the correctness of recombinant plasmids. The gene arrangement optimization method only requires rearranging and assembling the target gene, without the need for additional modification of the vector and host bacteria, and is easy to promote and apply.

[0043] (4) The streptosporin extraction method used in this invention uses acetone as the extractant, which has high extraction efficiency and simple operation. The HPLC detection method has strong specificity and high accuracy, and can quickly realize the qualitative and quantitative analysis of streptosporin, providing a reliable method for the yield detection of engineered bacteria.

[0044] (5) The engineered bacteria constructed in this invention uses Escherichia coli as the host. Its culture conditions are simple, its growth rate is fast, and its fermentation cycle is short. It is suitable for large-scale industrial cultivation. Combined with the optimization strategy of optimal gene arrangement, it can greatly improve the industrial production efficiency of streptosporine and reduce production costs. It has good prospects for industrial application.

[0045] (6) The engineered bacteria and their construction method of the present invention provide a new technical solution for the green and low-cost biomanufacturing of streptorubin, and have broad application prospects in the fields of food additives, cosmetic raw materials and health products development. Attached Figure Description

[0046] Figure 1 This involves constructing a metabolic flow diagram of engineered bacteria that synthesize streptorubin in Escherichia coli.

[0047] Figure 2 This is a schematic diagram of Gibson Assembly assembling the pHT01 vector and crtE, crtB, and crtI fragments.

[0048] Figure 3 This is a map of the recombinant plasmid pHT01-crtEB-crtI-BsRBS.

[0049] Figure 4 The chromatogram (A) and spectrum (B) are of the fermentation products of BL21(DE3) / pHT01-crtEB-crtI-BsRBS recombinant bacteria without IPTG induction.

[0050] Figure 5 The chromatogram (A) and spectrum (B) are of the fermentation products induced by IPTG from the recombinant BL21(DE3) / pET30a-crtEBI-EcRBS bacteria.

[0051] Figure 6 Based on OD 600 Cell dry weight calibration curve.

[0052] Figure 7This is a graph showing the carotenoid yield of four engineered bacteria: pHT01-crtEB-crtI-BsRBS, pHT01-T7-crtEB-crtI-BsRBS, pET30a-crtEBI-BsRBS, and pET30a-crtEBI-EcRBS under different induction conditions.

[0053] Figure 8 This is a graph showing the production of streptorubin from six different gene sequences. Detailed Implementation

[0054] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Test methods in the following embodiments that do not specify specific experimental conditions are generally performed under conventional experimental conditions or according to the manufacturer's recommended experimental conditions. Unless otherwise specified, the materials and reagents used are commercially available.

[0055] Example 1: Construction of recombinant plasmid pHT01-crtEB-crtI-BsRBS

[0056] 1. Preparation of linearized carriers

[0057] 1.1 Using the pHT01 plasmid routinely preserved in our laboratory as a template, the linearized pHT01 plasmid backbone was obtained by inverse PCR amplification. The PCR reaction system is shown in Table 1:

[0058] Table 1 PCR reaction system

[0059]

[0060] 1.2 The reverse PCR reaction program settings are shown in Table 2 (the annealing temperature can be adjusted according to the primer Tm value).

[0061] Table 2 Reverse PCR reaction procedure

[0062]

[0063] 1.3 After the PCR reaction was completed, the PCR products were verified by 1% agarose gel electrophoresis (containing nucleic acid dye) to observe whether the size of the target band was consistent with the expected (theoretical length after linearization of pHT01 plasmid).

[0064] 1.4 The linearized vector pHT01 was purified using a gel extraction kit (brand: Kangwei Century, model: Gel Rapid Extraction Kit). The specific procedure is as follows:

[0065] (1) Under the ultraviolet gel imaging system, accurately cut a single target DNA band (remove as much agarose gel as possible), put it into a pre-weighed clean centrifuge tube, and weigh it again to calculate the weight of the gel block.

[0066] (2) Add 1 volume of Buffer GP to the gel block (add according to the ratio of gel block weight: Buffer GP volume = 1 mg: 1 μL).

[0067] (3) Place the centrifuge tube in a 50°C water bath and incubate it by gently inverting the centrifuge tube every 2-3 minutes until the gel is completely dissolved (the sol is yellow). If the gel is not completely dissolved, add a small amount of Buffer GP or extend the incubation time.

[0068] (4) Transfer the dissolved gel to the adsorption column that has been loaded into the collection tube, let it stand at room temperature for 2 minutes, centrifuge at 13000 rpm for 15 minutes, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0069] (5) Add 700 μL of Buffer PW to the adsorption column, centrifuge at 13000 rpm for 1 minute, discard the waste liquid, and put the adsorption column back into the collection tube.

[0070] (6) Repeat step (5) for a second wash.

[0071] (7) Centrifuge at 13000 rpm for 1 minute to completely remove residual Buffer PW from the adsorption column.

[0072] (8) Transfer the adsorption column to a new 1.5 mL centrifuge tube, add 50 μL of BufferEB to the center of the adsorption membrane (ensure that BufferEB completely covers the adsorption membrane), let stand at room temperature for 2 minutes, centrifuge at 13000 rpm for 1 minute, collect the eluent (i.e. the linearized carrier pHT01), and seal and store at -20℃ for later use.

[0073] 2. Synthesis of the target gene

[0074] 2.1 Sequence acquisition of target genes related to carotenoid synthesis: The protein sequences encoded by the crtE gene (nucleotide sequence see SEQ ID NO: 1, amino acid sequence see SEQ ID NO: 2) and crtB gene (nucleotide sequence see SEQ ID NO: 3, amino acid sequence see SEQ ID NO: 4) corresponding to accession number P17060 of Rhodobacter capsulatus, and the protein sequence encoded by the crtI gene (nucleotide sequence see SEQ ID NO: 5, amino acid sequence see SEQ ID NO: 6) corresponding to accession number P54980 of Cereibacter phaeroides were determined after verifying the sequence accuracy.

[0075] 2.2 Synthesis of target genes: Junji Biotechnology Co., Ltd. was commissioned to synthesize the crtE, crtB, and crtI genes. During the synthesis process, according to the requirements of Gibson Assembly multi-fragment splicing, homologous arms (30-50 bp in length, with sequences complementary to the ends of the linearized vector and adjacent target gene fragments) were added to both ends of each gene fragment. After the synthesized products were verified by sequencing to be correct, they were used for subsequent vector construction.

[0076] 3. Gibson Assembly multi-segment splicing

[0077] The linearized vector pHT01 was assembled with the target fragments crtE, crtB, and crtI in tandem using Gibson Assembly technology. The primer sequences used are shown in Table 5.

[0078] 3.1 The homologous recombination reaction system is shown in Table 3:

[0079] Table 3 Homologous recombination reaction system

[0080]

[0081] 3.2 Add each component sequentially to a sterile PCR tube according to the above system, and gently pipette to mix (avoid vigorous shaking). (This process must be performed on ice).

[0082] 3.3 Place the PCR tubes in a 50°C incubator for 30 minutes. After incubation, immediately place them on ice to cool for 5 minutes before use.

[0083] 4. Transformation and positive clone screening

[0084] 4.1 Transformation of ligation products into E. coli DH5α competent cells

[0085] (1) Take 10 μL of Gibson Assembly splicing product and slowly add it to 100 μL of Escherichia coli DH5α competent cells in a pre-ice bath. Mix gently and then incubate on ice for 30 minutes (avoid frequent shaking).

[0086] (2) Place the centrifuge tubes in a 42°C constant temperature water bath for 90 seconds (strictly control the time, with an error of no more than ±5 seconds).

[0087] (3) Immediately after the heat shock, transfer the medium to an ice bath to cool for 2 minutes, and quickly add 900 μL of antibiotic-free LB liquid medium.

[0088] (4) Place the centrifuge tube in a constant temperature shaker at 37°C and 200 rpm for 1 hour to allow the cells to recover and express the resistance gene.

[0089] 4.2 Screening of coated plates

[0090] (1) Place the revived bacterial culture in a centrifuge and centrifuge at 4000 rpm for 1 minute. Discard the supernatant and retain 100 μL of bacterial culture. After gently resuspending the culture by pipetting, spread it evenly on LB solid medium plates containing ampicillin (Amp, final concentration 100 μg / mL).

[0091] (2) Invert the plate and place it in a 37°C biochemical incubator for 12-16 hours (the incubation time should not exceed 18 hours to avoid satellite colony growth affecting the screening).

[0092] 4.3 Three-level verification of positive clones:

[0093] (1) Initial screening by colony PCR:

[0094] Pick 5-10 single colonies growing on the plate and place them into PCR tubes containing 50 μL of sterile water. Mix well with a pipette, and then use 2 μL of the bacterial culture as a template for PCR amplification. The reaction system is shown in Table 4.

[0095] Table 4 PCR reaction system

[0096]

[0097] After PCR amplification, the size of the amplified bands was verified by 1% agarose gel electrophoresis to confirm whether it was consistent with the expected (total length of linearized vector + 3 target genes) and positive clones were preliminarily screened.

[0098] (2) Plasmid extraction and double enzyme digestion verification:

[0099] The remaining bacterial culture corresponding to the PCR-screened positive colonies was picked and inoculated into 50 mL of LB liquid medium containing ampicillin (final concentration 100 μg / mL), and cultured overnight at 37°C with shaking at 220 rpm. Recombinant plasmids were extracted using a plasmid miniprep kit (purchased from Novizan). Based on the multiple cloning site of the vector and the restriction enzyme sites at both ends of the target gene, appropriate restriction endonucleases were selected for double digestion. The digestion products were verified by agarose gel electrophoresis to observe whether bands of the same size as the linearized vector and the target gene fragment appeared.

[0100] (3) Sequencing validation (final confirmation):

[0101] The recombinant plasmid that tested positive for double enzyme digestion was sent to Jiangsu Kangwei Century Biotechnology Co., Ltd. (Guangzhou, China) for Sanger sequencing. The sequencing results were compared with the designed assembled sequence using SnapGene software, and the following three conditions had to be met: ① The tandem sequence of the target genes was crtE→crtB→crtI; ② There were no base mutations, deletions, or insertions at the homologous arm junctions; ③ The reading frames of the three target genes were intact, without frameshift mutations. The recombinant plasmid pHT01-crtEB-crtI-BsRBS was obtained, and its pattern is shown below. Figure 3 As shown.

[0102] Using plasmid pHT01-crtEB-crtI-BsRBS as a template, a pair of specific primers were designed to amplify the complete vector fragment carrying the T7 promoter sequence via PCR. After the amplified product was digested with DpnI to eliminate the template plasmid, homologous recombination and circularization were performed directly to replace the original Pgrac promoter region in situ. The pHT01 vector backbone was completely preserved during the modification process, and the elements such as the ampicillin resistance gene AmpR, selection markers, and origin of replication remained unchanged. The core expression cassette crtEB-crtI-BsRBS was completely preserved, and the gene sequence, transcription direction, and ribosome binding site (RBS) source remained unchanged. The promoter replacement was completed only by introducing the T7 promoter through primers, resulting in the recombinant expression plasmid pHT01-T7-crtEB-crtI-BsRBS.

[0103] Using the recombinant plasmid pHT01-T7-crtEB-crtI-BsRBS as a template, specific primers were designed to amplify the complete crtEB-crtI expression cassette containing the BsRBS sequence via PCR. Simultaneously, using the pET30a vector as a template, the linearized vector backbone with the original multiple cloning site (MCS) removed was amplified. The two fragments were then ligated via homologous recombination to achieve seamless splicing of the expression cassette with the pET30a backbone. The modified vector fully retained the core elements of pET30a: the T7 promoter / terminator, lacI repressor protein, lac operon, kanamycin resistance gene (KanR), and 6×His tag. The gene sequence, transcription direction, and Bacillus subtilis-derived ribosome binding site (BsRBS) of the core expression cassette crtEB-crtI-BsRBS were also fully preserved; only the vector backbone was replaced to obtain the recombinant expression plasmid pET30a-crtEBI-BsRBS.

[0104] Finally, using plasmid pET30a-crtEBI-BsRBS as a template, a stepwise overlapping extension PCR combined with multi-fragment homologous recombination strategy was employed to systematically modify the upstream ribosome binding sites (RBS) of the three genes crtE, crtB, and crtI. First, the complete linearized pET30a vector backbone, freed from the original crtEBI-BsRBS expression cassette, was amplified by inverse PCR (IPCR). Simultaneously, specific primers were designed to amplify the crtE, crtB, and crtI gene fragments carrying the E. coli-derived ribosome binding site (EcRBS) sequence via PCR. The 5' end of the primers was pre-introduced with the EcRBS sequence to achieve in-situ replacement of the RBS. The linearized vector backbone was then seamlessly spliced ​​with the three gene fragments carrying EcRBS through homologous recombination, completing vector circularization. During the modification process, all elements, including the pET30a vector backbone, T7 promoter / terminator, lac regulatory elements, KanR resistance gene, and 6×His tag, were fully preserved. The arrangement order and transcription direction of the core genes crtE / crtB / crtI remained unchanged. Only the host adaptability of the ribosome binding site was optimized by introducing EcRBS through primers, and finally the recombinant expression plasmid pET30a-crtEBI-EcRBS was obtained.

[0105] Table 5 Primer sequences for constructing recombinant plasmids

[0106]

[0107] Note: In the primer sequences, the lowercase part is the homologous arm sequence, the uppercase part is the target gene / vector binding sequence, the part in the box is the ribosome binding site RBS sequence, and the underlined part in pHT-F1-2-R is the T7 promoter sequence; all primers were PAGE purified and synthesized by Qingke Biotechnology Co., Ltd. (Guangzhou, China).

[0108] 5. Transformation of recombinant plasmid into Escherichia coli BL21(DE3)

[0109] The recombinant plasmids pHT01-crtEB-crtI-BsRBS, pHT01-T7-crtEB-crtI-BsRBS, pET30a-crtEBI-BsRBS, and pET30a-crtEBI-EcRBS, which were verified by sequencing, were transformed into E. coli BL21(DE3) competent cells using the same transformation method as in step 4.1. The bacteria transformed with pHT01-crtEB-crtI-BsRBS and pHT01-T7-crtEB-crtI-BsRBS were plated on LB agar plates containing ampicillin (final concentration 100 μg / mL), and the bacteria transformed with pET30a-crtEBI-BsRBS and pET30a-crtEBI-EcRBS were plated on LB agar plates containing kanamycin (final concentration 50 μg / mL). The plates were incubated upside down at 37°C for 12-16 hours. The positive transformants obtained through screening are the streptorubin-engineered bacteria based on the metabolic pathway of Escherichia coli, denoted as BL21(DE3) / pHT01-crtEB-crtI-BsRBS, BL21(DE3) / pHT01-T7-crtEB-crtI-BsRBS, BL21(DE3) / pET30a-crtEBI-BsRBS, and BL21(DE3) / pET30a-crtEBI-EcRBS.

[0110] 6. Culture and Induction Expression of Engineered Bacteria

[0111] 6.1 Seed liquid preparation

[0112] Single colonies of the four engineered bacteria obtained through screening were respectively: BL21(DE3) / pHT01-crtEB-crtI-BsRBS, BL21(DE3) / pHT01-T7-crtEB-crtI-BsRBS, BL21(DE3) / pET30a-crtEBI-BsRBS, and BL21(DE3) / pET30a-crtEBI-EcRBS. The pHT01 series recombinant bacteria were inoculated into 50 mL of sterile LB broth containing ampicillin (final concentration 100 μg / mL); the pET30a series recombinant bacteria were inoculated into 50 mL of sterile LB broth containing kanamycin (final concentration 50 μg / mL). All strains were cultured overnight in a shaker at 220 rpm and 37℃ to obtain activated seed cultures with uniform growth, providing standardized germplasm for subsequent scale-up culture and induced expression.

[0113] 6.2 Expanded Culture and Induced Expression

[0114] OD was measured spectrophotometrically for overnight cultured seed solutions. 600 The initial inoculation OD of different engineered bacteria was adjusted by dilution. 600 Maintain consistency. Transfer the standardized seed culture to 50 mL of fresh LB liquid medium containing the corresponding antibiotic resistance at an inoculation rate of 1% (v / v), and incubate in a shaker at 220 rpm and 37°C.

[0115] When the bacteria grow to the logarithmic growth phase (OD) 600 When the concentration of carotenoids was approximately 0.6–0.8, IPTG was added to a final concentration of 1.0 mmol / L for induction of expression. A control group (BL21(DE3) / pHT01-crtEB-crtI-BsRBS) without IPTG was also included to verify the effectiveness of promoter-induced expression. All treatment groups had three replicates, and were cultured in a shaker at 220 rpm and 37°C for 24 h. The fermentation broth was collected for subsequent extraction and content determination of carotenoids.

[0116] 7. Extraction of streptorubin

[0117] 7.1 Take 30 mL of fermentation broth and place it in a centrifuge tube. Centrifuge at 8000 rpm for 5 minutes at 4℃. Discard the supernatant and collect the bacterial pellet. Add 5 mL of PBS buffer (pH 7.4) to resuspend the bacterial pellet. Centrifuge at 8000 rpm for 5 minutes. Discard the supernatant. Repeat the washing process 3 times. After the last wash, centrifuge at 5000 rpm for 10 minutes and discard the supernatant.

[0118] 7.2 Transfer the washed bacterial pellet to a 2 mL sterile EP tube, add 1 mL TE buffer (pH 8.0) to resuspend, then add 25 μL 100 mg / mL lysozyme solution, mix gently, and incubate at 37℃ for 1 hour to break up the bacterial cell walls.

[0119] 7.3 After incubation, centrifuge at 10,000 rpm for 10 minutes, discard the supernatant, and retain the bacterial precipitate; add 1 mL of acetone to the precipitate, vortex for 1 minute, heat in a 55℃ water bath for 5 minutes, vortex again for 1 minute, centrifuge at 10,000 rpm for 5 minutes, and collect the supernatant into a clean test tube.

[0120] 7.4 Repeat the extraction operation in step 7.3 four times and combine all the supernatants (i.e., the crude extract of streptorubin).

[0121] 7.5 Filter the crude extract through a polycarbonate membrane with a pore size of 0.2 μm, collect the filtrate into a chromatographic vial, seal and store at -20℃ for subsequent qualitative and quantitative analysis.

[0122] 8. Qualitative analysis of streptorubin by HPLC

[0123] 8.1 Preparation of mobile phase: An acetonitrile-ethyl acetate mixed mobile phase was prepared at a volume ratio of 2:3, filtered through a 0.22 μm organic phase filter membrane, and then degassed by sonication for 60 minutes to remove air bubbles from the mobile phase.

[0124] 8.2 Column and instrument parameter settings: A C18 reversed-phase column (Agilent ZORBAX SB-C18, specifications: 4.6 mm × 250 mm, 5 μm) was used; detection wavelength was 441 nm; column temperature was 30℃; flow rate was 1.0 mL / min; sample loading volume was 10 μL; elution mode was isocratic elution, elution time was 8 minutes.

[0125] 8.3 Column equilibration: Connect the prepared mobile phase to the HPLC system, start the instrument according to the above parameters, and flush the column at a flow rate of 1.0 mL / min for about 40 minutes until the baseline is stable (baseline noise ≤0.01 mAU).

[0126] 8.4 Sample Testing and Result Analysis

[0127] To clarify the carotenoid synthesis spectra and product structures of different recombinant engineered bacteria, this study used a Shimadzu LC-20AT high-performance liquid chromatograph for qualitative and quantitative analysis of the fermentation products. The results showed significant differences in the chromatographic peak positions and spectral characteristics of the products from different recombinant strains, corresponding to the molecular structural characteristics of streptosporin and lycopene, respectively. Specific analysis is as follows:

[0128] (1) Identification and quantitative analysis of streptorubin synthesis

[0129] Using the BL21(DE3) / pHT01-crtEB-crtI-BsRBS series of recombinant bacteria as the research object, the HPLC chromatogram of their fermentation products without IPTG induction is shown. Figure 4 As shown in A), a single high-purity main peak appeared at 4.42 min, a retention time that perfectly matches the standard retention behavior of Neurosporene. Further full-wavelength UV-Vis absorption spectroscopy was performed on this main peak. Figure 4(B) The results showed that the maximum absorption wavelength (λmax) of the standard reference spectrum of streptorubin was 417 nm, 441 nm, and 470 nm, exhibiting the typical "three-finger peak" characteristic structure of carotenoids. This spectral feature is determined by the seven conjugated double bond system within its molecule and is the exclusive molecular fingerprint of streptorubin. The UV-Vis spectrum of the sample in this experiment showed a highly consistent three-peak absorption mode at 418 nm, 441 nm, and 469 nm. The peak position, peak shape, and relative peak height were not significantly different from the reference spectrum of streptorubin. There were only minor deviations within ±1 nm caused by instrument system errors and solvent environment. Combined with the carotenoid biosynthesis pathway mediated by the crtE / crtB / crtI genes, it can be confirmed that the main fermentation product of this recombinant bacteria is streptorubin.

[0130] Based on the peak area of ​​the characteristic peak of streptorubin, the value was substituted into the standard curve equation y = 1.666 × 10⁻⁶ established in this study. -5 x (where x is the peak area and y is the concentration of streptorubin, in mg / mL), calculate the total mass of streptorubin in the sample. Combine this with the dry weight (DCW) of the engineered bacteria, such as... Figure 6 As shown in the figure), further calculations revealed that the yield of streptorubin was 9.5 mg / g DCW, which is significantly higher than the levels reported in existing literature. Product component analysis showed (e.g.) Figure 7 As shown in Table 6, streptosporin accounts for 99% of the total carotenoid products, while lycopene accounts for only 1%, indicating that under the pHT01 carrier and BsRBS regulation system, CrtI enzyme mainly catalyzes the dehydrogenation of phytoene to streptosporin, and the product synthesis pathway is simple and efficient.

[0131] (2) Identification and quantitative analysis of lycopene synthesis

[0132] Using the recombinant BL21(DE3) / pET30a-crtEBI-EcRBS strain as the research object, the HPLC chromatogram of its fermentation products is shown below. Figure 5 As shown in A), a characteristic main peak with high purity and good symmetry appeared at 4.12 min, and this retention time was completely consistent with the standard retention behavior of lycopene. UV-Vis full-wavelength absorption spectroscopy analysis was performed on this main peak (…). Figure 5(B) The results showed that the maximum absorption wavelength (λmax) of the lycopene standard reference spectrum was 444 nm, 470 nm, and 502 nm, exhibiting a typical three-peak structure. The long-wavelength absorption peaks were significantly red-shifted to above 500 nm, a characteristic determined by the long-chain structure of 11 conjugated double bonds within the lycopene molecule. The UV-Vis spectrum of the sample in this experiment showed a highly matched three-peak absorption mode at 448 nm, 473 nm, and 504 nm. The peak positions, peak shapes, and relative peak heights were highly consistent with the lycopene reference spectrum, with only minor deviations within the range of ±2 to 4 nm caused by instrument system errors and solvent environment. Combined with the dual verification of gene function and spectral characteristics, it can be confirmed that the recombinant bacteria successfully synthesized lycopene.

[0133] Based on the peak area of ​​the characteristic peak of lycopene, the value was substituted into the standard curve equation Y = 2.055 × 10⁻⁶ established in this study. −5 X (where X is the peak area and Y is the lycopene concentration, in mg / mL) can be used to accurately calculate the concentration and total yield of lycopene in the sample. Combined with the aforementioned comparison results of carotenoid yields mediated by different plasmids (e.g., Figure 7 As shown in Table 6, the BL21(DE3) / pET30a-crtEBI-EcRBS recombinant strain produced lycopene at a yield of 37.2 mg / g DCW under IPTG induction, significantly higher than other recombinant strains. This result fully demonstrates that the dual modification of replacing the vector backbone from pHT01 to pET30a and optimizing the ribosome binding site (RBS) from Bacillus subtilis-derived BsRBS to Escherichia coli-derived EcRBS not only significantly improved the translation efficiency of the crtE / crtB / crtI genes, but also more effectively promoted the efficient conversion of the carotenoid synthesis pathway from streptococcusine to lycopene, achieving precise regulation of carotenoid yield and product structure.

[0134] Table 6. Yield and percentage of streptosporin

[0135]

[0136] Example 2: Different gene sequence arrangements and combinations

[0137] 1. Preparation of linearized carriers

[0138] Based on Example 1, using the pHT01-crtEB-crtI-BsRBS plasmid as a template, the redundant restriction site BamHI (GGATCC) was removed by point mutation of the primer pair pHT-IPCR-T7p-F and pHT01-vector0-R to obtain plasmid EBI. The linearized pHT01 plasmid backbone was obtained by inverse PCR amplification, and the purified linearized vector was obtained after detection by agarose gel electrophoresis.

[0139] 2. Acquisition of the target gene fragment and modification of homologous arms

[0140] Using plasmid EBI as a template, the crtE, crtB, and crtI genes and their upstream and downstream regulatory elements were amplified by PCR.

[0141] (1) Design specific primers and amplify single target gene fragments crtE, crtB and crtI by PCR, which contain their corresponding ribosome binding sites (RBS) and terminators. The fragments are then purified by agarose gel electrophoresis.

[0142] (2) Using the gene fragment obtained in step (1) as a template, PCR amplification is performed using primers with homologous overlapping sequences to make adjacent DNA fragments have an overlap region of 15-25 bp. The target gene fragment with homologous arms is purified by gel recovery.

[0143] 3. Gibson Assembly of Recombinant Plasmids with Different Gene Sequences

[0144] The crtE, crtB, and crtI fragments with homologous arms were mixed with the linearized pHT01 vector at a molar ratio of 1:1 to 1:3. The recombinant plasmids with six different gene sequences were constructed by in vitro recombination splicing using the Gibson Assembly enzyme system. The specific assembly system and reaction conditions were the same as in Example 1. The primers used are listed in Table 7 and were synthesized by Qingke Biotechnology Co., Ltd. (Guangzhou, China).

[0145] The constructed gene arrangement is as follows:

[0146] (1) The plasmid constructed by crtE-crtB-crtI is abbreviated as EBI, the same below; (2) The plasmid constructed by crtE-crtI-crtB is abbreviated as EIB; (3) The plasmid constructed by crtB-crtE-crtI is abbreviated as BEI; (4) The plasmid constructed by crtB-crtI-crtE is abbreviated as BIE; (5) The plasmid constructed by crtI-crtE-crtB is abbreviated as IEB; (6) The plasmid constructed by crtI-crtB-crtE is abbreviated as IBE.

[0147] Table 7 Primer sequences for constructing recombinant plasmids with different gene sequences

[0148]

[0149] 4. Transformation and positive clone screening of Escherichia coli clones

[0150] The above six assembly products were transformed into Escherichia coli DH5α competent cells, and after being subjected to ice bath, heat shock, and recovery, they were plated on the corresponding antibiotic plates and incubated upside down at 37 ℃. Single colonies were picked for colony PCR identification, and positive recombinant clones were screened.

[0151] 5. Sequencing validation and transformation of the expression strain

[0152] Clones that were positive by colony PCR were sequenced. The correct recombinant plasmids that were consistent with the theoretical sequence were transformed into Escherichia coli BL21(DE3) competent cells to obtain gene rearranged engineered strains for streptorubin synthesis.

[0153] 6. Fermentation culture

[0154] The seed culture of the positive expression strain was inoculated into LB fermentation medium containing ampicillin at an inoculation rate of 1% (v / v) and cultured at 37 ℃ and 220 rpm for 24 h to complete the biosynthesis of streptorubin.

[0155] 7. Pigment Extraction

[0156] Fermented cells were collected, and the pigment products synthesized in the cells were extracted using organic solvent extraction. The supernatant was collected by centrifugation to obtain a crude extract of streptorubin.

[0157] 8. HPLC Qualitative and Analytical Analysis

[0158] High-performance liquid chromatography (HPLC) was used to detect the crude pigment extract. Following the method in Example 1, HPLC qualitative analysis was performed on the synthetic products of strains with different gene sequences. The synthesis of streptorubin under different gene arrangements was compared, and the optimal gene arrangement was determined to be crtI-crtB-crtE (…). Figure 8 (and Table 8).

[0159] Table 8. Streptocarboxylic acid production and percentage for six different gene sequences

[0160]

[0161] The high-yield streptorubin engineered bacteria and the optimized gene-rearranged engineered bacteria constructed in this invention can achieve efficient synthesis of streptorubin under conventional microbial fermentation conditions. The host bacterium Escherichia coli has simple culture conditions and a short fermentation cycle, making it suitable for large-scale industrial production. At the same time, the construction method and gene arrangement optimization strategy of this invention are simple to operate and have good reproducibility. They can be directly applied to the modification and production of industrial strains, significantly improving the yield and production efficiency of streptorubin, reducing production costs, and have important industrial application value in the fields of food, medicine, and cosmetics.

[0162] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A high-yield Escherichia coli strain producing streptorubin, characterized in that, The engineered Escherichia coli strain was obtained by performing any of the following operations on the starting strain of Escherichia coli using a pHT series vector as the starting vector: (a) Sequential heterologous expression of the crtI, crtB, and crtE genes; (b) Sequential heterologous expression of the crtI, crtE, and crtB genes; (c) Sequential heterologous expression of the crtB, crtI, and crtE genes; (d) Sequential heterologous expression of the crtE, crtI, and crtB genes; (e) Sequential heterologous expression of the crtB, crtE, and crtI genes; (f) The crtE, crtB and crtI genes were expressed heterologously in sequence.

2. The engineered Escherichia coli strain with high streptorubin production according to claim 1, characterized in that: crtE is the geranylgeranyl pyrophosphate synthase gene crtE derived from Rhodobacter capsulatus, and its encoded amino acid sequence is shown in SEQ ID NO: 2; crtB is the phytoene synthase gene crtB derived from Rhodobacter capsulatus, and its encoded amino acid sequence is shown in SEQ ID NO: 4; crtI is the phytoene dehydrogenase gene crtI from Cereibacter sphaeroides, and its encoded amino acid sequence is shown in SEQ ID NO:

6.

3. The engineered Escherichia coli strain with high streptorubin production according to claim 2, characterized in that: The nucleotide sequence of the crtE gene is shown in SEQ ID NO: 1; The nucleotide sequence of the crtB gene is shown in SEQ ID NO: 3; The nucleotide sequence of the crtI gene is shown in SEQ ID NO:

5.

4. The engineered Escherichia coli strain with high streptorubin production according to any one of claims 1 to 3, characterized in that: The starting strain of Escherichia coli includes, but is not limited to, Escherichia coli BL21(DE3); Or, the starting carrier includes, but is not limited to, pHT01.

5. The engineered Escherichia coli strain with high streptorubin production according to any one of claims 1 to 3, characterized in that: Gene expression cassettes are constructed using the promoters Pgrac or PT7. And / or, when the gene is expressed heterologously, it also includes a ribosome binding site RBS1 that controls the expression of the crtE gene, a ribosome binding site RBS2 that controls the expression of the crtB gene, and a ribosome binding site RBS3 that controls the expression of the crtI gene; wherein, RBS includes BsRBS derived from Bacillus subtilis or EcRBS derived from Escherichia coli.

6. The engineered Escherichia coli strain with high streptorubin production according to claim 5, characterized in that: RBS1 includes BsRBS1 or EcRBS1, where BsRBS1: taaaggaggaa, EcRBS1: GATTTTTAGGAACAGTTAAGGAGGTTAATA; RBS2 includes BsRBS2 or EcRBS2, where BsRBS2: AAAGGAGGTG, EcRBS2: GAGTACAATAGAAATTAAAATCAGGAGGTCAACA; RBS3 includes BsRBS3 or EcRBS3, where BsRBS3 is: ATATTAGAGGAGGAG, and EcRBS3 is: AGATTTTAAATAACAATACTAAGGAGGTGCAAC.

7. The method for constructing the engineered Escherichia coli strain with high streptorubin production according to any one of claims 1 to 6, characterized in that, Includes the following steps: (1) Construct recombinant plasmids; (2) Transform the recombinant plasmid into Escherichia coli BL21(DE3) competent cells; (3) Screen and verify to obtain positive transformants containing the correct recombinant plasmid, thus obtaining the engineered Escherichia coli.

8. The application of the engineered Escherichia coli strain with high streptorubin production according to any one of claims 1 to 6, characterized in that, For any one or more of the following applications: (a) Application in the biosynthesis of streptorubin; (b) Application in the preparation of food additives, cosmetic ingredients or health products containing streptorubin.

9. A method for producing streptorubin, characterized in that, The step includes fermentation culture using the engineered Escherichia coli strain that produces high levels of streptorubin as described in any one of claims 1 to 6.

10. The method according to claim 9, characterized in that, Includes the following steps: Fermentation culture of the engineered Escherichia coli strain that produces high streptorubin according to any one of claims 1 to 6, and collection of fermentation products; Extract streptorubin from the fermentation product.

Images