Single-substrate dual-luciferase-based nf-kappa b activity detection cell model, construction method, detection method and application thereof
By integrating an NF-κB active reporter gene expression vector into the host cell genome and employing an optical signal separation and mathematical decoupling strategy, the problems of complex detection procedures and insufficient data stability in existing technologies are solved, thereby simplifying high-throughput drug screening and improving the reliability of results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- WULIANGYE
- Filing Date
- 2026-03-25
- Publication Date
- 2026-07-14
AI Technical Summary
Existing NF-κB reporter gene detection technologies have complex detection processes, numerous steps, insufficient synchronization, and limited data stability and repeatability in high-throughput drug screening, making it difficult to meet the requirements of automated, high-density plate-type screening.
The NF-κB active reporter gene expression vector was stably integrated into the host cell genome using a transposon system. Combined with optical signal separation and mathematical decoupling strategies under single luciferase substrate conditions, the simultaneous detection of dual reporter signals and internal control normalization were achieved.
It significantly simplifies the detection process, reduces operational errors, and improves data consistency and repeatability, making it suitable for high-throughput automated screening and applicable to anti-inflammatory drug screening and mechanism of action research.
Smart Images

Figure CN122382010A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine and cell engineering technology, specifically relating to a dual-luciferase NF-κB activity detection cell model for detecting the activation state of nuclear factor-κB (NF-κB), its construction method, detection method, and application in drug screening, and particularly to an NF-κB activity detection system based on a single luminescent substrate, optical signal separation, and internal control normalization. Background Technology
[0002] Nuclear factor-κB (NF-κB) is a family of transcription factors that play key roles in biological processes such as inflammatory responses, immune responses, cellular stress, and cell fate regulation. Abnormal activation of the NF-κB pathway is closely related to the development and progression of various inflammation-related diseases, autoimmune diseases, and tumors. Therefore, mechanistic studies and drug screening focusing on the NF-κB signaling pathway have long been an important direction in the development of anti-inflammatory and related therapeutic drugs.
[0003] To monitor changes in the activity of the NF-κB signaling pathway, reporter gene detection systems are commonly used in current technologies. These systems link NF-κB response elements to quantifiable reporter genes, using the expression level of the reporter gene as an indirect indicator of NF-κB activation status. Among these, luciferase reporter genes are widely used in NF-κB activity detection and related drug screening studies due to their high sensitivity and ease of detection.
[0004] One existing technical solution (e.g., patent CN102492657A) proposes a cell model for drug screening targeting NF-κB. This model utilizes a single luciferase reporter system driven by an NF-κB-responsive element to detect NF-κB pathway activity. These models typically rely on a single reporter signal as the detection indicator, have a relatively simple structure, and offer a straightforward detection process. However, under high-throughput screening conditions, due to the lack of a stable internal control calibration mechanism, these systems are susceptible to non-specific factors such as variations in cell seeding quantity, cell state fluctuations, and the cytotoxicity of candidate compounds. This results in significant well-to-well variability, limiting data stability and reproducibility, thus restricting their application value in automated drug screening.
[0005] To overcome the limitations of single reporter gene systems, another existing technology (such as patent CN107841488A) proposes a dual-luciferase reporter detection strategy. This strategy introduces two different types of luciferases, serving as the NF-κB response signal and the internal reference signal, respectively, to achieve relative correction of the detection results. This type of dual-reporter system reduces signal fluctuations caused by differences in cell number to a certain extent, thus improving the reliability of the detection results.
[0006] However, existing dual-luciferase assay systems typically rely on the stepwise addition and sequential detection of different luminescent substrates to distinguish between two report signals. This process involves multiple sample additions, reaction switching, and multiple readings. In high-throughput screening scenarios, this approach not only increases operational complexity and detection time but is also prone to introducing systematic errors due to differences in substrate reaction kinetics, sample addition timing deviations, and reading delays, thus affecting the consistency and reproducibility of screening data. Furthermore, the separation of the report signal and internal control signal in these technologies primarily relies on chemical reactions or reaction time differences, rather than achieving effective signal decoupling under simultaneous detection conditions, thus remaining insufficient in terms of simplifying the detection process and adapting to automation.
[0007] Overall, while existing NF-κB reporter gene detection technologies have achieved monitoring of NF-κB activity and internal reference calibration to some extent, their implementation primarily revolves around stepwise detection and reaction differentiation. This makes it difficult to simultaneously meet the comprehensive requirements of high-throughput drug screening, including simplified detection procedures, synchronous control, and data consistency. Especially under automated, high-density plate-based screening conditions, how to further reduce detection steps, decrease systematic errors, and improve the stability and repeatability of screening results while maintaining internal reference calibration capabilities remains a pressing technical challenge. Summary of the Invention
[0008] To address the common problems of existing NF-κB reporter gene detection systems in high-throughput drug screening, such as complex detection procedures, numerous detection steps, insufficient synchronization, and limited data stability and repeatability, the present invention aims to provide a new NF-κB activity detection cell model and its detection method.
[0009] To achieve the above-mentioned objectives, the technical solution adopted in this application is as follows: In the first aspect, this application provides a cell model for NF-κB activity detection, which is obtained by stably integrating an NF-κB activity reporter gene expression vector into the host cell genome through a transposon system; The NF-κB active reporter gene expression vector includes an insulator element, an NF-κB response expression unit containing the luciferase reporter gene ELUC, and an internal reference expression unit containing the internal reference gene SLR.
[0010] In some embodiments, the insulator element is a series-connected HS4 core insulator with a nucleotide sequence as shown in SEQ ID NO:1.
[0011] In some preferred embodiments, the number of insulator elements is 1 to 3.
[0012] In some embodiments, the luciferase reporter gene is also fused with a PEST tag. The nucleotide sequence of ELUC is shown in SEQ ID NO:5. The PEST tag is shown in SEQ ID NO:4.
[0013] In some embodiments, the nucleotide sequence of the internal reference gene SLR is shown in SEQ ID NO:7.
[0014] In some embodiments, the NF-κB active reporter gene expression vector contains the following elements: (1) First insulator element; (2) NF-κB response expression unit: contains tandem NF-κB binding elements, a minimal promoter, and a luciferase ELUC coding sequence; (3) Second insulator element: located downstream of the ELUC expression unit; (4) Internal reference expression unit: including the EF1α constitutive promoter and the luciferase SLR coding sequence; (5) Screening for marker genes; (6) Third insulator element: located at the end of the expression box.
[0015] In some preferred embodiments, the nucleotide sequence of the NF-κB binding element is shown in SEQ ID NO:2.
[0016] In some preferred embodiments, the minimum promoter nucleotide sequence is shown in SEQ ID NO:3.
[0017] In some preferred embodiments, the constitutive promoter nucleotide sequence of the EF1α is shown in SEQ ID NO:6.
[0018] In some preferred embodiments, the NF-κB active reporter gene expression vector contains a gene sequence as shown in SEQ ID NO:9.
[0019] In some embodiments, the host cell is selected from at least one of RAW264.7, HEK293 and its derivatives, THP-1, HeLa, HCT116, Hep G2, A549 or Jurkat cell lines.
[0020] In some implementations, the transposon system used to construct the reporter gene expression vector is selected from at least one of piggyBac (PB) or Sleeping Beauty (SB).
[0021] Secondly, this application provides a method for constructing a cell model for NF-κB activity detection, comprising the following steps: Using genetic engineering techniques, the NF-κB active reporter gene expression cassette is inserted into the transposon system, followed by cell transfection, resistance selection, and purification to obtain a cell line that stably expresses the NF-κB active reporter gene.
[0022] In some embodiments, the nucleotide sequence of the NF-κB activity reporter gene expression cassette is shown in SEQ ID NO:9.
[0023] In some implementations, the transfection time is 24–48 h.
[0024] In some embodiments, the hygromycin B resistance gene Hygro is added for resistance screening. The nucleotide sequence of the hygromycin B resistance gene Hygro is shown in SEQ ID NO:8.
[0025] Thirdly, this application provides a detection method for NF-κB activity detection, comprising the following steps: (1) After adding a single luciferase substrate to the NF-κB activity detection cell model obtained in the first aspect above, the cells are allowed to simultaneously generate two luminescent signals with spectral overlap characteristics. (2) Then, the original signals F1 and F2 are obtained by separating them through filters of different wavelength ranges. The target signal E representing the activity of the NF-κB pathway and the stable signal R as an internal reference are calculated by using the pre-calibrated filter transmittance coefficient and the decoupling algorithm E=aF1+bF2, R=cF1+dF2. (3) The systematic error can be eliminated by normalizing the NF-κB activity = E / R.
[0026] In some implementations, the pre-calibrated filter transmittance coefficient in the above detection step (2) is obtained by the following method: The transmittance coefficient of the reporter gene ELUC under filter 1 is denoted as T1e, and the transmittance coefficient of the internal reference gene SLR is denoted as T1r. The transmittance coefficient of the reporter gene ELUC under filter 2 is denoted as T2e, and the transmittance coefficient of the internal reference gene SLR is denoted as T2r. ① Prepare cells that express only ELUC, without using a filter, and directly measure all the light emitted by ELUC, which is recorded as Etotal; ② Collect the amount of light passing through ELUC cells using filter 1, and record it as E1; ③ Collect the amount of light passing through ELUC cells using filter 2, and record it as E2; ④ Calculate the transmittance coefficient of the filter: T1e = E1 / Etotal; T2e = E2 / Etotal; Similarly, prepare cells that express only the internal reference gene SLR to obtain the transmittance coefficient of the internal reference gene SLR.
[0027] In some more specific implementations, the decoupling algorithm and normalization process are implemented through the following methods: ①True fluorescein content of ELUC: denoted as E; True fluorescein content of SLR: denoted as R; The transmittance coefficient of filter 1 to ELUC is denoted as T1e, and the transmittance coefficient to SLR is denoted as T1r; The transmittance coefficient of filter 2 to ELUC is denoted as T2e, and the transmittance coefficient to SLR is denoted as T2r; The detection values for the mixed sample are as follows: the amount of light measured using filter 1 is recorded as F1, and the amount of light measured using filter 2 is recorded as F2. ② Measure the mixed sample of ELUC and SLR. Measure with filter 1: F1 = the amount of light passing through filter 1 of ELUC + the amount of light passing through filter 1 of SLR = T1e×E + T1r×R; Measure with filter 2: F2 = the amount of light passing through filter 2 of ELUC + the amount of light passing through filter 2 of SLR = T2e×E + T2r×R. Substitute the coefficients of each filter to obtain E, R and the ratio.
[0028] In some embodiments, the wavelength of the filter 1 is 530±15 nm.
[0029] In some embodiments, the wavelength of the filter 2 is 610±30 nm.
[0030] Fourthly, this application provides the application of the NF-κB activity detection cell model obtained in the first aspect in the screening of anti-inflammatory drugs.
[0031] In some implementations, the screening method used in the application includes the following steps: (1) The stable NF-κB reporter cells obtained in the first aspect were seeded into multi-well plates and pretreated with the test compound; (2) Add NF-κB activator or inhibitor, and add single luciferase substrate after incubation; (3) Simultaneously acquire dual-channel emission signals through filters of different wavelengths; perform signal decoupling calculation based on the transmittance coefficient of the filters; calculate the ELUC / SLR ratio as an NF-κB activity index; output the screening results and determine the candidate compounds.
[0032] In some implementations, the anti-inflammatory drug is an inhibitor of the NF-κB signaling pathway.
[0033] In some preferred embodiments, the anti-inflammatory drug is at least one of MG132, BAY 11-7082, bortezomib, sorafenib, DMAPT, LP46, or RS47.
[0034] In some embodiments, the NF-κB activator or inhibitor is at least one of tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), lipopolysaccharide (LPS), TLR1 / TLR2 agonist, TLR7 agonist, hydrogen peroxide, C16 ceramide, or doxyfluorourea.
[0035] In some embodiments, the concentration of the NF-κB activator or inhibitor is 50–100 ng / mL.
[0036] In some embodiments, the NF-κB activator or inhibitor is incubated for 4 to 6 hours.
[0037] In some embodiments, the luciferase substrate is D-luciferin or a derivative thereof.
[0038] Beneficial Effects: This application utilizes the principle that the first and second luciferases can emit light simultaneously under the same luminescent substrate conditions, but their emission spectra differ. It provides a cell model for detecting dual-luciferase NF-κB activity reporter genes that requires only a single substrate addition and can achieve stable, high-throughput screening. Compared with existing technologies, this application features a single-vector, dual-reporter-gene tandem structure, three-insulator isolation, and a built-in constant internal control using the second luminescent protein. It also offers the following advantages in detection methods, operational procedures, and applications: (1) Innovation in detection principle: Existing NF-κB dual-luciferase detection systems mainly rely on different substrate reactions or stepwise detection methods to distinguish between reporter signals and internal reference signals. However, this invention introduces the strategy of "optical signal separation and mathematical decoupling under single substrate conditions" for the first time in NF-κB activity detection, realizing the synchronous detection of dual reporter signals and internal reference normalization. Its detection principle is fundamentally different from existing technologies.
[0039] (2) Substantial simplification of the detection process: The present invention can complete signal acquisition with a single sample addition, significantly reducing operation steps and reducing human and equipment operation errors, and is particularly suitable for automated high-throughput screening in 96-well, 384-well and higher density plate types.
[0040] (3) Improved data stability and repeatability: By synchronous expression of dual reporter genes in the same construct and correction of internal reference ratio, the present invention can effectively reduce the impact of cell number difference, cell state fluctuation and non-specific toxicity factors on the detection results, and improve the consistency and reliability of screening data.
[0041] (4) Good application adaptability: The detection system described in this invention can be seamlessly integrated into existing high-throughput screening platforms and automated detection processes. It is suitable for screening, evaluation and mechanism of action of anti-inflammatory active compounds and has good industrial application prospects. Attached Figure Description
[0042] Figure 1 This is a schematic diagram of the dual-luciferase reporter gene expression vector used for NF-κB activity detection in Example 1 of the present invention.
[0043] Figure 2 This is a schematic diagram illustrating the NF-κB activity detection principle based on a dual-luciferase reporter system in Example 3 of the present invention.
[0044] Figure 3 This is a schematic diagram of the overall process for high-throughput drug screening using the NF-κB dual-luciferase stable cell model in Example 5 of the present invention. Detailed Implementation
[0045] To make the technical problems, solutions, and beneficial effects of this application clearer, the following detailed description is provided in conjunction with the embodiments. Unless otherwise defined, all technical terms used herein have the same meaning as understood by one of ordinary skill in the art.
[0046] In this document, the terms “comprising,” “having,” “including,” and “containing” should be interpreted as open-ended terms (i.e., meaning “including but not limited to”).
[0047] In this document, “and / or” means and includes any and all possible combinations of one or more of the associated listed items. For example, “the composition contains A and / or B” can be interpreted as the composition contains A, the composition contains B, or the composition contains both A and B.
[0048] The technical problems addressed in this article are as follows: (1) Existing single NF-κB reporter systems lack reliable internal control calibration and are easily affected by cell number, cell state and non-specific toxicity, resulting in large fluctuations in screening results; (2) Existing dual-luciferase reporter systems usually rely on different luminescent substrates or stepwise detection methods to distinguish between reporter signals and internal control signals. The detection process is complex and not conducive to high-throughput automated operation. (3) Under high-throughput screening conditions, multiple sample additions and sequential readings can easily introduce systematic errors, affecting the consistency and repeatability of the detection results.
[0049] Therefore, the purpose of this paper is not merely to provide a new method for constructing NF-κB reporter genes, but to propose a comprehensive technical solution for NF-κB activity detection that simplifies the detection process, allows for simultaneous signal acquisition, and is suitable for high-throughput screening, while ensuring the internal reference calibration capability.
[0050] The term "luciferase reporter gene" in this article refers to a method that integrates a reporter gene into a target biological system using molecular biology techniques, and then studies specific biological processes by detecting the signal produced by the reporter gene. Luciferase, as a common enzyme selected for reporter genes, catalyzes the oxidation of the substrate luciferin. During the oxidation process, the luciferin substrate emits biofluorescence, and the fluorescence signal value can be accurately measured using a fluorescence meter, thereby accurately quantifying the expression level of luciferase.
[0051] Cell models for NF-κB activity detection This article presents a cell model for NF-κB activity detection based on a single-substrate dual-luciferase. This cell model was obtained by stably integrating an expression construct containing the following functional modules into the host cell genome through a transposon system: (1) First reporter gene expression unit: This expression unit includes an NF-κB response element and a minimal promoter, which are used to drive the expression of the first luciferase when the NF-κB signaling pathway is activated; (2) Internal reference gene expression unit: This expression unit is regulated by a constitutive promoter and is used to drive the stable expression of the second luciferase, serving as an internal reference signal that reflects the cell state and overall transcriptional activity; (3) An insulator sequence located between and on both sides of the first reporter gene expression unit and the internal reference gene expression unit is used to reduce the influence of transcriptional crosstalk and genome insertion site effects on the reporter signal.
[0052] The first and second luciferases in this article are capable of emitting light simultaneously under the same luminescent substrate conditions, but their emission spectra differ. In some examples, the first luciferase is ELUC, and the second luciferase is the internal reference gene SLR.
[0053] In some examples, the NF-κB activity reporter gene expression vector includes an insulator element, an NF-κB response expression unit containing the luciferase reporter gene ELUC, and an internal reference expression unit containing the internal reference gene SLR. The insulator element is preferably a 2×HS4 core insulator.
[0054] The term "2×HS4 core insulator" in this article refers to a DNA element consisting of two tandem "chicken HS4 insulator core sequences." It is an artificially constructed DNA regulatory element with double the efficacy, which significantly enhances the barrier effect of the insulator by forming a tandem dimer, thereby reducing the impact of exogenous transgene insertion sites on transcriptional activity and improving the stability and consistency of the reporter signal. In some examples, the 2×HS4 core insulator is shown in SEQ ID NO:1.
[0055] In some examples in this paper, the number of insulator elements is 1 to 3. Preferably, there are 3 insulator elements. The first insulator element is used to reduce the influence of the exogenous transgene insertion site on transcriptional activity and improve the stability and consistency of the reporter signal; the second insulator element is used to isolate upstream and downstream transcription units to avoid transcriptional interference; and the third insulator element is at the end of the entire expression frame to further reduce the influence of the chromatin environment on the overall expression of the transgene.
[0056] The term "NF-κB response element" in this paper refers to the element that drives the transcriptional expression of the downstream gene ELUC when the NF-κB signaling pathway is activated; the minimal promoter is used to reduce the basal transcriptional background and improve the signal-to-noise ratio.
[0057] In some examples, the luciferase reporter gene ELUC is fused with a PEST tag that shortens the protein's half-life, enabling the reporter signal to more accurately reflect the transient activation state of the NF-κB pathway, reducing background signal accumulation, and thus improving the sensitivity and dynamic range of high-throughput screening. In some specific examples, the ELUC coding sequence is shown in SEQ ID NO:5.
[0058] The term "internal reference gene" in this paper refers to a luciferase reporter gene assay system used to correct for differences in cell number and cytotoxicity, resulting in more accurate results. While existing technologies often employ Renal luciferase, this paper uses an SLR coding sequence as the internal reference gene. Preferably, this SLR coding sequence is derived from the red-emitting luciferase of the worm *Gymnocypris spp.* In some examples, the expression unit of the internal reference gene is regulated by a constitutive promoter, preferably the EF1α promoter. More preferably, the nucleotide sequence of the SLR coding sequence, as shown in SEQ ID NO:7, is used to provide a stable internal reference signal under different treatment conditions.
[0059] The term "host cell" in this article refers to the cell that "reads" the gene from the plasmid, synthesizes the luciferase protein, and ultimately generates fluorescence by adding a substrate to reflect NF-κB activity. Cell lines RAW264.7, HEK293 and its derivatives, THP-1, HeLa, HCT116, Hep G2, A549, or Jurkat are all suitable for stable transfection of the NF-κB activity reporter gene expression vector described in this article. The RAW264.7 cell line is superior for studies on inflammation, immune regulation, and related signaling pathways; therefore, in some preferred examples, the RAW264.7 cell line was chosen for introducing the NF-κB activity reporter gene expression vector.
[0060] Methods for constructing cell models for NF-κB activity detection This article provides a method for constructing a cell model for NF-κB activity detection, including the following steps: using genetic engineering technology, inserting an NF-κB activity reporter gene expression cassette into a transposon system, followed by cell transfection, resistance screening, purification, and obtaining a cell line that stably expresses the NF-κB activity reporter gene.
[0061] The cell model constructed in this paper uses a relatively conventional method. Any method that can integrate the exogenous gene into the host cell genome and enable its long-term stable expression can serve as the basis for constructing the cell model. For example, lentiviral systems, transposon systems, and conventional plasmid transfection can be used. To achieve multi-copy integration and high expression levels, transposon systems are more suitable for reporter gene detection, which requires a high signal-to-noise ratio, as described in this paper.
[0062] Detection methods for NF-κB activity This article provides a detection method for NF-κB activity assay, which includes the following steps: (1) After adding a single luciferase substrate to the NF-κB activity detection cell model obtained above, wait for the cells to simultaneously generate two luminescent signals with spectral overlap characteristics. (2) Then, the original signals F1 and F2 are obtained by separating them through filters of different wavelength ranges. The target signal E representing the activity of the NF-κB pathway and the stable signal R as an internal reference are calculated by using the pre-calibrated filter transmittance coefficient and the decoupling algorithm E=aF1+bF2, R=cF1+dF2. (3) The systematic error can be eliminated by normalization: NF-κB activity = E / R.
[0063] In this study, optical filters with different wavelength ranges were used to acquire the synchronously generated luminescence signals through multiple channels during the detection process. Based on pre-calibrated spectral transmittance parameters, mathematical conversion was performed on the signals of each channel to decouple and obtain the true luminescence contribution values of the first luciferase and the internal reference luciferase. Furthermore, the ratio of the two was used to achieve normalized detection of NF-κB activity. Unlike existing dual-luciferase systems that rely on different substrates or stepwise detection, this invention achieves synchronous acquisition and calculation separation of dual reporter signals under a single substrate condition, avoiding the systematic errors introduced by multiple sample additions and sequential detection.
[0064] Application of NF-κB activity assay cell model in anti-inflammatory drug screening This paper also uses the obtained NF-κB activity detection cell model for anti-inflammatory drug screening.
[0065] In some examples in this article, the filtering methods are as follows: (1) The obtained stable NF-κB reporter cells were seeded into multi-well plates and pretreated with the test compound; (2) Add NF-κB activator or inhibitor, and add single luciferase substrate after incubation; (3) Simultaneously acquire dual-channel emission signals through filters of different wavelengths; perform signal decoupling calculation based on the transmittance coefficient of the filters; calculate the ELUC / SLR ratio as an NF-κB activity index; output the screening results and determine the candidate compounds.
[0066] In practical applications, this drug screening method is applicable to all anti-inflammatory drugs designed based on the NF-κB activity pathway, including but not limited to small molecule compounds, natural product extracts, or their derivatives. The anti-inflammatory drug may be selected from at least one of MG132, BAY 11-7082, bortezomib, sorafenib, DMAPT, LP46, or RS47.
[0067] In practical applications, to achieve a higher and more stable response signal, the concentration of the NF-κB activator or inhibitor is 50–100 ng / mL. This 50–100 ng / mL is any value between 50 and 100 ng / mL, such as 50, 60, 70, 80, 90, 100 ng / mL, or any range between two values. Similarly, to obtain detection results more quickly, the incubation time for the NF-κB activator or inhibitor is 4–6 h. This incubation time is any value between 4 and 6 h, such as 4, 4.5, 5, 5.5, 6, or any range between two values.
[0068] To make the objectives, technical solutions, and advantages of this invention clearer, the invention is further described below with reference to specific embodiments. The advantages and features of this invention will become clearer with this description. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions were performed under conventional conditions in the art or as recommended by the manufacturer. Unless otherwise stated, the experimental materials and reagents used in the following embodiments are commercially available.
[0069] Example 1: Construction of NF-κB reporter gene expression vector In this embodiment, a reporter gene expression vector for NF-κB activity detection was constructed using the PiggyBac (PB) transposon system. The vector comprises the following functional elements from the 5′ end to the 3′ end: (1) First insulator element: The core sequence of the 2×HS4 core insulator is selected to reduce the influence of the exogenous transgene insertion site on transcriptional activity and improve the stability and consistency of the reporter signal. The 2×HS4 core insulator is specifically shown in SEQ ID NO:1.
[0070] (2) NF-κB Response Expression Unit: This expression unit includes a multi-copy tandem NF-κB binding element, a minimal promoter (minP), and a green-emitting luciferase ELUC coding sequence from Brazilian quinquefolius. The NF-κB binding element can be a synthetically produced tandem sequence, as shown in SEQ ID NO:2, used to drive the transcriptional expression of the downstream ELUC when the NF-κB signaling pathway is activated. The minimal promoter is used to reduce the basal transcriptional background and improve the signal-to-noise ratio; the minP shown in SEQ ID NO:3 can be selected. The ELUC incorporates a PEST tag that shortens the protein half-life (as shown in SEQ ID NO:4), enabling the reporter signal to more accurately reflect the transient activation state of the NF-κB pathway, reducing background signal accumulation, and improving the sensitivity and dynamic range of high-throughput screening; the ELUC coding sequence shown in SEQ ID NO:5 can be selected.
[0071] (3) Second insulator element: 2×HS4 core insulators are set downstream of the ELUC expression unit to isolate the upstream and downstream transcription units and avoid transcriptional interference.
[0072] (4) Internal reference expression unit: This unit includes the EF1α constitutive promoter (SEQ ID NO:6) and the SLR coding sequence of red luciferase from the iron worm, which is used to provide a stable internal reference signal under different treatment conditions, as shown in SEQ ID NO:7.
[0073] (5) Screening marker gene: Hygromycin B resistance gene is linked downstream of the SLR expression unit, as shown in SEQ ID NO:8, for drug screening of stable cell lines.
[0074] (6) Third insulator element: 2×HS4 core insulators are set at the end of the entire expression framework to further reduce the influence of the chromatin environment on the overall expression of transgenes.
[0075] The aforementioned expression cassette was cloned into the PiggyBac transposon vector backbone and used together with the transposase expression plasmid for cell transfection.
[0076] like Figure 1 As shown, the expression vector of the present invention comprises, from the 5′ end to the 3′ end, the following: a PiggyBac transposon left-hand repeat sequence (PB 5′ITR); a first insulator module, consisting of at least two HS4 core insulator sequences tandemly; an NF-κB response expression unit, including multiple copies of an NF-κB binding element and a minimal promoter; a first luciferase reporter gene, preferably ELUC, used to reflect NF-κB pathway activity; and a degradation tag that shortens the protein half-life, preferably a PEST tag, fused with the first luciferase for expression, thereby changing the signal from "slow accumulation" to "rapid real-time response," significantly reducing background noise, amplifying the activation signal, and fundamentally improving the signal-to-noise ratio, sensitivity, and data reliability of high-throughput drug screening. The second insulator module is used to isolate adjacent transcription units and reduce transcriptional interference; a constitutive promoter (preferably the EF1α promoter); a second luciferase internal reference gene, preferably an SLR, to reflect cell number and overall transcriptional level; an antibiotic selection marker gene (such as the hygromycin B resistance gene Hygro); a third insulator module; and a right-hand repeat sequence (PB 3′ ITR) of the PiggyBac transposon. This vector, through a triple design of stable expression via insulators, tandem tandem expression of two reporter genes, and PEST tag-accelerated signal response, constructs a stable, low-background, high-dynamic-response NF-κB high-throughput screening system suitable for simultaneous single-substrate detection. In a specific embodiment of this invention, the nucleotide sequence of its expression vector is shown in SEQ ID NO:9.
[0077] Example 2: Construction of a stable NF-κB reporter cell line In this embodiment, the mouse macrophage cell line RAW264.7 was selected as the host cell. The PiggyBac reporter vector described in Example 1 and the transposase expression plasmid were co-transfected into RAW264.7 cells at a certain ratio (e.g., 5:1).
[0078] Resistance selection begins 24-48 hours after transfection by adding hygromycin B to the culture medium, with a preferred final concentration of 500 μg / mL. Selection continues for 7-14 days until all untransfected control cells have died.
[0079] During the screening process, the culture medium containing hygromycin B was replaced regularly, and the cell growth status was observed. After the cell population stabilized, stable monoclonal cell lines could be obtained further using limiting dilution or single-cell cloning methods.
[0080] Functional validation of the obtained stable cell lines was performed, including but not limited to: (1) Background luminescence detection of ELUC and SLR under basic conditions; (2) Induction of ELUC signal after stimulation with NF-κB activator; (3) Consistency of signal intensity and ELUC / SLR ratio among different clones.
[0081] Clones with low basal background, high fold induction, and good reproducibility are preferred as cell models for subsequent screening.
[0082] Using the same construction method as in Example 1, RAW264.7 cells expressing only SLR or ELUC were obtained by removing ELUC or SLR-related sequences.
[0083] Example 3: Optical Decoupling and Normalization Method Figure 2 This invention presents an NF-κB activity detection workflow based on a dual-luciferase reporter system. Through a technical approach of "single substrate, dual luminescence, spectral separation, and mathematical decoupling," it achieves precise quantification of NF-κB signaling pathway activity. The workflow begins with NF-κB reporter cells. After adding a single luciferase substrate, the cells simultaneously generate two luminescent signals (green and red) with overlapping spectra. The original signals F1 and F2 are separated by the filter channels of a microplate reader. Then, using pre-calibrated filter transmittance coefficients and a decoupling algorithm (E=aF1+bF2, R=cF1+dF2), the target signal E representing NF-κB pathway activity and the stable signal R serving as an internal control are calculated. Finally, normalization (NF-κB activity = E / R) eliminates systematic errors, achieving precise and robust detection of pathway activity.
[0084] A multi-channel emission detector is used to acquire two emission signal channels through filters with different wavelength ranges. Preferably, one channel mainly reflects the emission signal of the ELUC, and the other channel mainly reflects the emission signal of the SLR. Preferred filters are F53030 (530 nm, 515-545 nm) and F61060 (610 nm, 580-640 nm).
[0085] The specific calculation method is as follows: First, measure the "filter transmittance coefficient" of the two luciferases, and then use the test value of the mixed sample to infer the true content.
[0086] True luciferin content (corresponding luminescence amount) of ELUC: denoted as E; True luciferin content (corresponding luminescence amount) of SLR: denoted as R; Filter F53030 (530 nm, 515-545 nm): Transmittance coefficient for ELUC green light denoted as T1e, transmittance coefficient for SLR red light denoted as T1r; Filter F61060 (610 nm, 580-640 nm): Transmittance coefficient for ELUC green light denoted as T2e, transmittance coefficient for SLR red light denoted as T2r; Detection values of mixed samples (single cell lines expressing two luciferases): The amount of light measured using filter F53030 is denoted as F1, and the amount of light measured using filter F61060 is denoted as F2.
[0087] (1) Determine the transmittance coefficients (T1e, T1r, T2e, T2r). Referring to Examples 1 and 2, SLR-related genes were removed, and cells expressing only ELUC (without SLR) were prepared using the same method. Without any filters, all light emitted by ELUC was directly measured and recorded as Etotal. Using a filter (530 nm), the amount of light passing through filter F53030 of ELUC was measured and recorded as E1. Using a filter (610 nm), the amount of light passing through filter F61060 of ELUC was measured and recorded as E2. The coefficients were calculated as follows: T1e = E1 / Etotal; T2e = E2 / Etotal. Similarly, the transmittance of SLR was detected, and the coefficients T1r and T2r were obtained respectively.
[0088] (2) Measure the detection values F1 and F2 of the mixed sample, and calculate the luminescence of ELUC and SLR. For mixed samples of ELUC and SLR (single cell lines expressing two luciferases), the following values were measured using a filter (530 nm): F1 = (ELUC light intensity through filter F53030) + (SLR light intensity through filter F53030) = T1e × E + T1r × R; and F2 = (ELUC light intensity through filter F61060) + (SLR light intensity through filter F61060) = T2e × E + T2r × R.
[0089] Substitute the coefficient values determined in step (1) and solve the equation to calculate E, R and their ratio ELUC / SLR.
[0090] Example 4: System Specificity Verification To verify the specific response capability of the NF-κB-binding element-based ELUC / SLR dual reporter system constructed in this invention to the NF-κB signaling pathway and its reliability in drug screening, systematic functional verification experiments were conducted on the obtained stable cell lines, specifically including kinetic response, dose dependence, pathway specificity, and high-throughput screening applicability assessment.
[0091] (1) Verification of the dynamic response of the NF-κB signaling pathway The stable cell line obtained in Example 2 was seeded in multi-well plates. After cell adhesion, lipopolysaccharide (LPS) was added at different time points as an inflammatory stimulus, with a final concentration of 100 ng / mL. Samples were collected at 0, 0.5, 1, 3, 6, and 12 h after stimulation and subjected to luminescence detection.
[0092] During detection, without changing the substrate (D-luciferase), luminescence signals were acquired using 530 nm and 610 nm filters, respectively. Signal conversion and normalization were performed according to the method described in Example 3, and the ELUC / SLR ratio was calculated. The results showed that the ELUC / SLR ratio rapidly increased within 0.5–6 h after stimulation, reaching a peak at approximately 4–6 h, and then gradually decreased, consistent with the kinetic characteristics of rapid activation of the NF-κB signaling pathway.
[0093] (2) Validation of dose-dependent response of NF-κB signaling pathway At the optimal stimulation time point (6 h) determined above, stable cell lines were stimulated with different concentrations of LPS, ranging from 10, 50, 100, 250, and 500 ng / mL. After stimulation, luminescence detection was performed and the ELUC / SLR ratio was calculated in the same manner.
[0094] The results showed that the ELUC / SLR ratio increased significantly in a dose-dependent manner with increasing LPS concentration, reaching a high and stable response level in the range of 50-100 ng / mL, while the luminescence intensity of SLR remained basically constant among the groups, indicating that the changes in ELUC signal in the system of this invention mainly reflect the activation degree of the NF-κB pathway.
[0095] (3) Pharmacological validation of pathway specificity To further verify the specificity of this system for the NF-κB signaling pathway, TPCA-1, a known NF-κB pathway inhibitor, was added to cells as a pretreatment 1 h before LPS stimulation, while the control group received an equal volume of solvent. Cells were then stimulated with 100 ng / mL LPS for 6 h before luminescence detection.
[0096] The results showed that inhibitor pretreatment significantly reduced the LPS-induced increase in the ELUC / SLR ratio, and the degree of inhibition increased with increasing inhibitor concentration, indicating that the activation of the reporter system of this invention depends on the intact function of the NF-κB pathway.
[0097] (4) Stability verification of the ELUC / SLR normalization strategy LPS stimulation experiments were repeated under different batches of cells and different seeding densities, and the original ELUC luminescence values and ELUC / SLR ratios were analyzed. The results showed that although the original ELUC luminescence values fluctuated under different experimental conditions, the ELUC / SLR ratio after SLR internal reference correction had a significantly lower coefficient of variation, indicating that the same-vector dual-reporter normalization strategy used in this invention can effectively eliminate the influence of differences in cell number and overall transcriptional level.
[0098] (5) Applicability assessment of high-throughput screening Under optimal stimulation conditions, a strong NF-κB activation group (LPS treatment) and a negative control group (vehicle treatment) were set up, and repeated tests were performed in multi-well plates. The mean and standard deviation of the ELUC / SLR ratio of the two groups were calculated, and the Z′ value was calculated accordingly.
[0099] The results showed that the Z′ value of the system was greater than 0.5, indicating that the NF-κB reporter system had a good signal-to-noise ratio and repeatability, and was suitable for high-throughput anti-inflammatory drug screening.
[0100] Example 5: Application of anti-inflammatory drug screening In this embodiment, the above-mentioned stable cell line was used for NF-κB activity detection and preliminary screening of anti-inflammatory drugs. The specific procedure is as follows: Figure 3 As shown, stable NF-κB reporter cells were seeded in multi-well plates; the test compound was added for pretreatment; NF-κB activator or inhibitor was added; after incubation, a single luciferase substrate was added; dual-channel emission signals were simultaneously acquired through filters of different wavelengths; signal decoupling calculation was performed based on the transmittance coefficient of the filters; the ELUC / SLR ratio was calculated as an indicator of NF-κB activity; the screening results were output and candidate compounds were determined.
[0101] The specific steps are as follows: (1) Cell inoculation The stable cells prepared in Example 2 were seeded into multi-well plates, preferably 96-well or 384-well plates, to make the detection more suitable for high-throughput screening. After seeding, the cells were cultured until they adhered and reached an appropriate density. Preferably, 5000 RAW264.7 cells were seeded into each 384-well plate.
[0102] (2) Treatment of candidate compounds The compound to be screened is added to each well. The compound can be a small molecule compound, a natural product extract, or a derivative thereof. Pretreatment of cells for 0.5-2 hours before NF-κB activation is preferred; in this embodiment, 1 hour is preferred.
[0103] (3) NF-κB activation treatment After pretreatment, an NF-κB activator, such as lipopolysaccharide (LPS), is added to each well, preferably at a final concentration of 100 ng / mL, and incubation continues for 4-8 hours, preferably 6 hours in this embodiment.
[0104] (4) Luminescence detection After incubation, the culture medium in the well plate was removed by centrifugation. The plate was then frozen at -80°C for at least 2 hours and brought to room temperature. Lysis buffer and the luciferase substrate D-luciferin were added to each well, simultaneously exciting ELUC and SLR luminescence signals. The preferred final concentration of the substrate was 0.5 mM. The lysis buffer composition was as follows: Potassium Phosphate Buffer 25 mM, NaCl 50 mM, MgSO4 5 mM, ATP 0.25 mM, DTT 1 mM, EGTA 0.1 mM, Coenzyme A 0.1 mM, Glycylglycine 25 mM, D luciferin 0.5 mM, Triton 1%.
[0105] A multi-channel emission detector is used to acquire two emission signal channels through filters with different wavelength ranges. Preferably, one channel mainly reflects the emission signal of the ELUC, and the other channel mainly reflects the emission signal of the SLR. Preferred filters are F53030 (530 nm, 515-545 nm) and F61060 (610 nm, 580-640 nm).
[0106] (5) Signal conversion, normalization and high-throughput calculation methods In order to improve detection efficiency and ensure the stability and repeatability of calculation results under high-throughput drug screening conditions, this invention adopts a batch calculation method based on linear equations to convert and normalize the luminescence signal.
[0107] Specifically, after obtaining the transmittance coefficients T1e, T1r, T2e, and T2r of the filter, the following system of linear equations can be established for each aperture to be measured: F1 = T1e × E + T1r × R F2 = T2e × E + T2r × R Wherein, F1 and F2 are the original emission values measured at the corresponding aperture positions under the conditions of 530 nm and 610 nm filters, and E and R represent the actual emission contribution values of ELUC and SLR in the aperture position, respectively.
[0108] In the high-throughput screening process, the above equations can be solved automatically in batches by computer programs. The methods used include, but are not limited to: direct linear solution based on matrix inversion; linear fitting solution based on least squares method; and automatic calculation process implemented by Python, R, MATLAB or commercial high-throughput screening analysis software.
[0109] In this embodiment, a linear algebra direct solution method is preferred. The F1 and F2 data of each pore are input into a preset calculation model, and the corresponding E and R values are automatically output. The ELUC / SLR ratio is further calculated as a normalized index of the NF-κB activity of that pore.
[0110] This calculation method has the following advantages: ① The calculation model is well-defined and requires no empirical parameters; ② It is applicable to 96-well, 384-well and higher throughput formats; ③ It can be seamlessly integrated with automated liquid workstations and data analysis software.
[0111] (6) To eliminate false positive results, the candidate compounds obtained from the initial screening are re-screened and verified. The re-screening steps include, but are not limited to: ① Dose gradient screening: Multiple concentration gradients were set for candidate compounds to detect their dose-dependent inhibitory effect on the ELUC / SLR ratio; ② Repeated experimental verification: Repeat the screening experiment at different batches of cells and at different time points to verify the stability of the results; ③ Cell viability exclusion assay: Simultaneously detect the effect of candidate compounds on cell viability to exclude false inhibition caused by cytotoxicity; ④ Pathway correlation verification: Combine NF-κB target gene expression detection or immunological methods to further verify the anti-inflammatory mechanism of candidate compounds.
[0112] The gene sequence information mentioned in this invention is as follows. Unless otherwise specified, gene sequences not specifically described herein are those that can be directly obtained by those skilled in the art through existing publicly available literature or technology: SEQ ID NO:1: 2×HS4 core insulator ccgggtaccgagttgggagctcacggggacagcccccccccaaagcccccagggatgtaattacgtccctcccccgctagggggcagcagcgagccgcccggggctccgctccggtccggcgctccccccgcatccccgagccggcagcgtgcggggacagcccgggcacggggaaggtggcacgggatcgctttcctctgaacgcttctcgctgctctttgagcctgcagacacctggggggatacggggaaaaagctttaggctgaaagagagatttagaatgacagtctagtgggagctcacggggacagcccccccccaaagcccccagggatgtaattacgtccctcccccgctagggggcagcagcgagccgcccggggctccgctccggtccggcgctccccccgcatccccgagccggcagcgtgcggggacagcccgggcacggggaaggtggcacgggatcgctttcctctgaacgcttctcgctgctctttgagcctgcagacacctggggggatacggggaaaaagctttaggctgaaagagagatttagaatgacagaactcgatttcattgcagactggccggcctaggaacttccgat SEQ ID NO:2: NF-κB binding element GGGAATTTCCGGGGACTTTCCGGGAATTTCCGGGGACTTTCCGGGAATTTCC SEQ ID NO:3: Minimal promoter TAGAGGGTATATAATGGAAGCTCGACTTCCAG SEQ ID NO:4: PEST tag agccatggcttcccgccggaggtggaggagcaggctgctggcacgctgcccatgtcttgtgcccaggagagcgggatggaccgtcaccctgcagcctgtgcttctgctaggatcaatgtg SEQ ID NO:5: ELUC coding sequence SEQ ID NO:6: EF1α constitutive promoter SEQ ID NO:7: SLR encoded sequence SEQ ID NO:8: Hygromycin B resistance gene SEQ ID NO:9: NF-κB reporter gene expression vector The above description is merely an exemplary embodiment of the present invention. It should be noted that those skilled in the art can make improvements to the present invention without departing from the inventive concept, and all such improvements fall within the scope of protection of the present invention.
Claims
1. A cell model for detecting NF-κB activity, characterized in that, The cell model was obtained by stably integrating an NF-κB active reporter gene expression vector into the host cell genome through a transposon system. The NF-κB active reporter gene expression vector includes an insulator element, an NF-κB response expression unit containing the luciferase reporter gene ELUC, and an internal reference expression unit containing the internal reference gene SLR.
2. The cell model for NF-κB activity detection according to claim 1, characterized in that, Meet at least one of the following: The insulator element is a series-connected HS4 core insulator, and its nucleotide sequence is shown in SEQ ID NO:1; preferably, there are 1 to 3 insulator elements; The nucleotide sequence of ELUC is shown in SEQ ID NO:5; The luciferase reporter gene is also fused with a PEST tag; preferably, the PEST tag is as shown in SEQ ID NO:4; The nucleotide sequence of the internal reference gene SLR is shown in SEQ ID NO:
7.
3. The cell model for NF-κB activity detection according to claim 1 or 2, characterized in that, The NF-κB activity reporter gene expression vector contains the following elements: (1) First insulator element; (2) NF-κB response expression unit: contains tandem NF-κB binding elements, a minimal promoter, and a luciferase ELUC coding sequence; (3) Second insulator element: located downstream of the ELUC expression unit; (4) Internal reference expression unit: including the EF1α constitutive promoter and the luciferase SLR coding sequence; (5) Screening for marker genes; (6) Third insulator element: located at the end of the expression box.
4. The cell model for NF-κB activity detection according to claim 3, characterized in that, Meet at least one of the following: The nucleotide sequence of the NF-κB binding element is shown in SEQ ID NO:2; The minimum promoter nucleotide sequence is shown in SEQ ID NO:3; The constitutive promoter nucleotide sequence of the EF1α is shown in SEQ ID NO:
6.
5. The cell model for NF-κB activity detection according to claim 4, characterized in that, The NF-κB active reporter gene expression vector contains the gene sequence shown in SEQ ID NO:
9.
6. The cell model for NF-κB activity detection according to claim 1, characterized in that, The host cell is selected from at least one of RAW264.7, HEK293 and its derivatives, THP-1, HeLa, HCT116, Hep G2, A549 or Jurkat cell lines; the transposon system used to construct the reporter gene expression vector is selected from at least one of piggyBac or Sleeping Beauty.
7. The method for constructing a cell model for NF-κB activity detection according to any one of claims 1 to 6, characterized in that, The process includes the following steps: using genetic engineering techniques, inserting the NF-κB active reporter gene expression cassette into the transposon system, followed by cell transfection, resistance selection, purification, and obtaining a cell line that stably expresses the NF-κB active reporter gene.
8. A detection method for detecting NF-κB activity, characterized in that, Includes the following steps: (1) After adding a single luciferase substrate to the NF-κB activity detection cell model obtained by any one of claims 1 to 6, the cells are allowed to simultaneously generate two luminescent signals with spectral overlap characteristics. (2) Then, the original signals F1 and F2 are obtained by separating them through filters of different wavelength ranges. The target signal E representing the activity of the NF-κB pathway and the stable signal R as an internal reference are calculated by using the pre-calibrated filter transmittance coefficient and the decoupling algorithm E=aF1+bF2, R=cF1+dF2. (3) The systematic error can be eliminated by normalizing the NF-κB activity = E / R.
9. The detection method for NF-κB activity detection according to claim 8, characterized in that, In step (2) of the test, the pre-calibrated transmittance coefficient of the filter is obtained by the following method: The transmittance coefficient of the reporter gene ELUC under filter 1 is denoted as T1e, and the transmittance coefficient of the internal reference gene SLR is denoted as T1r. The transmittance coefficient of the reporter gene ELUC under filter 2 is denoted as T2e, and the transmittance coefficient of the internal reference gene SLR is denoted as T2r. ① Prepare cells that express only ELUC, without using a filter, and directly measure all the light emitted by ELUC, which is recorded as Etotal; ② Collect the amount of light passing through ELUC cells using filter 1, and record it as E1; ③ Collect the amount of light passing through ELUC cells using filter 2, and record it as E2; ④ Calculate the transmittance coefficient of the filter: T1e = E1 / Etotal; T2e = E2 / Etotal; Similarly, prepare cells that express only the internal reference gene SLR to obtain the transmittance coefficient of the internal reference gene SLR.
10. The application of the NF-κB activity detection cell model in the screening of anti-inflammatory drugs, characterized in that... The screening method used includes the following steps: (1) The cell model for NF-κB activity detection obtained according to any one of claims 1 to 6 is seeded into a multi-well plate and the test compound is added for pretreatment; (2) Add NF-κB activator or inhibitor, and add single luciferase substrate after incubation; (3) Simultaneously acquire dual-channel emission signals through filters of different wavelengths; perform signal decoupling calculation based on the transmittance coefficient of the filters; calculate the ratio E / R of the target signal E representing the activity of the NF-κB pathway and the stable signal R used as an internal reference as the NF-κB activity index; output the screening results and determine the candidate compounds.
Citation Information
Patent Citations
CN102492657A
CN107841488A