Anti-chicken foxp3 monoclonal antibody, hybridoma cell strain secreting the monoclonal antibody and application thereof
By preparing the hybridoma cell line chFoxp3-G2-4, which contains an anti-chicken Foxp3 monoclonal antibody, and the monoclonal antibody it secretes, the problem of detecting Foxp3 protein in poultry has been solved, enabling efficient detection of chicken Treg cells and supporting the evaluation of vaccine immune responses and the development of inflammation regulation strategies.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HARBIN VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES (CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER HARBIN BRANCH CENTER)
- Filing Date
- 2026-06-17
- Publication Date
- 2026-07-14
Smart Images

Figure CN122382014A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to an anti-chicken Foxp3 monoclonal antibody, and also to a hybridoma cell line that secretes this monoclonal antibody and its applications. This invention belongs to the field of biopharmaceuticals. Background Technology
[0002] Regulatory T cells (Tregs) are a core suppressive subset of cells that maintain immune homeostasis and prevent excessive inflammatory responses. Their development and function are highly dependent on the transcription factor Foxp3 (Forkhead box P3). Tregs exert negative regulation on effector T cells, B cells, dendritic cells, and innate immune cells through two pathways: cell-cell contact (CTLA-4, LAG-3) and the secretion of suppressive cytokines (IL-10, TGF-β). In mammals, Foxp3 has become the "gold standard" molecule for identifying, tracing, expanding, or depleting Tregs; however, in birds, especially the chicken (Gallus gallus) model, Treg research has long been limited by the lack of species-specific tools, leading to questions about whether functionally conserved Foxp3 exists in chickens. + Fundamental questions such as "How do chicken Tregs act as an immune brake during persistent viral infection?" remain unresolved, directly hindering the evaluation of avian vaccine efficacy and the development of inflammation control strategies.
[0003] Recent studies have found that chickens also possess the Foxp3 gene, and chicken Foxp3 is a specific marker for Treg cells. However, due to the lack of chicken-specific Foxp3 antibodies, research on chicken Treg cells is currently limited to CD4+. + CD25 + The T cell phenotype is ambiguous. Currently, Treg function can only be indirectly inferred using "mean CD25 fluorescence intensity" or "IL-10 / IFN-γ ratio," resulting in poor experimental reproducibility and the inability to compare data across laboratories. Therefore, a chicken Foxp3-specific monoclonal antibody was prepared, and CD4 was used to establish... + CD25 + FoxP3 + Treg cell flow cytometry provides an important tool for studying the regulatory role of Tregs in the pathogenesis of avian immunosuppressive pathogens.
[0004] Infections with Marek's disease virus (MDV), avian leukosis virus (ALV), and avian influenza virus (AIV) can all induce CD4. + CD25 + Cellular proliferation leads to increased viral load and decreased vaccine protection. For example, with MDV, CD4 counts in peripheral blood of chickens are visible 7 days after infection with a virulent strain. +CD25 + While the proportion of cells increased 3–5 times, direct evidence has been lacking regarding whether Foxp3 protein expression was synchronously upregulated and whether this upregulation mediated the suppression of cytotoxic T cell function. Currently available commercial anti-mammalian Foxp3 antibodies share only about 50% homology with chicken Foxp3, exhibiting weak cross-reactivity. Therefore, commercially available human and mouse Foxp3 antibodies cannot be used for Western blot and flow cytometry detection of chicken-derived Foxp3.
[0005] In mammals, Foxp3-EGFP reporter mice and Foxp3-DTR (diphtheria toxin receptor) depletion models have become standard tools for studying inflammatory diseases and tumor immunotherapy. In contrast, chicken embryos have a short manipulation window and gene modification technology is still in its early stages, with no Foxp3 fluorescent reporter chickens or transgenic lines capable of inducing Treg depletion. If highly specific anti-chicken Foxp3 monoclonal antibodies can be obtained, the gap in transgenic models can be filled by using antibodies to bridge the gap through fluorescent labeling, magnetic bead sorting, antibody-drug conjugates (ADCs), or antibody-mediated cell depletion. This would provide a direct means to track Treg migration in vivo in real time and analyze their immune braking effect in persistent viral infection. Summary of the Invention
[0006] The purpose of this invention is to provide an anti-chicken Foxp3 monoclonal antibody, a hybridoma cell line that secretes the monoclonal antibody, and its applications.
[0007] To achieve the above objectives, the present invention employs the following technical means:
[0008] On the one hand, the present invention proposes a hybridoma cell line that secretes a monoclonal antibody against chicken transcription factor Foxp3 (Forkhead box P3). The hybridoma cell line is named chFoxp3-G2-4 and is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC No. C202635 and accession date of April 16, 2026.
[0009] On the other hand, the present invention also proposes a monoclonal antibody against chicken Foxp3, wherein the monoclonal antibody is secreted by the hybridoma cell line described above.
[0010] Furthermore, this invention also proposes the application of the aforementioned anti-chicken Foxp3 monoclonal antibody in the preparation of reagents for detecting chicken transcription factor Foxp3.
[0011] Preferably, the chicken transcription factor Foxp3 is a eukaryotic Foxp3 protein, a prokaryotic Foxp3 protein, or an endogenous Foxp3 protein.
[0012] Preferably, the chicken transcription factor Foxp3 is the chicken transcription factor Foxp3 found in regulatory T cells (Treg).
[0013] Furthermore, the present invention also proposes a method for detecting Foxp3 protein in chicken Treg cells for non-diagnostic purposes, comprising the steps of isolating chicken peripheral blood lymphocytes, obtaining peripheral blood mononuclear cells, adding anti-chicken CD3, CD4, and CD25 antibodies to stain the cell surface, using the aforementioned anti-chicken Foxp3 monoclonal antibody for intracellular staining, and using flow cytometry to acquire data.
[0014] Preferably, the method includes the following steps:
[0015] (1) Chicken peripheral blood lymphocytes were separated by density gradient centrifugation: 5 mL of chicken peripheral blood lymphocyte separation solution was added to a 15 mL centrifuge tube, and 5 mL of peripheral blood from SPF chickens was gently added to the upper layer. The tube was centrifuged at room temperature and 750 g on a horizontal rotor for 30 min.
[0016] (2) Obtaining peripheral blood mononuclear cells (PBMCs): Carefully aspirate the second layer of ring-shaped milky white lymphocytes using a pipette to obtain peripheral blood mononuclear cells. Wash twice with PBS buffer to remove residual separation solution. Remove red blood cells from all cells using red blood cell lysis buffer and wash twice with PBS buffer. Finally, adjust the cell suspension concentration to 1×10⁻⁶. 7 -3×10 7 cells / mL;
[0017] (3) Take 1×10 6 -3×10 6 Surface staining of individual cells: Add anti-chicken CD3, CD4, and CD25 antibodies and incubate on ice in the dark for 30 minutes.
[0018] (4) Intracellular staining: After washing the cells in step (3) with PBS, fix and perforate them with Foxp3 / transcription factor staining buffer, then add the monoclonal antibody against chicken Foxp3 for intracellular staining, and incubate at room temperature in the dark for 60 minutes.
[0019] (5) Data acquisition using flow cytometry: After washing the cells in step (4) with PBS, the cells were incubated at room temperature in the dark for 60 minutes with APC-labeled goat anti-mouse IgG as the secondary antibody. After washing with PBS, the cells were resuspended in PBS containing 1% w / w BSA. Data were acquired using flow cytometry, and CD25 was analyzed. + FoxP3 +The proportion of T cells.
[0020] Furthermore, this invention also proposes a method for detecting Foxp3 protein in Treg cells of chicken peripheral immune organs for non-diagnostic purposes, comprising the steps of cutting chicken peripheral immune organs into small pieces under sterile conditions, preparing a single-cell suspension by filtering through a cell sieve, adding anti-chicken CD3, CD4, and CD25 antibodies to stain the cell surface, performing intracellular staining using the aforementioned anti-chicken Foxp3 monoclonal antibody, and acquiring data using a flow cytometer.
[0021] Preferably, the method includes the following steps:
[0022] (1) Take peripheral immune organs of chickens, cut them into pieces under sterile conditions, and filter them through a 40 μm cell sieve to prepare a single cell suspension; take a centrifuge tube, add an equal amount of separation liquid to the single cell suspension, add the single cell suspension to the surface of the separation liquid, and centrifuge at room temperature;
[0023] (2) Obtaining mononuclear cells: Carefully aspirate the second layer of ring-shaped milky white cells with a pipette, wash twice with PBS buffer to remove residual separation solution, remove red blood cells from all cells using red blood cell lysis buffer, and wash twice with PBS buffer. Finally, adjust the cell suspension concentration to 1×10⁻⁶. 7 -3×10 7 cells / mL;
[0024] (3) Take 1×10 6 -3×10 6 Surface staining of individual cells: Add anti-chicken CD3, CD4, and CD25 antibodies and incubate on ice in the dark for 30 minutes.
[0025] (4) Intracellular staining: After washing the cells in step (3) with PBS, fix and perforate them with Foxp3 / transcription factor staining buffer, then add the monoclonal antibody against chicken Foxp3 for intracellular staining, and incubate at room temperature in the dark for 60 minutes.
[0026] (5) Data acquisition using flow cytometry: After washing the cells in step (4) with PBS, the cells were incubated at room temperature in the dark for 60 minutes with APC-labeled goat anti-mouse IgG as the secondary antibody. After washing with PBS, the cells were resuspended in PBS containing 1% w / w BSA. Data were acquired using flow cytometry, and CD25 was analyzed. + FoxP3 + The proportion of T cells.
[0027] Preferably, the peripheral immune organs include the spleen and cecal tonsils.
[0028] Applications of methods for detecting chicken Treg cell Foxp3 protein in cells for non-diagnostic purposes and for detecting chicken Treg cell Foxp3 protein in peripheral immune organ samples for non-diagnostic purposes (not the process of identifying, studying, and determining the etiology or lesion status in living humans or animals) include, but are not limited to, the following:
[0029] (1) Used to analyze the developmental trajectory of regulatory T cells in the chicken immune system.
[0030] (2) In the vaccine-inoculated chicken experiment, the levels of Foxp3 in immune organs were detected. + The dynamic changes of Treg cells are used to comprehensively evaluate the strength of the vaccine-induced immune response and the state of immune balance.
[0031] Compared with the prior art, the beneficial effects of the present invention are:
[0032] This invention provides a hybridoma cell line that secretes a monoclonal antibody against the chicken transcription factor Foxp3, and the monoclonal antibody secreted by this hybridoma cell line. The antibody titer in the ascites fluid is 1:215, indicating it is of the IgG1κ type. Experiments have demonstrated that the monoclonal antibody can recognize eukaryotic Foxp3 expressed protein, prokaryotic Foxp3 expressed protein, or endogenous Foxp3 protein, and can be used for Foxp3 detection in Treg cell flow cytometry. A core bottleneck in chicken Treg research is the lack of tools at the Foxp3 protein level. This invention fills the gap in avian Treg research from the "genetic level" to the "protein level" by preparing a highly specific anti-chicken Foxp3 monoclonal antibody, providing a technical means to elucidate the molecular mechanism of chicken Tregs in viral immune escape and to clarify the correlation between abnormal Foxp3 expression and disease occurrence. Attached Figure Description
[0033] Figure 1 Phylogenetic tree diagrams of the Foxp3 gene in chickens and different species;
[0034] Figure 2 A statistical graph showing the ELISA titer of Foxp3 antibody in the serum of immunized mice;
[0035] Figure 3 Statistical graph of ELISA titer results for chicken Foxp3 monoclonal antibody G2-4;
[0036] Figure 4 Ig class / subclass identification diagram for chicken Foxp3 monoclonal antibody G2-4;
[0037] Figure 5 A photograph of the Western blot results of chicken Foxp3 monoclonal antibody G2-4 on prokaryotic Foxp3 protein expression;
[0038] Figure 6 Photographs showing the IFA results of chicken Foxp3 monoclonal antibody G2-4 against eukaryotic Foxp3 protein;
[0039] In this study, A was the positive control (293T cells were transfected with the recombinant eukaryotic expression plasmid pCAGGS-Foxp3-HA, using mouse anti-HA antibody (Sigma) as the primary antibody and FITC-labeled goat anti-mouse IgG (Sigma) as the secondary antibody); B was the negative control (293T cells were transfected with the empty plasmid pCAGGS, using monoclonal antibody G2-4 as the primary antibody and FITC-labeled goat anti-mouse IgG (Sigma) as the secondary antibody); C was the G2-4 group (293T cells transfected with pCAGGS-Foxp3-HA were tested, using monoclonal antibody G2-4 as the primary antibody and FITC-labeled goat anti-mouse IgG (Sigma) as the secondary antibody); the scale bar was 400 μm.
[0040] Figure 7 A photograph of the Western blot results of chicken Foxp3 monoclonal antibody G2-4 on eukaryotic Foxp3 protein expression;
[0041] Figure 8 Image showing the Western blot results of chicken Foxp3 monoclonal antibody G2-4 on endogenous Foxp3 protein in MSB-1 cells; scale bar is 200 μm.
[0042] Figure 9 The results of flow cytometry analysis of chicken Foxp3 monoclonal antibody G2-4 on PBMCs and Foxp3 protein in chicken immune organs;
[0043] In this table, A represents the flow cytometry results of Foxp3 protein in PBMCs; B represents the flow cytometry results of Foxp3 protein in the spleen; and C represents the flow cytometry results of Foxp3 protein in the cecal tonsils.
[0044] Cell Preservation Information:
[0045] Nomenclature: Hybridoma cell line chFoxp3-G2-4
[0046] Hybridoma cell line chFoxp3-G2-4
[0047] Classification and nomenclature: Hybridoma cell line chFoxp3-G2-4
[0048] Hybridoma cell line chFoxp3-G2-4
[0049] Preservation Institution: China Center for Type Culture Collection
[0050] Address: Wuhan University, Wuhan, China
[0051] Accession number: CCTCC No. C202635
[0052] Preservation date: April 16, 2026. Detailed Implementation
[0053] To make the objectives, technical solutions, and advantages of the present invention clearer, the embodiments of the present invention will be described in further detail below with reference to the accompanying drawings.
[0054] Materials and instruments not described in this invention are conventional materials and instruments in the art. Operational details not described in this invention are conventional operations in the art. The software used in this invention is operated by conventional methods in accordance with the software provider's instructions. The reagent kits used in this invention are operated by conventional methods in accordance with the reagent kit's instruction manual.
[0055] The nucleic acid sequences shown in this invention are all written from left to right in the direction from 5' to 3', and the protein sequences are written from left to right in the direction from N-terminus to C-terminus.
[0056] Example 1: Preparation of Foxp3 protein in chicken Treg cells
[0057] 1. Amplification of the chicken Foxp3 gene
[0058] Based on the chicken Foxp3 gene sequence (GenBank accession number MT133687.1), forward and reverse primers Foxp3-F (SEQ ID NO.1) and Foxp3-R (SEQ ID NO.2) were designed to amplify the full-length chicken Foxp3 gene. Well-cultured MSB-1 cells were used, and total RNA was extracted from MSB-1 cells using an RNA extraction kit (purchased from Bao Engineering (Dalian) Co., Ltd.) according to the kit's instructions. The total RNA was then reverse transcribed into cDNA using a reverse transcription kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.) according to the kit's instructions. Using the cDNA as a template, the chicken Foxp3 gene sequence was amplified using primers Foxp3-F and Foxp3-R. The PCR reaction system was as follows: 2×PrimeSTAR 25 μL, forward primer 1 μL, reverse primer 1 μL, ddH2O 21 μL, template 2 μL, total 50 μL. PCR reaction program: 98℃ for 5 min; 98℃ for 10 s, 55℃ for 30 s, 72℃ for 1 min, 35 cycles; extension at 72℃ for 10 min. The PCR amplification product (amplified fragment 1) was identified by 1% agarose gel electrophoresis, and the target fragment was purified and recovered using a gel extraction kit (Omega) according to the manufacturer's instructions. The purified target gene was stored at -20℃ for later use.
[0059] Foxp3-F: ATGGCGGGTGCCCGGG
[0060] Foxp3-R:TCAGCTCCGTGGGGGCAGAAA
[0061] 2. Construction of Foxp3 gene recombinant eukaryotic expression vector
[0062] The upstream and downstream primers Foxp3-pCAGGS-F (SEQ ID NO.3) and Foxp3-pCAGGS-HA-R (SEQ ID NO.4) were designed to clone chicken Foxp3 into the eukaryotic vector pCAGGS.
[0063] Foxp3-pCAGGS-F: CTCATCATTTTGGCAAAGAATTCGCCACCATGGCGGGTGCCCGGGACCC
[0064] Foxp3-PCAGGS-HA-R: TTTGGCAGAGGGAAAAAGATCTAGCGTAATCTGGAACATCGTATGGGTATCAGCTCCGTGGGGGCAGAAAG
[0065] Using the purified amplified fragment 1 as a template, the amplified fragment 2 was obtained by PCR amplification with primers Foxp3-pCAGGS-F and Foxp3-pCAGGS-HA-R. The eukaryotic expression vector pCAGGS was double-digested with EcoRI and BgI II restriction endonucleases, respectively. Homologous recombination of the recovered pCAGGS vector with the purified amplified fragment 2 was performed using a homologous recombination kit (Novozan) according to the manufacturer's instructions. The correctly identified Foxp3 eukaryotic expression recombinant plasmid, confirmed by Sanger sequencing, was named pCAGGS-Foxp3-HA.
[0066] Sequencing results showed that the amplified chicken Foxp3 gene was 882 bp long, encoding 294 amino acids, and its nucleotide sequence was completely identical to that of the chicken Foxp3 reference gene in GenBank (GenBank accession number MT133687.1), with a homology rate of 100%. The nucleotide sequence of the chicken Foxp3 gene is shown in SEQ ID NO.5, and its encoded amino acid sequence is shown in SEQ ID NO.6.
[0067] 3. Construction of a prokaryotic expression vector for the chicken ΔR-Foxp3 gene after codon optimization in *E. coli*
[0068] Based on the chicken Foxp3 gene sequence (GenBank accession number MT133687.1), codon optimization for *E. coli* was commissioned to Jilin Kumei Co., Ltd. Based on protein domain analysis, a truncated version of the nucleotide sequence encoding amino acids 1 to 206 was designed and named ΔR-Foxp3. The optimized nucleotide sequence of the chicken ΔR-Foxp3 gene is shown in SEQ ID NO. 7. Specific primers ΔR-Foxp3-pCold-F (SEQ ID NO. 8) and ΔR-Foxp3-pCold-R (SEQ ID NO. 9) were designed for PCR amplification (amplified fragment 3).
[0069] ΔR-Foxp3-pCold-F:ATGGAGCTCGGTACCCTCGAGGCAGGTGCACGCGATCCGCTG
[0070] ΔR-Foxp3-pCold-R:GACAAGCTTGAATTCGGATCCTTAACTACGCGGCGGCAGAAA
[0071] The prokaryotic expression vector pColdⅠ (TaKaRa) was double-digested with Xho I and BamH І restriction endonucleases, respectively. Using a homologous recombination kit (Novozan), the recovered pColdⅠ vector was ligated with the previously purified amplified fragment 3 via homologous recombination according to the manufacturer's instructions. The Foxp3 prokaryotic expression recombinant plasmid, correctly identified by Sanger sequencing, was named pCold-ΔR-Foxp3.
[0072] Phylogenetic trees of the Foxp3 gene nucleotide sequences of chicken (GenBank accession number MT133687.1), tit (Foxp3 gene GenBank accession number NM_001323961.1), parrot (Foxp3 gene GenBank accession number XM_030475460.1), zebrafish (FenBank accession number FJ906821.1), mouse (Foxp3 gene GenBank accession number DQ387959.1), pig (Foxp3 gene GenBank accession number NM_001128438.1), sheep (Foxp3 gene GenBank accession number NM_001144947.1), and human (Foxp3 gene GenBank accession number EF534714.1) were constructed using MAGA 6.0 software.
[0073] The results are as follows Figure 1As shown in the figure. Specifically, chicken Foxp3 is more closely related to ducks, tits, parrots, and pigeons, with a nucleotide homology of about 80%; while chicken Foxp3 is more distantly related to humans, mice, and pigs, with a nucleotide homology of less than 50%.
[0074] 4. Expression and purification of chicken ΔR-Foxp3
[0075] The recombinant plasmid pCold-ΔR-Foxp3 was transformed into competent BL21(DE3) cells. Single colonies were picked and inoculated into 4 mL of LB medium containing ampicillin and cultured for 12 h. Then, the cells were transferred to LB medium containing ampicillin at a ratio of 1% v / v and cultured at 37 °C and 200 r / min until OD200. 450nm At a concentration of 0.6, IPTG at a final concentration of 1.0 mmol / L was added for induction for 22 h at a rotation speed of 180 r / min and a temperature of 20℃. The induced bacterial culture was centrifuged at 4500 g for 10 min, and the supernatant was discarded to collect the bacterial cells. The bacterial cells were resuspended in 10 mL of pre-chilled PBS and washed three times. Finally, the bacterial precipitate was resuspended in 1.5 mL of pre-chilled PBS. The resuspended bacterial cells were subjected to thorough sonication in an ice-water mixture. The supernatant and precipitate obtained after centrifuging the disrupted bacterial cells at 13000 g, 4℃, and 30 min were prepared separately and identified by SDS-PAGE and Coomassie Brilliant Blue staining on a 12.5% separating gel. The target protein was expressed in inclusion body form.
[0076] Chicken Foxp3 recombinant protein expressed in inclusion body form was purified using a nickel column. 1 ml of inclusion body sample was dissolved in 10 ml of 8 M urea using standard methods and then incubated overnight at 4°C with a 1 ml nickel column. The sample was washed with 5 mM imidazole and eluted with 500 mM imidazole. The eluent was dialyzed at 4°C for 4 hours at different concentrations (6 M, 4 M, 2 M). The dialysate was concentrated using ultrafiltration (4000 g, 4°C, 20 min).
[0077] A small amount (10 μL) of the eluted protein was diluted 10-fold with PBS and then added to SDS-PAGE protein loading buffer (5×). The protein purification effect was identified by SDS-PAGE and Western blot. The primary antibody used for Western blot identification was a mouse anti-His tag antibody (Sigma), and the secondary antibody was IRDye800CW-labeled goat anti-mouse IgG (Sigma). SDS-PAGE results showed that the purified chicken Foxp3 recombinant protein had a molecular weight of approximately 34 kDa, and Western blot results showed that it could be recognized by the anti-His antibody.
[0078] Example 2: Preparation and Identification of Chicken Foxp3 Monoclonal Antibody
[0079] 1. Mouse immunization
[0080] The prokaryotically expressed and purified chicken Foxp3 recombinant protein (hereinafter referred to as Foxp3 protein) solution obtained in Example 1 (solvent: sterile PBS (0.01 mol / L, pH 7.4)) was mixed with Freund's complete adjuvant at a 1:1 volume ratio and emulsified thoroughly on a tissue homogenizer to obtain immunogen composition 1. The same Foxp3 protein solution was mixed with Freund's incomplete adjuvant at a 1:1 volume ratio and emulsified using the same method to obtain immunogen composition 2.
[0081] Six-week-old BALB / c mice (purchased from Liaoning Changsheng Biotechnology Co., Ltd.) were used for immunization, with a total of 5 mice immunized. Immunogen composition 1 was administered to the mice via multiple subcutaneous injections on the back, with an immunization dose of 0.1 mg Foxp3 protein per mouse. A second immunization was administered 14 days after the first immunization using immunogen composition 2, and a third immunization was administered 14 days after the second immunization using immunogen composition 2, with the same immunization method and dosage as the first immunization. Seven days after the third immunization, blood was collected from the tail tip of the mice, and serum was separated for antibody titer detection.
[0082] 2. Detection of antibodies in mouse serum
[0083] The purified Foxp3 protein was used to coat ELISA plates, and the antibody titer in the serum of immunized mice was detected by ELISA. Unimmunized mice were used as negative controls. The specific operation is as follows: (1) Dilute the purified Foxp3 protein (prepared in Example 1) to 12 μg / mL with carbonate coating solution, add 100 μL to each well of the ELISA plate, and coat overnight at 4℃; (2) Take out the coated ELISA plate, discard the coating solution in the well, and pat dry; (3) Add 100 μL of 5% skim milk (solvent is PBS) to each well and incubate at 37℃ for 1 h, discard the liquid in the well, and pat dry; (4) Add PBST (200 μL / well) to wash 3 times, and pat dry; (5) Dilute the serum sample to be tested (mouse serum obtained in step 1) with serum diluent (PBS) from 1:500 (volume ratio) in 7 gradients at a 2-fold ratio, add 100 μL to each well, incubate at 37℃ for 1 h, discard the liquid in the well, and pat dry; (6) Add PBST (200 μL / well) to wash 3 times, and pat dry; (7) Wash 4 times with PBS at a ratio of 1:3000 (volume ratio) and pat dry; (8) Dilute HRP-labeled goat anti-mouse IgG secondary antibody (purchased from Sigma) at 1:3000 (volume ratio), 100 μL / well, incubate at 37℃ for 1 h, discard the liquid in the wells, and pat dry; (9) Add PBST (200 μL / well) to wash 4 times and pat dry; (10) Add 100 μL of TMB substrate chromogenic solution to each well and incubate at 37℃ for 15 min; (11) Add 100 μL of stop solution (2M H2SO4) to each well, and immediately place the microplate in a microplate reader to measure the absorbance OD. 450 nm. A positive result is defined as a sample well having an absorbance ratio greater than 2.1 compared to a negative control well. For the ELISA titer statistics of Foxp3 antibody in the serum of the immunized mouse with the highest antibody titer (mouse a), please refer to [link to ELISA data]. Figure 2 Therefore, the ELISA titer of Foxp3 serum can reach 1:16000, and the anti-Foxp3 antibody produced by this mouse has good efficacy. Further research will be conducted on this mouse.
[0084] 3. Hybridoma cell preparation
[0085] (1) Culture of myeloma cells SP2 / 0
[0086] Cell resuscitation: Frozen SP2 / 0 myeloma cells were removed from liquid nitrogen and immediately placed in a 37°C water bath for 5 minutes to thaw. The cells were then immediately removed from the water bath. In a biosafety cabinet, the cells were transferred to sterile 15 mL centrifuge tubes, and 5 mL of preheated DMEM medium was added. The cells were gently mixed by pipetting and aspirating, and centrifuged at 1000 g for 5 min. The supernatant was discarded, and 2 mL of DMEM medium was added and mixed by pipetting and aspirating. The mixture was then transferred to a cell culture flask, and 4 mL of DMEM medium was added and mixed. The flasks were incubated at 37°C in a 5% CO2 incubator.
[0087] Cell passage: Observe cell status and density. When the cell density reaches 90% or higher, perform cell passage. Discard the original DMEM culture medium in the culture flask, add 4 mL of sterile PBS along the sidewall, slowly rinse once, then add an appropriate amount of DMEM culture medium and disperse the cells. Transfer the cell suspension to a new culture flask, add an appropriate amount of DMEM culture medium and mix well. Incubate at 37°C in a 5% CO2 incubator.
[0088] (2) Preparation of mouse spleen cells
[0089] The serum antibody titer of mouse a met the standard. Mouse a was then given a booster immunization using the same method as the second immunization. Spleen cells were prepared 3 days after the booster immunization. ① The aforementioned booster-immunized mouse a was removed from its eyeballs to expel blood and collect serum; ② After euthanizing the mouse by cervical dislocation, it was soaked in 75% alcohol for 15 min, then fixed, the peritoneum was cut open, and the spleen was bluntly dissected. An appropriate amount of DMEM culture medium was taken, and the surface was rinsed to remove as much excess fat and connective tissue as possible; ③ The spleen was placed in a clean culture dish, 25 mL of DMEM culture medium was added, a pore was made in the spleen with a needle, and then DMEM was injected from one end of the spleen using a 20 mL syringe. The spleen was rinsed repeatedly until it turned white; ④ The spleen cell suspension was transferred to a 50 mL centrifuge tube, mixed well, and cell counting was performed.
[0090] (3) Cell fusion
[0091] ① Resuspend SP2 / 0 cells in 25 mL of warm DMEM culture medium and count the cells; ② Mix spleen cells and SP2 / 0 cells at a ratio of 8:1, centrifuge at 300 g for 5 min at room temperature, discard the supernatant, and gently tap the bottom to resuspend and mix the cells; ③ Place the centrifuge tube in 37°C sterile water, add 1 mL of PEG cell fusion agent (Sigma) to the centrifuge tube within 1 min, and then let it stand for 4 min; ④ Slowly add 20 mL of warm DMEM culture medium over 4 min to terminate the fusion, centrifuge at 1200 g for 5 min at room temperature, and discard the supernatant; ⑤ Resuspend the cells in HAT culture medium, add 10 mL of Hybridoma Feeder, and then add HAT culture medium to 200 mL to resuspend the cells; ⑥ Aliquot the cell suspension into five 96-well cell plates at a dose of 200 μL / well, observe cell growth after 5 days, and replenish DMEM culture medium as needed.
[0092] Seven days after fusion, hybridoma cells that had begun to form cell clusters were observed when replenished with HAT medium. Ten days after fusion, the hybridoma cell clusters in the 96-well plates became larger, with rounded cell shapes and good condition.
[0093] 4. Screening and subcloning of positive hybridoma cells
[0094] The titer of Foxp3 antibody in hybridoma cell supernatant was detected using an indirect ELISA method (detection method as described in Section 2 above). Fifteen wells from five 96-well cell culture plates with high OD values and containing only a single cell cluster were selected. The culture medium in these wells was discarded, and HT culture medium was added again. The cell clusters were gently dispersed and transferred to fifteen 48-well plates. After confluence, the cells were expanded and cultured. The antibody titer in the cell supernatant was detected again. Then, one well with the highest absorbance and containing only a single cell cluster was selected for subcloning using a flow cytometry cell sorting system. The cells with the highest absorbance and containing only a single cell cluster were dispersed into a suspension, diluted with HT culture medium, and separated into single cells / well using a flow cytometry cell sorting system. These cells were then added to a 96-well cell culture plate (each well containing 200 µL of HT culture medium). The plates were incubated at 37°C for 5-8 days, and the titer in the supernatant was detected. A second subcloning was then performed (using the same method as above). After secondary subcloning, wells containing a single cell cluster were all detected as positive with high OD values, indicating that the cells in these positive wells were monoclonal hybridoma cell lines secreting Foxp3 antibodies. The obtained hybridoma cell line capable of secreting Foxp3 monoclonal antibody was named hybridoma cell line chFoxp3-G2-4 (abbreviated as G2-4), and deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC No. C202635. The monoclonal antibody secreted by G2-4 was named antibody G2-4.
[0095] 5. Expanded culture of hybridoma cells and preparation of monoclonal antibody ascites
[0096] The hybridoma cell line G2-4, which was identified as positive, was gradually expanded and cultured to 6-well plates. The titer of the hybridoma cell supernatant was determined again by ELISA (the detection method is the same as in Section 2 above). Cells that were still positive were further expanded and cultured for cell cryopreservation and preparation of ascites monoclonal antibodies, respectively.
[0097] The ascites preparation procedure was as follows: Five healthy 9-week-old female BALB / c mice were intraperitoneally injected with 0.3 mL of Freund's incomplete adjuvant per mouse, and the fluid was used 5-7 days later. G2-4 positive hybridoma cells in the logarithmic growth phase were suspended in PBS, and the cell density was adjusted to approximately 6 × 10⁻⁶ cells / mL. 6 cells / mL, approximately 2.0 × 10⁶ cells / mL, administered intraperitoneally to each mouse. 6 One cell (0.2 mL). Ascites fluid was collected one week later, centrifuged at 10000 g for 10 min, and the upper light yellow clear liquid was carefully extracted, which is the monoclonal antibody ascites fluid, and stored at -80℃ for later use.
[0098] 6. Characterization of Monoclonal Antibody Properties
[0099] (1) Determination of monoclonal antibody potency
[0100] Mouse ascites was diluted with PBS at a 1:2 ratio. 11 The monoclonal antibody was initially serially diluted 2-fold eight times, and its titer was detected using indirect ELISA. The indirect ELISA procedure was the same as described in Section 2 above. Results are shown below. Figure 3 Therefore, the antibody titer in the monoclonal antibody ascites fluid is 1:2. 15 .
[0101] (2) Subclass identification of monoclonal antibodies
[0102] The G2-4 monoclonal antibody was subclassed using the Mouse Monoclonal Antibody Ig Class / Subclass Identification ELISA Kit (supplier: Beijing Bio-Long Immunotherapy Co., Ltd.) according to the instructions. Results are shown below. Figure 4 The G2-4 monoclonal antibody was identified as IgG1κ type using a mouse Ig class / subclass identification kit.
[0103] (3) Preliminary application of monoclonal antibodies
[0104] To test the applicability of Foxp3 monoclonal antibody G2-4, IFA and Western blot were used to detect the responsiveness of Foxp3 monoclonal antibody to prokaryotic and eukaryotic Foxp3 expressed proteins. Furthermore, the responsiveness of Foxp3 monoclonal antibody to MSB1-induced endogenous Foxp3 expression was examined.
[0105] ① Detection of prokaryotic expressed proteins by monoclonal antibodies
[0106] The purified prokaryotic recombinant Foxp3 protein from Example 1 was subjected to SDS-PAGE and then transferred to an NC membrane. Using diluted Foxp3 monoclonal antibody G2-4 (1:1000) as the primary antibody and IRDye800CW-labeled goat anti-mouse IgG as the secondary antibody (Sigma), the reactivity of the Foxp3 monoclonal antibody to the prokaryotic Foxp3 protein was detected by Western blot. Results are shown below. Figure 5 Therefore, the prepared Foxp3 monoclonal antibody G2-4 can be used to detect Foxp3 prokaryotic expression protein by Western blot technology.
[0107] ② Detection of eukaryotic expressed proteins by monoclonal antibodies
[0108] The recombinant eukaryotic expression plasmid pCAGGS-Foxp3-HA and the empty plasmid pCAGGS obtained in Example 1 were transfected into 293T cells for 30 h to express Foxp3 in eukaryotes. 30 h after transfection, in vitro anabolism (IFA) was performed using Foxp3 monoclonal antibody G2-4 (1:1000) as the primary antibody and FITC-labeled goat anti-mouse IgG (Sigma) as the secondary antibody. Results are shown below. Figure 6 Therefore, the prepared Foxp3 monoclonal antibody G2-4 can be used to detect eukaryotic Foxp3 protein expression using IFA technology.
[0109] In addition, the recombinant eukaryotic expression plasmid pCAGGS-Foxp3 and the empty plasmid pCAGGS were transfected into 293T cells for 30 h. The cells were then subjected to Western blot analysis using Foxp3 monoclonal antibody G2-4 (1:1000) as the primary antibody and IRDye800CW-labeled goat anti-mouse IgG (Sigma) as the secondary antibody.
[0110] See results Figure 7 Therefore, the prepared Foxp3 monoclonal antibody G2-4 can be used to detect Foxp3 eukaryotic expression protein by Western blot technology.
[0111] ③ Detection of endogenous Foxp3 by monoclonal antibodies
[0112] The responsiveness of Foxp3 monoclonal antibody G2-4 (1:1000) to endogenously expressed Foxp3 was detected by in vitro anabolism (IFA). FITC goat anti-mouse IgG (sigma) was used as the secondary antibody in the IFA.
[0113] See results Figure 8 Therefore, the prepared Foxp3 monoclonal antibody G2-4 can be used to detect endogenous Foxp3 protein in cells using Western blot technology.
[0114] Example 3: Establishment and application of a flow cytometry method for detecting chicken Treg cells based on anti-Foxp3 monoclonal antibody.
[0115] 1. Establishment of a flow cytometry method for detecting chicken Tregs based on Foxp3 monoclonal antibody
[0116] Chicken peripheral blood lymphocytes were isolated using density gradient centrifugation. 5 mL of chicken peripheral blood lymphocyte separation medium was added to a 15 mL centrifuge tube. 5 mL of peripheral blood from SPF chickens was gently added to the upper layer. The tube was centrifuged at 750 g for 30 min at room temperature with a horizontal rotor. The second layer of ring-shaped, milky-white lymphocytes was carefully aspirated using a pipette to obtain peripheral blood mononuclear cells (PBMCs). The middle ring-shaped, milky-white lymphocytes were then carefully aspirated using a pipette. All cells were treated with erythrocyte lysis buffer to remove red blood cells, and washed twice with PBS. The final cell suspension concentration was adjusted to approximately 2 × 10⁻⁶ cells / mL. 7 cells / mL.
[0117] Take approximately 2 × 10 6 Cell surface staining: Anti-chicken CD3, CD4, and CD25 antibodies were added, and the cells were incubated on ice in the dark for 30 minutes. After washing with PBS, the cells were fixed and perforated using Foxp3 / transcription factor staining buffer (ThermoFisher Scientific). Intracellular staining was then performed using anti-Foxp3 monoclonal antibody G2-4, and the cells were incubated at room temperature in the dark for 60 minutes. After washing with PBS, APC goat anti-mouse IgG (ThermoFisher Scientific) was used as the secondary antibody, and the cells were incubated at room temperature in the dark for 60 minutes. After washing with PBS, the cells were resuspended in PBS containing 1% BSA. Data were obtained using flow cytometry, and lymphocyte populations, monocytes, and CD3+ cells were selected. + CD4 + Cells and analysis of CD25 + FoxP3 + The proportion of T cells (i.e., Treg cells). All data were analyzed using FlowJo software.
[0118] See results Figure 9 A. A standardized flow cytometry method for detecting chicken Tregs was successfully established using a self-made Foxp3 monoclonal antibody, G2-4. This method can effectively identify CD4+ in chicken peripheral blood. + CD25 + Foxp3 expression in T cells (i.e., Treg cells) lays the foundation for subsequent identification of chicken regulatory T cells (Treg).
[0119] 2. Foxp3 + Distribution of Treg cells in chicken peripheral immune organs
[0120] Mononuclear cells (MSCs) from peripheral immune organs of chickens were isolated using density gradient centrifugation. Spleen and cecal tonsils from SPF chickens were aseptically minced and filtered through a 40 μm cell sieve to prepare 15 mL of single-cell suspension. In a 50 mL centrifuge tube, an equal volume of separation medium was added, and 15 mL of the single-cell suspension was carefully pipetted onto the surface of the separation medium. The tube was centrifuged at 750 g for 30 min at room temperature with a horizontal rotor. The central ring of milky-white cells was carefully aspirated using a pipette. All cells were treated with erythrocyte lysis buffer to remove red blood cells, and the cells were washed twice with PBS. The final cell suspension concentration was adjusted to approximately 2 × 10⁻⁶ cells / mL. 7 cells / mL. Staining and flow cytometry were performed using the standardized procedure established in Section 1 of Example 3, with gating strategies and data analysis methods consistent.
[0121] See results Figure 9 B and C, the present invention successfully applied the prepared Foxp3 monoclonal antibody G2-4 to effectively detect CD4 in the peripheral immune organs of chickens by flow cytometry. + CD25 + Foxp3 expression was observed in T cells (Treg cells). Analysis showed that the spleen maintained a stable proportion of Treg cells among peripheral immune organs. Notably, a significant Foxp3 expression was also identified in the cecal tonsil, a key site of mucosal immunity. + Treg cell population.
Claims
1. A hybridoma cell line that secretes monoclonal antibodies against chicken Foxp3 (Forkhead box P3), characterized in that, The hybridoma cell line described is named chFoxp3-G2-4 and is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC No. C202635 and deposit date of April 16, 2026.
2. A monoclonal antibody against chicken Foxp3, characterized in that, The monoclonal antibody is secreted by the hybridoma cell line described in claim 1.
3. The application of the anti-chicken Foxp3 monoclonal antibody as described in claim 2 in the preparation of a reagent for detecting chicken transcription factor Foxp3.
4. The application as described in claim 3, characterized in that, The chicken transcription factor Foxp3 is a eukaryotic Foxp3 expressed protein, a prokaryotic Foxp3 expressed protein, or an endogenous Foxp3 protein.
5. The application as described in claim 4, characterized in that, The chicken transcription factor Foxp3 mentioned above is the chicken transcription factor Foxp3 found in regulatory T cells (Treg).
6. A method for detecting Foxp3 protein in chicken Treg cells for non-diagnostic purposes, characterized in that, The method includes the steps of isolating chicken peripheral blood lymphocytes, obtaining peripheral blood mononuclear cells, adding anti-chicken CD3, CD4, and CD25 antibodies to stain the cell surface, performing intracellular staining using the anti-chicken Foxp3 monoclonal antibody as described in claim 2, and acquiring data using flow cytometry.
7. The method as described in claim 6, characterized in that, Includes the following steps: (1) Chicken peripheral blood lymphocytes were separated by density gradient centrifugation: 5 mL of chicken peripheral blood lymphocyte separation solution was added to a 15 mL centrifuge tube, and 5 mL of peripheral blood from SPF chickens was gently added to the upper layer. The tube was centrifuged at room temperature and 750 g on a horizontal rotor for 30 min. (2) Obtaining peripheral blood mononuclear cells: Carefully aspirate the second layer of ring-shaped milky white lymphocytes with a pipette to obtain peripheral blood mononuclear cells. Wash twice with PBS buffer to remove residual separation solution. Remove red blood cells from all cells using red blood cell lysis buffer and wash twice with PBS buffer. Finally, adjust the cell suspension concentration to 1×10⁻⁶. 7 -3×10 7 cells / mL; (3) Take 1×10 6 -3×10 6 Surface staining of individual cells: Add anti-chicken CD3, CD4, and CD25 antibodies and incubate on ice in the dark for 30 minutes. (4) Intracellular staining: After washing the cells in step (3) with PBS, fix and perforate them with Foxp3 / transcription factor staining buffer, then add the anti-chicken Foxp3 monoclonal antibody as described in claim 2 for intracellular staining, and incubate at room temperature in the dark for 60 minutes. (5) Data acquisition using flow cytometry: After washing the cells in step (4) with PBS, the cells were incubated at room temperature in the dark for 60 minutes with APC-labeled goat anti-mouse IgG as the secondary antibody. After washing with PBS, the cells were resuspended in PBS containing 1% w / w BSA. Data were acquired using flow cytometry, and CD25 was analyzed. + FoxP3 + The proportion of T cells.
8. A method for detecting Foxp3 protein in Treg cells of chicken peripheral immune organs for non-diagnostic purposes, characterized in that, The procedure includes the steps of cutting chicken peripheral immune organs into small pieces under sterile conditions, filtering them through a cell sieve to prepare a single-cell suspension, adding anti-chicken CD3, CD4, and CD25 antibodies to stain the cell surface, using the anti-chicken Foxp3 monoclonal antibody as described in claim 2 for intracellular staining, and using a flow cytometer to acquire data.
9. The method as described in claim 8, characterized in that, Includes the following steps: (1) Take peripheral immune organs of chickens, cut them into pieces under sterile conditions, and filter them through a 40 μm cell sieve to prepare a single cell suspension; take a centrifuge tube, add an equal amount of separation liquid to the single cell suspension, add the single cell suspension to the surface of the separation liquid, and centrifuge at room temperature; (2) Obtaining mononuclear cells: Carefully aspirate the second layer of ring-shaped milky white cells with a pipette, wash twice with PBS buffer to remove residual separation solution, remove red blood cells from all cells using red blood cell lysis buffer, and wash twice with PBS buffer. Finally, adjust the cell suspension concentration to 1×10⁻⁶. 7 -3×10 7 cells / mL; (3) Take 1×10 6 -3×10 6 Surface staining of individual cells: Add anti-chicken CD3, CD4, and CD25 antibodies and incubate on ice in the dark for 30 minutes. (4) Intracellular staining: After washing the cells in step (3) with PBS, fix and perforate them with Foxp3 / transcription factor staining buffer, then add the anti-chicken Foxp3 monoclonal antibody as described in claim 2 for intracellular staining, and incubate at room temperature in the dark for 60 minutes. (5) Data acquisition using flow cytometry: After washing the cells in step (4) with PBS, the cells were incubated at room temperature in the dark for 60 minutes with APC-labeled goat anti-mouse IgG as the secondary antibody. After washing with PBS, the cells were resuspended in PBS containing 1% w / w BSA. Data were acquired using flow cytometry, and CD25 was analyzed. + FoxP3 + The proportion of T cells.
10. The method as described in claim 8 or 9, characterized in that, The peripheral immune organs mentioned include the spleen and cecal tonsils.