Ebola nucleic acid detection quality control product and preparation method thereof
By preparing Ebola nucleic acid detection quality control products with multiple subtypes and multiple target genes, using human serum as a matrix and freeze-drying, the problems of limited coverage and poor stability of existing quality control products are solved, achieving efficient quality control and reliable test results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GENEWELL BIOTECHNOLOGY CO LTD
- Filing Date
- 2026-06-11
- Publication Date
- 2026-07-14
Smart Images

Figure CN122382017A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of medical testing technology, and in particular to a quality control product for Ebola nucleic acid detection and its preparation method. Background Technology
[0002] Ebola Virus Disease (EVD) is an acute hemorrhagic infectious disease caused by the genus Ebolavirus of the family Filoviridae. In Ebola prevention and control, early, rapid, and accurate laboratory diagnosis is the core link in case identification, isolation and treatment, contact tracing, and disease control. Nucleic acid testing, including real-time quantitative PCR (RT-qPCR) and sequencing, is the "gold standard" for Ebola virus detection and can provide a basis for diagnosis in the early stage of the disease. However, in the field prevention and control process, due to problems such as insufficient matching between the target of the reagent kit and the strain, there is a risk of missed detection in nucleic acid testing. Therefore, quality control products that can cover the mainstream strains and simulate real clinical samples are of vital value for timely detection and avoidance of missed detection. At present, although there are reports of some Ebola quality control products, the existing products still have the following technical bottlenecks: (1) The strain coverage is one-sided, and most of them only use a single subtype, which cannot simultaneously cover the three major circulating strains of Zaire, Sudan, and Bundibugyo. (2) The target gene selection is limited, focusing only on NP and GP genes, lacking commonly used detection genes such as VP24 and VP40. (3) The products are mostly naked nucleic acids or liquid pseudoviruses, and the matrix is mostly buffer solution, which differs significantly from clinical serum samples. It can only control the PCR amplification step, and cannot achieve full-process quality control from nucleic acid extraction to amplification. The liquid formulation is difficult to store and transport, and has poor storage and transportation stability. (4) The concentration specifications are limited, making it difficult to comprehensively evaluate the key performance of the kit, such as sensitivity and linearity.
[0003] In summary, the industry lacks commercially available quality control materials that are compatible with multiple subtypes, multiple target genes, multiple concentration gradients, and biomimetic clinical serum matrices. This results in laboratories at all levels lacking qualified reference materials for conducting methodological validation and routine internal quality control, making it difficult to guarantee the reliability of Ebola nucleic acid test results. Summary of the Invention
[0004] To address the shortcomings of existing technologies, this invention proposes a quality control product for Ebola nucleic acid detection and its preparation method.
[0005] This invention provides a quality control product for Ebola nucleic acid detection, using human serum as a matrix, and includes quality control product 1, quality control product 2 and quality control product 3; The quality control sample 1 contains pseudovirus 1 and pseudovirus 2. Pseudovirus 1 contains the tandem sequence of the NP gene and VP24 gene of the Bundibugyo type Ebola virus, and pseudovirus 2 contains the tandem sequence of the GP gene and VP40 gene of the Bundibugyo type Ebola virus. The quality control sample 2 contains pseudovirus 3 and pseudovirus 4. Pseudovirus 3 contains the tandem sequence of the NP gene and VP24 gene of Zaire Ebola virus, and pseudovirus 4 contains the tandem sequence of the GP gene and VP40 gene of Zaire Ebola virus. The quality control sample 3 contains pseudovirus 5 and pseudovirus 6. Pseudovirus 5 contains the tandem sequence of the Sudan Ebola virus NP gene and VP24 gene, and pseudovirus 6 contains the tandem sequence of the Sudan Ebola virus GP gene and VP40 gene. The quality control product 1, quality control product 2 and quality control product 3 respectively include low-concentration quality control product, medium-concentration quality control product and high-concentration quality control product; The copy number concentration range of the low-concentration quality control sample is 1.00 × 10⁻⁶. 3 ~1.00×10 4 The copy number concentration range of the medium-concentration quality control sample is 1.00 × 10⁻⁶ copies / mL. 4 ~1.00×10 5 The high-concentration quality control sample has a copy number concentration range of 1.00 × 10⁻⁶ copies / mL. 5 ~1.00×10 6 copies / mL.
[0006] To ensure the packaging efficiency of lentiviruses, the length of the inserted fragment should not exceed 3Kb. Therefore, the above method is used for gene tandem.
[0007] In some embodiments, the pseudovirus 1 comprises a tandem sequence of the nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 3; The pseudovirus 2 contains a tandem sequence of the nucleotide sequences shown in SEQ ID No. 2 and SEQ ID No. 4; The pseudovirus 3 contains a tandem sequence of the nucleotide sequences shown in SEQ ID No. 5 and SEQ ID No. 7; The pseudovirus 4 contains a tandem sequence of the nucleotide sequences shown in SEQ ID No. 6 and SEQ ID No. 8; The pseudovirus 5 contains a tandem sequence of the nucleotide sequences shown in SEQ ID No. 9 and SEQ ID No. 11; The pseudovirus 6 contains a tandem sequence of the nucleotide sequences shown in SEQ ID No. 10 and SEQ ID No. 12.
[0008] In some embodiments, a negative control is also included; the negative control is a sterile negative human serum matrix.
[0009] In some embodiments, the copy number ratio of fake virus 1 to fake virus 2 in the quality control sample 1 is (1~2):(1~2). In the quality control sample 2, the copy number ratio of fake virus 3 to fake virus 4 is (1~2):(1~2); In the quality control sample 3, the copy number ratio of fake virus 5 to fake virus 6 is (1~2):(1~2).
[0010] This invention combines two pseudoviruses in equal proportions, which can accurately simulate the sample characteristics of natural viruses with equal copies of each target gene. The in vitro amplification efficiency of each gene is closer to the amplification pattern of real clinical samples, effectively improving the accuracy of quality control throughout the entire process.
[0011] In some embodiments, the Ebola nucleic acid test quality control product is a freeze-dried preparation.
[0012] The present invention also provides a method for preparing the Ebola nucleic acid detection quality control product, comprising the following steps: S1: Construct lentiviral recombinant plasmids containing each tandem sequence; S2: The lentiviral recombinant plasmid and the lentiviral packaging plasmid were co-transfected into HEK293T cells, and the cell supernatant was collected after culture, filtered and purified to obtain pseudoviruses 1-6. S3: Using human serum as a matrix, pseudoviruses are mixed to prepare quality control product 1, quality control product 2 and quality control product 3, respectively, to obtain the Ebola nucleic acid detection quality control product.
[0013] In some embodiments, the lentiviral packaging plasmid includes VSV-G, PLP1, and PLP2; The molar ratio of the lentiviral recombinant plasmid, VSV-G, PLP1, and PLP2 is (1~2):(1~2):(1~2):(1~2).
[0014] The present invention also provides an Ebola nucleic acid detection quality control reagent, comprising the aforementioned Ebola nucleic acid detection quality control product.
[0015] In summary, compared with the prior art, the present invention achieves the following technical effects: 1. The Ebola nucleic acid detection quality control product prepared by this invention can achieve comprehensive typing quality control for three mainstream strains, effectively making up for the shortcomings of existing quality control systems; the positive quality control products of different concentrations (high, medium and low) can be accurately quantified by digital PCR, which can be used to effectively control the performance of the detection system and ensure the accuracy and reliability of the detection results.
[0016] 2. The Ebola nucleic acid detection quality control product prepared by this invention has excellent low-temperature storage performance. It can be stored at 2~8℃ for more than 25 months. During long-term storage, the content of target nucleic acid does not decrease significantly, and the product has a long shelf life.
[0017] 3. This invention uses human serum as the matrix for quality control products, which can highly simulate the real clinical testing sample environment and fit the actual testing scenario to the greatest extent. Combined with the freeze-drying process to process the quality control products, the storage and use stability of the quality control products is greatly improved, which is suitable for the quality control needs of clinical and various nucleic acid testing scenarios. Attached Figure Description
[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 This is the expression plasmid used for pseudovirus preparation in Example 1 of the present invention. Detailed Implementation
[0020] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.
[0021] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, all materials and reagents used are commercially available.
[0022] This invention relates to a quality control product for Ebola virus nucleic acid detection, which consists of a pseudovirus packaged with core detection genes. The quality control product covers three mainstream strains: Bundibugyo, Zaire, and Sudan, and contains four core detection regions for each strain: NP gene, GP gene, VP24 gene, and VP40 gene. This quality control product uses digital PCR for precise determination and is lyophilized using human serum as a matrix, providing a standardized, traceable, and stable quality control solution for Ebola virus detection, thus helping to improve the accuracy and reliability of clinical testing.
[0023] The specific experimental plan is as follows: Example 1: Preparation of pseudoviruses (1) The NP, GP, VP24, and VP40 genes of three strains—Bendibugyo (reference sequence: FJ217161), Zaire (reference sequence: NC_002549), and Sudan (reference sequence: AY729654)—were synthesized. The NP gene sequence of the Bendibjo strain is shown in SEQ ID No. 1, the GP gene sequence is shown in SEQ ID No. 2, the VP24 gene sequence is shown in SEQ ID No. 3, and the VP40 gene sequence is shown in SEQ ID No. 4.
[0024] The NP gene sequence of the Zaire strain is shown in SEQ ID No. 5, the GP gene sequence is shown in SEQ ID No. 6, the VP24 gene sequence is shown in SEQ ID No. 7, and the VP40 gene sequence is shown in SEQ ID No. 8.
[0025] The Sudan-type strain NP gene sequence is shown in SEQ ID No. 9, the GP gene sequence is shown in SEQ ID No. 10, the VP24 gene sequence is shown in SEQ ID No. 11, and the VP40 gene sequence is shown in SEQ ID No. 12.
[0026] In this study, the NP gene and VP24 gene from the same strain were tandemly synthesized into the same fragment, and the GP gene and VP40 gene from the same strain were tandemly synthesized into the same fragment. Furthermore, the synthesized fragments were inserted into the lentiviral expression plasmid pLV using the restriction enzyme sites SpeI and PstI. The plasmid backbone is shown below. Figure 1 As shown (LTR stands for long terminal repeat sequence). Therefore, the NP, VP24, GP, and VP40 genes contained in the three strains were respectively constructed onto the expression plasmids of six third-generation lentiviral packaging systems.
[0027] (2) The lentiviral expression plasmid was co-transfected with three packaging plasmids (pLP / VSV-G, pLP1, and pLP2) in a molar ratio of 1:1:1:1 and then transfected into HEK293T cells. The packaged pseudoviruses were concentrated and enriched by ultracentrifugation. The specific method for preparing the pseudoviruses in this embodiment is as follows: ① 2×10 6 HEK293T cells were seeded in 25cm cells 2After 24 hours, transfection was performed on the cell culture flasks: 1 μg of VSV-G plasmid, 1 μg of PLP1 plasmid, 1 μg of PLP2 plasmid, and 1 μg of lentiviral expression plasmid were added to 500 μL of jetPRIME buffer and mixed thoroughly by pipetting; 10 μL of jetPRIME transfection reagent was added, mixed well, and incubated at room temperature for 10 min; the reagent was then added to the cell culture medium, and cell culture was continued.
[0028] ②48h after transfection, collect the cell supernatant, filter it through a 0.22μm filter membrane, store it at 4℃, and replace it with fresh culture medium; 72h after transfection, collect the supernatant again, filter it through a 0.22μm filter membrane, and combine it with the supernatant collected at 48h.
[0029] ③ Collection of pseudoviruses: Add 8 mL of 20% sucrose to an ultracentrifuge tube, then add the combined cell supernatant to the tube. Weigh and balance the mixture accurately, then ultracentrifuge at 4°C (30,000 rpm, 3 h). After centrifugation, carefully discard the supernatant and resuspend the pseudoviruses in an appropriate amount of PBS solution. Aliquot the pseudovirus solution and store it at -80°C for long-term storage. The obtained pseudoviruses are shown in Table 1.
[0030] Table 1 Genome composition of pseudoviruses
[0031] Example 2: Preparation of Ebola nucleic acid detection quality control materials To achieve end-to-end quality control for Ebola virus nucleic acid detection, this embodiment uses human serum as a matrix. After quantifying the prepared pseudoviruses using digital PCR (primers and probes used are shown in Table 2), two pseudoviruses from each strain are mixed at equal copy number ratios and then added to a negative matrix to prepare quality control samples with 10 copy number concentration gradients. The concentrations of the quality control samples are then measured using digital PCR and the primers and probes in Table 2 to confirm that the pseudovirus copy number is within the theoretical copy number concentration range. The specific theoretical copy number range is shown in Table 3 below.
[0032] Table 2 Primer and probe sequences used for pseudovirus quantification
[0033] Table 3. Theoretical copy number range of quality control materials
[0034] The copy number of each pseudovirus in the quality control samples at various concentration levels was detected by digital PCR. The actual copy numbers of representative batches are shown in Tables 4 to 6. The actual copy numbers are consistent with the theoretical copy number range.
[0035] Table 4. Measured copy number of Bendibu coke-type quality control samples
[0036] Table 5. Measured copy number of Zaire-type quality control samples
[0037] Table 6. Measured copy number of Sudan-type quality control samples
[0038] To improve the stability of the quality control samples and facilitate transportation and use, the samples were freeze-dried. The freeze-drying operation was performed in a freeze dryer (model: ZLGJ-30). After freeze-drying, the quality control samples appeared as pale yellow, loosely structured lumps. The freeze-drying parameters were as follows: Table 7 Parameters used for freeze-drying of quality control products
[0039] Example 3: Uniformity Verification of Quality Control Samples In accordance with the requirements of GB / T 15000.3-2023 "Standard Sample Working Guidelines Part 3: Standard Sample Value Assignment and Homogeneity and Stability Assessment", the homogeneity of the prepared quality control samples was evaluated to confirm the consistency of the values between different packaging units within each batch.
[0040] Ten smallest packaging units were randomly selected from each batch of quality control samples at low, medium, and high concentration levels using a random sampling method, and reconstituted with enzyme-free water. Digital PCR was used to independently test each sample three times under repeatability conditions. One-way ANOVA was employed to statistically analyze the detection data for each concentration level and target, calculating the ratio of inter-vial mean square to intra-vial mean square (F-value), and the inter-vial coefficient of variation (CV) was also calculated as an auxiliary indicator of precision.
[0041] Judgment criteria: At a 95% confidence level, if the calculated F-value is less than the critical value F0.05(9,20)=2.39 (P>0.05), it indicates that the difference between bottles is not statistically significant; at the same time, the coefficient of variation (CV) between bottles is not greater than 10%, then the homogeneity is considered acceptable. The homogeneity data are shown in Tables 8 to 13 below.
[0042] Table 8. F-values of various pseudovirus concentrations in Bendibujö-type quality control samples.
[0043] Table 9. F-values of various pseudovirus concentrations in Zaire-type quality control samples
[0044] Table 10. F-values of various pseudovirus concentrations in Sudan-type quality control samples
[0045] Table 11. CV values (%) of various pseudovirus concentrations in Bendibujökull-type quality control samples.
[0046] Table 12. CV values (%) of various pseudovirus concentrations in Zaire-type quality control samples
[0047] Table 13. CV values (%) of various pseudovirus concentrations in Sudan-type quality control samples.
[0048] One-way ANOVA confirmed that the calculated F-values for all detection targets were less than the critical value F0.05(9,20) = 2.39, indicating that there was no statistically significant difference between vials at the 95% confidence level. Furthermore, the coefficient of variation (CV) between vials for each target was ≤10%, meeting the industry-standard acceptance criteria (≤10%), confirming good homogeneity between vials. Therefore, all detection targets in the three batches at different concentration levels showed good homogeneity, meeting the pre-set requirements.
[0049] Example 4: Stability Verification of Quality Control Samples In accordance with the requirements of GB / T 15000.3-2023 "Standard Sample Working Guidelines Part 3: Standard Sample Value Assignment and Homogeneity and Stability Assessment", the stability of the quality control samples prepared in this study was evaluated.
[0050] Three batches of quality control samples were collected at 0 (T0, baseline), 6 (T1), 12 (T2), 24 (T3), and 25 (T4), with three replicates at each time point. Each sample underwent two digital PCR tests to determine the copy number concentration. Using T0 as the baseline, the bias of the measured copy number at each time point relative to T0 was examined. The pre-set acceptance criteria were: absolute bias of each target ≤10%, no amplification in negative controls, and 100% specificity. Simultaneously, linear regression analysis was used to analyze the relationship between time and concentration to assess the trend of concentration changes over time.
[0051] For the three batches of Ebola nucleic acid test quality control products, the bias of all samples at each time point relative to T0 was statistically analyzed. The bias details are shown in Table 14 below: Table 14. Absolute values (%) of relative deviations of stability bias at various time points for Ebola nucleic acid test quality control products.
[0052] The results in Table 14 show that, under storage conditions of 2–8°C, the absolute values of all biases of the quality control samples were less than the 10% limit during the monitoring period of 0–25 months; at the same time, no nonspecific amplification signals were detected in the negative control samples, and the negative compliance rate was 100%.
[0053] Furthermore, a linear regression model was used to statistically analyze the detected concentrations (copy number / mL) at different time points to assess the trend of the time factor on concentration changes. For each combination, a linear regression was performed with time (month) as the independent variable and the measured concentration as the dependent variable. The regression slope and its significance were calculated, and the specific results are shown in Table 15 below: Table 15 Results of linear regression analysis on stability
[0054] The results above indicate that the regression slopes of all combinations were not significant (P>0.05), and their 95% confidence intervals all included 0, suggesting that under storage conditions of 2~8℃, no significant increase or decrease in the detection concentration was observed over time during the 25-month storage period.
[0055] Based on the above analysis, the Ebola nucleic acid detection quality control product prepared by this invention maintains good stability for at least 25 months under cryopreservation conditions of 2-8°C. The deviation of its detection concentration relative to the initial value meets the preset standard of ≤±10%, and no significant concentration change trend was observed. Therefore, the long-term stability of this product can be determined to be 24 months (T3 time point).
[0056] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
[0057] sequence list SEQ ID No.1 SEQ ID No.2 SEQ ID No.3 ATGGCTAAGGCAACAGGTAGGTACAACTTGGTTTCACCTAAAAAGGACCTCGAGAGGGGGCTTGTTTTGAGTGATTTGTGCACGTTTTTAGTTGATCAGACTATCCAGGGGTGGCGGGTGACTTGGGTTGGGATTGAATTTGACATCGCCCAGAAAGGGATGGCTCTACTGCATCGGTTAAAAACTGCTGACTTCGCTCCTGCATGGTCGATGACAAGGAATTTATTTCCTCATTTATTTCAAAATTCAAATTCTACTATTGAGTCTCCCCTCTGGGCATTACGAGTGATTCTGGCAGCTGGTATTCAAGACCAGTTAATTGACCAATCCTTGGTAGAACCGTTGGCCGGAGCCCTGAGCTTAGTCTCCGATTGGCTTCTTACAACAAACACAAACCATTTTCAAATGCGCACGCAGCACGCTAAAGAGCAACTGAGCTTGAAGATGCTATCATTAGTGCGCTCTAATATCTTGAAATTCATCAGTCAATTGGACGCACTACATGTCGTGAACTACAATGGACTCTTGAGCAGTATCGAAATTGGCACTAGAAATCATACCATTATCATCACAAGAACCAACATGGGTTTCCTGGTAGAATTACAGGAGCCTGATAAATCTGCCATGAATCAAAAGAAACCAGGACCAGTCAAGTTCTCCCTCCTGCATGAATCAACCTTCAAGGCTCTAATCAAAAAACCCGCAACTAAGATGCAGGCCTTGATTCTGGAATTTAACAGCTCCCTGGCAATATAG SEQ ID No.4 ATGAGGAGGGCAATTCTACCTACTGCACCGCCAGAATACATAGAGGCTGTCTACCCAATGAGAACGGTTAGTACTAGTATCAACAGTACTGCCAGTGGTCCGAACTTTCCAGCACCGGATGTAATGATGAGTGATACACCCTCCAACTCACTCCGACCAATTGCTGATGATAACATCGATCATCCAAGTCATACACCAACCAGTGTTTCATCAGCCTTTATACTCGAGGCAATGGTGAATGTGATATCGGGGCCGAAGGTACTAATGAAGCAAATTCCTATATGGCTCCCCTTGGGTGTTGCTGATCAAAAAACATATAGTTTTGACTCAACTACAGCTGCAATTATGCTCGCATCGTACACCATCACTCACTTTGGCAAAACCTCCAATCCGCTTGTGAGAATCAATCGACTTGGTCCTGGGATCCCCGATCACCCGTTGCGGCTTCTAAGAATAGGAAATCAAGCCTTCTTGCAAGAGTTTGTGCTGCCTCCAGTTCAATTGCCGCAGTATTTCACTTTTGACCTGACGGCTCTAAAGCTGATCACTCAACCTCTCCCGGCAGCAACCTGGACGGATGATACTCCGACCGGTCCTACAGGAATACTTCGTCCTGGAATTTCCTTTCATCCCAAACTGAGACCTATCCTATTGCCAGGGAAGACCGGGAAAAGAGGATCCAGCTCCGATCTTACTTCTCCTGATAAAATACAAGCAATAATGAACTTTCTCCAAGACCTCAAACTCGTGCCGATTGATCCAGCCAAGAACATTATGGGTATTGAAGTGCCGGAACTCTTGGTCCACAGACTAACTGGAAAGAAAATCACAACAAAAAATGGTCAACCAATAATTCCTATTCTTCTACCAAAGTATATTGGCATGGATCCCATTTCTCAGGGAGACCTCACAATGGTCATCACTCAAGACTGTGACACTTGCCATTCTCCTGCTAGTCTTCCTCCAGTCAGCGAGAAATGA SEQ ID No.5 SEQ ID No.6 SEQ ID No.7 ATGGCTAAAGCTACGGGACGATACAATCTAATATCGCCCAAAAGGACCTGGAGAAAGGGGTTGTCTTAAGCGACCTCTGTAACTTCTTAGTTAGCCAAACTATTCAGGGGTGGAAGGTTTATTGGGCTGGTATTGAGTTTGATGTGACTCACAAAGGAATGGCCCTATTGCATAGACTGAAAACTAAT GACTTTGCCCTGCATGGTCAATGACAAGGAATCTCTTTCCTCATTTATTTCAAAATCCGAATTCCACAATTGAATCACCGCTGTGGGCATTGAGAGTCATCCTTGCAGCAGGGATACAGGACCAGCTGATTGACCAGTCTTTGATTGAACCCTTAGCAGGAGCCCTTGGTCTGATCTCTGATTGGCTG CTAACAACCAACACTAACCATTTCAACATGCGAACACAACGTGTCAAGGAACAATTGAGCCTAAAAATGCTGTCGTTGATTCGATCCAATATTCTCAAGTTTATTAACAAATTGGATGCTCTACATGTCGTGAACTACAACGGATTGTTGAGCAGTATTGAAATTGGAACTCAAAATCATACAATCATCATAACTCGAACTAACATGGGTTTTCTGGTGGAGCTCCAAGAACCCGACAAATCGGCAATGAACCGCATGAAGCCTGGGCCGGCGAAATTTTCCCTCCTTCATGAGTCCACACTGAAAGCATTTACACAAGGATCCTCGACACGAATGCAAAGTTTGATTCTTGAATTTAATAGCTCTCTTGCTATCTAA SEQ ID No. 8 ATGAGGCGGGTTATATTGCCTACTGCTCCTCCTGAATATATGGAGGCCATATACCCTGTCAGGTCAAATTCAACAATTGCTAGAGGTGGCAACAGCAATACAGGCTTCCTGACACCGGAGTCAGTCAATGGGGACACTCCATCGAATCCACTCAGGCCAATTGCCGATGACACCATCGACCATGCCAGCCACACACCAGGCAGTGTGTCATCAGCATTCATCCTTGAAGCTATGGTGAATGTCATATCGGGCCCCAAAGTGCTAATGAAGCAAATTCCAATTTGGCTTCCTCTAGGTGTCGCTGATCAAAAGACCTACAGCTTTGACTCAACTACGGCCGCCATCATGCTTGCTTCATACACTATCACCCATTTCGGCAAGGCAACCAATCCACTTGTCAGAGTCAATCGGCTGGGTCCTGGAATCCCGGATCATCCCCTCAGGCTCCTGCGAATTGGAAACCAGGCTTTCCTCCAGGAGTTCGTTCTTCCGCCAGTCCAACTACCCCAGTATTTCACCTTTGATTTGACAGCACTCAAACTGATCACCCAACCACTGCCTGCTGCAACATGGACCGATGACACTCCAACAGGATCAAATGGAGCGTTGCGTCCAGGAATTTCATTTCATCCAAAACTTCGCCCCATTCTTTTACCCAACAAAAGTGGGAAGAAGGGGAACAGTGCCGATCTAACATCTCCGGAGAAAATCCAAGCAATAATGACTTCACTCCAGGACTTTAAGATCGTTCCAATTGATCCAACCAAAAATATCATGGGAATCGAAGTGCCAGAAACTCTGGTCCACAAGCTGACCGGTAAGAAGGTGACTTCTAAAAATGGACAACCAATCATCCCTGTTCTTTTGCCAAAGTACATTGGGTTGGACCCGGTGGCTCCAGGAGACCTCACCATGGTAATCACACAGGATTGTGACACGTGTCATTCTCCTGCAAGTCTTCCAGCTGTGATTGAGAAGTAA SEQ ID No.9 SEQ ID No.10 SEQ ID No.11 ATGGCTAAAGCCACAGGCCGGTACAACTTGGTAACACCAAAACGGGAGCTAGAGCAAGGAGTTGTGTTTAGCGACCTATGCAACTTCCTAGTGACTCCAACTGTGCAAGGATGGAAGGTTTACTGGGCTGGACTTGAGTTGATGTCAACCAAAAGGGTATTACCCTGTTAAATCGTCTTAAAGTGAAT GATTTTGCTCCTGCATGGGCGATGACCCGGAACCTCTTCCCACACTTGTTCAAAAACCAACAGTCTGAAGTCCAAACTCCCATTTGGGCCTTGAGGGTAATTCTTGCCGCCGGGATTCTTGACCAATTAATGGATCATTCCCTCATTGAGCCGCTATCAGGGGCCCTGAACCTAATTGCTGATTGGTTA CTAACAACATCTACTAATCACTTCAACATGAGAACTCAACGAGTAAAGGACCAACTGAGCATGAGGATGTTATCTCTTATAAGGTCAAATATTATTAACTTTATAAATAAGCTCGAGACTCTTCATGTCGTTAATTACAAGGGACTTCTAAGCAGTGTTGAGATAGGAACACCAAGCTATGCAATCATCATTACCAGGACTAATATGGGTTATCTTGTCGAGGTTCAGGAACCAGATAAATCTGCGATGGATATACGACACCCTGGTCCTGTCAAATTCTCCTTACTACATGAATCGACACTTAAACCTGTTGCCACTCCTAAACCATCAAGCATTACTTCATTGATCATGGAGTTCAACAGTTCTTTGGCAATTTAA SEQ ID No. 12 ATGAGAAGGGTCACTGTGCCGACTGCACCACCTGCCTATGCTGACATTGGCTATCCTATGAGCATGCTTCCCATCAAGTCAAGCAGGGCTGTGAGTGGAATTCAACAGAAACAAGAGGTCCTTCCTGGAATGGATACACCATCAAATTCTATGAGACCTGTTGCTGATGATAACATTGATCATACAAGTCATACCCCGAACGGAGTGGCCTCAGCATTCATCTTGGAGGCAACTGTCAATGTGATCTCGGGGCCCAAAGTCCTCATGAAACAAATCCCTATTTGGTTGCCACTCGGAATTGCTGACCAAAAAACGTACAGTTTTGACTCAACAACAGCAGCAATTATGCTCGCATCTTATACGATCACCCATTTTGGAAAGGCCAACAACCCCCTCGTTAGAGTGAATCGACTTGGTCAGGGAATACCGGATCACCCACTCAGATTGCTCAGGATGGGGAACCAGGCTTTCCTTCAAGAGTTTGTGCTACCACCAGTTCAACTGCCGCAATATTTCACTTTTGATCTGACTGCACTCAAACTAGTGACACAGCCTCTCCCTGCTGCAACATGGACAGATGAGACTCCGAGCAACCTTTCAGGAGCCCTTCGTCCCGGGCTTTCATTTCACCCAAAGCTGAGACCCGTTCTACTTCCAGGCAAGACGGGAAAGAAAGGGCATGTTTCTGATCTGACTGCCCCAGACAAAATTCAGACAATTGTGAACCTGATGCAAGATTTCAAAATCGTGCCAATTGATCCAGCTAAGAGTATCATTGGGATCGAGGTTCCAGAATTGCTGGTCCACAAGCTCACTGGGAAGAAAATGAGTCAGAAGAATGGACAGCCTATAATTCCTGTCTTACTCCCAAAATACATTGGGCTAGATCCAATCTCACCTGGAGACCTGACTATGGTCATAACACCAGATTATGATGATTGTCATTCACCTGCCAGTTGCTCTTATCTCAGTGAAAAGTGA SEQ ID No.13 CAAAACAGGAAGGCGGTATGA SEQ ID No.14 TCATTGATTGGCCCTGGAA SEQ ID No.15 ATGACAATGACATACCC SEQ ID No.16 CCAGACACAGTCCCCACAACT SEQ ID No.17 GTGGCTGGTGGTTTGTTCCT SEQ ID No.18 TGATCCCCGACACAAT SEQ ID No.19 CAAAACAAGTGGACATTACGA SEQ ID No.20 TCATTGATGGGTCCTGGAA SEQ ID No.21 ATGATGACGACATTCCC SEQ ID No.22 CTTGCCACAATCTCCACGAGTCC SEQ ID No.23 GGTGCTGTTGTCCGGACCT SEQ ID No.24 CAATCCCTCACAACCA SEQ ID No.25 CAAGGTTGGAGATCGTTATCC SEQ ID No.26 TCATAGATCGGCCCGGGAA SEQ ID No.27 ATGACAATGATATTCCA SEQ ID No.28 GACAGAAGGTCGAAGAGTAGGT SEQ ID No.29 AATTGTTGCAGCTGTCTCT SEQ ID No.30 TGAACACTCAGGAGAC。
Claims
1. A quality control product for Ebola nucleic acid detection, characterized in that, Using human serum as a matrix, it includes quality control product 1, quality control product 2 and quality control product 3; The quality control sample 1 contains pseudovirus 1 and pseudovirus 2. Pseudovirus 1 contains the tandem sequence of the NP gene and VP24 gene of the Bundibugyo type Ebola virus, and pseudovirus 2 contains the tandem sequence of the GP gene and VP40 gene of the Bundibugyo type Ebola virus. The quality control sample 2 contains pseudovirus 3 and pseudovirus 4. Pseudovirus 3 contains the tandem sequence of the NP gene and VP24 gene of Zaire Ebola virus, and pseudovirus 4 contains the tandem sequence of the GP gene and VP40 gene of Zaire Ebola virus. The quality control sample 3 contains pseudovirus 5 and pseudovirus 6. Pseudovirus 5 contains the tandem sequence of the Sudan Ebola virus NP gene and VP24 gene, and pseudovirus 6 contains the tandem sequence of the Sudan Ebola virus GP gene and VP40 gene. The quality control product 1, quality control product 2 and quality control product 3 respectively include low-concentration quality control product, medium-concentration quality control product and high-concentration quality control product; The copy number concentration range of the low-concentration quality control sample is 1.00 × 10⁻⁶. 3 ~1.00×10 4 The copy number concentration range of the medium-concentration quality control sample is 1.00 × 10⁻⁶ copies / mL. 4 ~1.00×10 5 The high-concentration quality control sample has a copy number concentration range of 1.00 × 10⁻⁶ copies / mL. 5 ~1.00×10 6 copies / mL.
2. The Ebola nucleic acid detection quality control product according to claim 1, characterized in that, The pseudovirus 1 contains a tandem sequence of the nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 3; The pseudovirus 2 contains a tandem sequence of the nucleotide sequences shown in SEQ ID No. 2 and SEQ ID No. 4; The pseudovirus 3 contains a tandem sequence of the nucleotide sequences shown in SEQ ID No. 5 and SEQ ID No. 7; The pseudovirus 4 contains a tandem sequence of the nucleotide sequences shown in SEQ ID No. 6 and SEQ ID No. 8; The pseudovirus 5 contains a tandem sequence of the nucleotide sequences shown in SEQ ID No. 9 and SEQ ID No. 11; The pseudovirus 6 contains a tandem sequence of the nucleotide sequences shown in SEQ ID No. 10 and SEQ ID No.
12.
3. The Ebola nucleic acid detection quality control product according to claim 1, characterized in that, It also includes negative control products; the negative control products are sterile negative human serum matrix.
4. The Ebola nucleic acid detection quality control product according to claim 1, characterized in that, In the quality control sample 1, the copy number ratio of fake virus 1 to fake virus 2 is (1~2):(1~2). In the quality control sample 2, the copy number ratio of fake virus 3 to fake virus 4 is (1~2):(1~2). In the quality control sample 3, the copy number ratio of fake virus 5 to fake virus 6 is (1~2):(1~2).
5. The Ebola nucleic acid detection quality control product according to claim 1, characterized in that, The Ebola nucleic acid test quality control product is a freeze-dried preparation.
6. A method for preparing the Ebola nucleic acid detection quality control product according to any one of claims 1 to 5, characterized in that, Includes the following steps: S1: Construct lentiviral recombinant plasmids containing each tandem sequence; S2: The lentiviral recombinant plasmid and the lentiviral packaging plasmid were co-transfected into HEK293T cells, and the cell supernatant was collected after culture, filtered and purified to obtain pseudoviruses 1-6. S3: Using human serum as a matrix, pseudoviruses are mixed to prepare quality control product 1, quality control product 2 and quality control product 3, respectively, to obtain the Ebola nucleic acid detection quality control product.
7. The preparation method according to claim 6, characterized in that, The lentivirus packaging plasmids include VSV-G, PLP1, and PLP2. The molar ratio of the lentiviral recombinant plasmid, VSV-G, PLP1, and PLP2 is (1~2):(1~2):(1~2):(1~2).
8. A quality control reagent for Ebola nucleic acid detection, characterized in that, It includes the Ebola nucleic acid detection quality control product as described in any one of claims 1 to 5.