Application of soybean ph19 gene in regulating plant height

Editing the soybean PH19 gene using the CRISPR-Cas9 system solved the problem of unclear regulation of soybean plant height, achieving a reduction in plant height without affecting yield, and providing new breeding resources.

CN122382084APending Publication Date: 2026-07-14INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2026-06-05
Publication Date
2026-07-14

Smart Images

  • Figure CN122382084A_ABST
    Figure CN122382084A_ABST
Patent Text Reader

Abstract

The application discloses a soybean PH19 gene in regulating plant height. It relates to the technical field of plant genetic engineering. The application discloses that a soybean PH19 gene has the function of regulating plant height, and the coding region of the soybean PH19 gene is edited by using a CRISPR-Cas9 system, and it is found that PH19 PH19 PH19 PH19 PH19 PH19 after mutation, the soybean plant height can be significantly reduced, and the yield is not affected. The application provides a new genetic resource and a new selection for the coordinated improvement of plant height and yield.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and more specifically to soybeans. PH19 Application of genes in regulating plant height. Background Technology

[0002] Plant height is one of the important agronomic traits of crops, directly affecting plant structure and further influencing lodging resistance and yield. The significant increase in grain yield during the Green Revolution was mainly attributed to the introduction of semi-dwarf traits, which improved lodging resistance and boosted yields under high-density planting conditions. Unlike crops such as rice and wheat, soybeans, one of the world's most important economic oilseed crops, providing high-quality plant protein and oil for global human consumption and animal feed, have not yet experienced their own Green Revolution.

[0003] Soybean plant height is mainly determined by several factors, including hypocotyl length, number of main stem nodes, and internode spacing, and is significantly influenced by the environment. The molecular mechanisms regulating soybean plant height primarily involve two aspects. First, there is the regulation of plant height through hormone metabolic pathways. Reported hormones involved in plant height regulation mainly include gibberellin (GA), auxin (IAA), and brassinolide (BR), all of which are height-promoting factors. Their regulatory mechanisms mainly involve hormone synthesis, metabolism, and response, affecting plant height by altering hormone levels and signal transduction. Related cloned and validated genes include... GA2ox7 , GA2ox8c , GmRGAs On the other hand, there is the light signaling pathway, mainly mediated by the key flowering regulation transcription factors GmFT2a / GmFT5a, which activate... GmAP1 and GmLFY Gene expression promotes flowering and shortens the vegetative growth period, thereby reducing plant height. Hormone metabolism can affect the light signaling pathway, and light can also regulate hormone levels; there is an interaction between the two.

[0004] Although current research on soybean plant height regulation has made some progress, the related mechanisms remain unclear due to the complexity of soybean plant height development. Therefore, further elucidating the molecular mechanisms of soybean plant height regulation and discovering related new genes, especially those with yield-enhancing potential, will provide a theoretical basis and genetic resources for soybean dwarfing and high-density planting breeding.

[0005] Therefore, is it possible to provide soybeans? PH19 The application of genes in regulating plant height is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides soybeans PH19 Application of genes in regulating plant height.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: soybeans PH19 Application of genes in regulating plant height and yield; in, PH19 The gene CDS sequence is shown in SEQ ID NO:2, encoding a protein composed of the amino acid sequence shown in SEQ ID NO:3.

[0008] Preferred method: Using genetic engineering techniques, the PH19 gene in soybean is mutated, causing the gene to lose or weaken its function, thereby reducing plant height without affecting yield.

[0009] This invention also provides a method for reducing soybean plant height while maintaining the same yield per plant, the method comprising: silencing, weakening, or knocking out soybeans. PH19 Genes; among which, PH19 The gene CDS sequence is shown in SEQ ID NO:2.

[0010] Preferred: Genetically modified using CRISPR, TALEN, and ZFN gene editing technologies PH19 Gene.

[0011] Preferred: including: with PH19 Using the gene as a target, a CRISPR-Cas9-based sgRNA sequence was designed. A DNA fragment containing the sgRNA sequence was ligated into a vector carrying CRISPR-Cas9, and soybeans were transformed to obtain transgenic soybeans with the gene function missing.

[0012] The preferred nucleotide sequence for the sgRNA activation site is: Target1: 5'-GGTCATGTTGCAGTGCCAGGAGG-3' as shown in SEQ ID NO:6.

[0013] The present invention also provides the application of any of the above-described methods of transgenic soybeans in plant breeding.

[0014] Preferred breeding methods include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

[0015] This invention also provides soybeans PH19 Application of genes in breeding new dwarf varieties PH19 The gene CDS sequence is shown in SEQ ID NO:2.

[0016] Preferred plant: soybean.

[0017] As can be seen from the above technical solutions, compared with the prior art, the present invention discloses soybean... PH19 The application of genes in regulating plant height and the resulting technical effects are the first time this invention has revealed the role of soybeans in this field. PH19 Genes have the function of regulating plant height. The CRISPR-Cas9 system was used to study this gene. PH19 Editing the coding region of a gene revealed... PH19 The mutation significantly reduces soybean plant height without affecting yield. This invention provides new genetic resources and options for the synergistic improvement of plant height and yield. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0019] Figure 1 The attached figure is provided by the present invention. PH19 A schematic diagram of gene knockout targets and sequence variations, where A: gene structure and target information; B: editing type identification.

[0020] Figure 2 The attached figure is provided by the present invention. PH19 A comparison of transgenic plant height under long-day (16 h light / 8 h dark) and short-day (8 h light / 16 h dark) incubator conditions after gene mutation. In the figure, A: plant phenotype under long-day conditions; B: comparison of plant height under long-day conditions; Hypocotyl: hypocotyl; Epicotpl: epicotyl; 1 st node: length of the first internode; C: plant phenotype under short-day conditions; D: comparison of plant height under short-day conditions.

[0021] Figure 3 The attached figure is provided by the present invention. PH19 After gene mutation, the morphological characteristics and yield identification of transgenic plants in the field are shown in the figure. In the figure, A: plant phenotype at harvest; B: plant height; C: yield per plant; D: plot yield, and ns indicates no significant difference. Detailed Implementation

[0022] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0023] This invention discloses soybeans. PH19 The application of genes in regulating plant height. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0024] Construction of plant expression vector for soybean PH19 gene mutant Example 2

[0025] Obtaining genetically modified soybean plants The vector plasmid obtained in Example 1 was transformed into Agrobacterium and then used for soybean transformation.

[0026] 1. Preparation and transformation of Agrobacterium competent cells 1) Preparation of Agrobacterium competent cells Single colonies of Agrobacterium K599 (Coolaber, AR410-0.2 mL) and EHA105 were picked and placed separately into 5 mL of LB broth containing the corresponding antibiotics. K599 was inoculated with 100 μg / mL streptomycin; EHA105 with 100 μg / mL rifampin. The cultures were incubated overnight at 28°C. 500 μL of the overnight culture was then inoculated into 50 mL of LB broth containing the corresponding antibiotics and incubated at 28°C until OD (October Expiratory Scale) was reached. 600 Approximately 0.6; place on ice for 30 min; centrifuge at 5,000 rpm for 10 min at 4 °C; resuspend Agrobacterium cells in 15 mL of pre-chilled 10 mM CaCl2; centrifuge at 5,000 rpm for 10 min at 4 °C; resuspend the precipitate in 2 mL of pre-chilled 10 mM CaCl2; aliquot 100 μL / tube on ice; flash freeze in liquid nitrogen; store at -80 °C.

[0027] 2) Agrobacterium-mediated transformation Thaw 100 μL of competent cells on ice, add 1 μg of plasmid DNA, mix well, place on ice for 30 min, flash freeze in liquid nitrogen for 5 min, then quickly place in a 37℃ water bath for 5 min, add 1 mL of antibiotic-free LB liquid medium, and revive at 28℃ and 160 rpm for 3-5 h. Spread the bacterial culture evenly on a solid medium containing the corresponding antibiotic. Incubate at 28℃ upside down for 2-3 days. Select single bacteria for PCR identification of positive clones. The reaction mixture consists of 20 μl of template, 1 μl each of F / R primers, 10 μl of KOD One™ PCR Master Mix-Blue (TOYOBO, KMM-201), and 6 μl of ddH2O. The reaction cycle is: 95℃ pre-denaturation for 10 min, 98℃ denaturation for 10 s, 60℃ annealing for 10 s, 68℃ extension for 10 s, 36 cycles, and a final extension at 68℃ for 5 min. Incubate at 4℃. (Primers involved: U626-IDF: TGTCCCAGGATTAGAATGATTAGGC, sgRNA-sc-R: AAAAGCACCGACTCGGTGCCA; Cas9-F2: GTTCATCAAGCCGATTCTGG, Cas9-R2: GCTTCCTGCTCAGCCTCCC). The constructed vector has been successfully transformed into Agrobacterium.

[0028] 2. Detection of CRISPR vector editing efficiency in soybean root hair analysis (1) Seed disinfection: Select healthy, plump seeds without disease spots (otherwise, bacteria will easily grow). Sterilize the beans with chlorine gas produced by the reaction of 4 mL concentrated hydrochloric acid and 100 mL disinfectant water for about 16-18 hours, and then blow off the chlorine gas in a clean bench.

[0029] (2) Seed germination: Place the beans on the prepared germination medium, about 8-10 beans per dish. Cultivate in a greenhouse under light for about 3 days.

[0030] (3) Cut the beans and adjust the OD600 value of the bacterial solution: Cut the cotyledons. Take soybean seeds that have germinated for 4-7 days (preferably 5-6 days) and cut them off 0.3-0.5 cm from the hypocotyl. Cut the cotyledons in half and remove the apical bud. Take out the shaken bacterial solution (K599 Agrobacterium, OD value = 0.8-0.9), centrifuge (4000 rpm, 10 min), resuspend in liquid co-culture medium to make the OD value of the bacterial solution = 0.8-0.9, add the beans to the prepared bacterial solution, shake by hand once every few minutes, and soak for a total of 15 min. Take out and blow for about 10 min.

[0031] (4) Co-culture: Place sterilized filter paper on the co-culture medium, then place the seeds soaked in the bacterial solution evenly on the medium and culture in the dark for 3 days at a temperature of about 25℃.

[0032] (5) Induction culture: After 3 days of dark culture, the plumules elongate. Wash them 4-5 times each with sterile water and liquid induction medium containing hormones to ensure that Agrobacterium is completely removed. Insert the plumules obliquely into the solid induction medium with the plumules facing upwards and place them in a greenhouse for light culture. After about 15 days of culture in the greenhouse, the cotyledons begin to root.

[0033] (6) Root sampling and testing: Take roots growing from the wound of the soybean, 2-3 roots per tube, 3 replicates, extract DNA by CTAB method, perform PCR detection, and sequence (primers and PCR program are the same as 1-2 in Example 2) to confirm that the roots have been successfully transformed into the constructed vector.

[0034] 3. Soybean Conversion (1) Sterilize beans by shaking them with chlorine gas produced by the reaction of concentrated hydrochloric acid and sodium hypochlorite.

[0035] (2) Cut the beans in half, remove part of the embryo tip, make a cut in the meristematic area of ​​the beans, and soak them in sterile water. In the afternoon, take out the shaken bacterial solution, centrifuge (4000 rpm, 10 min), adjust the bacterial solution to make the OD value of the bacterial solution = 0.4-0.6, pour out the sterile water in the beans, add the adjusted bacterial solution, place it in a shaker and shake for 30 min (28℃, about 200 rpm), take it out and blow it for about 10 min, spread it evenly in the co-culture medium and incubate in the dark for 3 days.

[0036] (3) After 3 days of dark culture, the embryo elongates. Wash it 4-5 times each with sterile water and liquid induction medium with added hormones to ensure that Agrobacterium is washed away.

[0037] (4) Cut off the grown embryo, leaving only 3-4 mm in length. Insert the embryo with the wound side facing up into the solid induction medium and place it in a greenhouse for light cultivation.

[0038] (5) After 10 days of cultivation in the greenhouse, some of the soybeans began to sprout. Those with sprouts were cut off from the base and transferred to a new solid induction medium. Those without sprouts were discarded.

[0039] (6) After culturing in the greenhouse for 10 days, the sprouted beans were subcultured into a new solid induction medium, and the beans that did not sprout were discarded. The beans were then cultured in the greenhouse for another 10 days. The beans were cultured in the solid induction medium for a total of 30 days.

[0040] (7) Separate the callus from the bean, discard the bean, scrape off the black surface on the callus, transfer it to a solid elongation medium, replace it with a new solid elongation medium every 20 days, and generally subculture 3-4 times, for a total of 60-80 days.

[0041] (8) Callus is being screened while it is elongating, and seedlings will grow during the screening process. After growing to a certain length, they are transferred to rooting medium.

[0042] (9) After the seedlings have been cultured in the culture medium for about 20-30 days, the seedlings that have grown strong and have developed root systems can be placed in a shaded place for hardening off, which usually takes 5 days.

[0043] (10) Label each seedling with the bean variety, gene name, rooting date, and soil cultivation date. Cover with a thin film and place under light to allow it to adapt to strong light. Remove the film after 3 days. Obtain the transgenic plants to be tested and complete the hardening-off process. Example 3

[0044] Identification of transgenic positive lines To identify transgenic positive plants, DNA was extracted using the CTAB method: 0.1-0.2 g of fresh, tender leaves were placed in a 2 mL centrifuge tube, steel balls were added, the tube was quickly frozen in liquid nitrogen, and the leaves were ground into powder by shaking. 700 μl of preheated 65℃ 2×CTAB extraction buffer (Coolaber, ZT1008-1-500 mL) was added, and the mixture was shaken to mix. The mixture was then incubated in a 65℃ water bath for 60 min, inverting and mixing every 15 min. After cooling to room temperature, 700 μl of chloroform:isoamyl alcohol 24:1 (Amresco, XYHZ-X205-450 mL) was added, and the mixture was vigorously inverted and mixed. The tube was centrifuged at 12000 rpm for 10 min. 500 μl of the supernatant was transferred to a new 1.5 mL centrifuge tube, and an equal volume of pre-chilled isopropanol (Amresco, VWRC0918-20 L) was added. The tube was then incubated at -20℃ for 30 min to precipitate DNA. Centrifuge at 12000 rpm for 10 min, discard the supernatant, add 300 μl of 75% chlorine and rinse twice, centrifuge at 12000 rpm for 1 min; open the lid and air dry at room temperature, add 30-50 μl of ddH2O to dissolve, and store at 4℃.

[0045] PCR detection (primers and PCR steps are the same as in Example 2, sections 1-2): For CRISPR knockout mutants, the Cas9 protein and U6 promoter were detected. The location of the gRNA was amplified by PCR (2D-GmPH19-F34: ACACTGGTATCGGACGATGAC, D-GmPH19-R34: CAGGATTGTAAATAGTGATCTTGCCA), and then sequenced.

[0046] PCR analysis revealed two homozygous edit lines with frameshift mutations, deleting 1 bp and 2 bp from the sgRNA, respectively. These lines were named... PH19 CR1 and PH19 CR2 This can be used for subsequent gene function verification; see the specific sequencing results below. Figure 1 .in Figure 1 A in the middle is PH19 Gene structure diagram and target information, Figure 1 B represents the target sequence detection result. Example 4

[0047] Phenotypic identification of genetically modified soybeans The number of transgenic samples used in this experiment was greater than 10 plants in the incubator and greater than 90 plants in the field, which was statistically significant.

[0048] Transgenic material grown in a controlled-day incubator was subjected to two photoperiod treatments: a long-day condition with 16 hours of light / 8 hours of darkness and day / night temperatures of 26°C / 22°C, and a short-day condition with 8 hours of light / 16 hours of darkness and constant day / night temperatures of 26°C / 22°C. Plant height and internode lengths were measured when the plants reached stage V1. Figure 2 As shown, Figure 2 A and B are under long-day conditions PH19 Statistical analysis of morphology and plant height of mutant and wild-type plants. Figure 2 C and D represent short-day conditions. PH19 Statistical analysis of morphology and plant height of mutant and wild-type plants; Figure 2 The figures in the middle B diagram, from top to bottom, are the hypocotyl, epicotyl, and first internode. PH19 After the mutation, the plant height was significantly reduced under incubator conditions, mainly due to the significant shortening of the epicotyl.

[0049] The transgenic soybean materials for field trials were planted at the Beijing Shunyi Experimental Base of the Institute of Crop Science, Chinese Academy of Agricultural Sciences; the Shennong Seed Industry Laboratory Experimental Base of the Henan Academy of Agricultural Sciences; and the Yangtze University Experimental Base in Hubei Province. Sowing density followed the local conventional soybean planting density. After soybean maturity, plant height, grain weight per plant, and plot yield of wild-type and mutant materials were systematically investigated and statistically analyzed. Figure 3 As shown, Figure 3 When the A-class academy was harvested in Jingzhou... PH19 Morphological characteristics of mutant and wild-type plants. Figure 3 BD is PH19 Statistical analysis of plant height, grain weight per plant, and plot yield of mutants and wild types. PH19 After the mutation, the plant height was significantly reduced, but the yield per plant and the yield per plot did not decrease under the three environments.

[0050] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0051] Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Soybeans PH19 Application of genes in regulating plant height and yield; in, PH19 The gene CDS sequence is shown in SEQ ID NO:2, encoding a protein composed of the amino acid sequence shown in SEQ ID NO:

3.

2. The application according to claim 1, characterized in that, Using genetic engineering techniques to modify soybeans PH19 Gene mutations can cause the gene to lose or weaken its function, thereby reducing plant height without affecting yield.

3. A method for reducing soybean plant height while maintaining the same yield per plant, characterized in that, The method includes: silencing, weakening, or knocking out soybeans. PH19 Genes; among which, PH19 The gene CDS sequence is shown in SEQ ID NO:

2.

4. The method according to claim 3, characterized in that, Using CRISPR, TALEN, and ZFN gene editing technologies to modify PH19 Gene.

5. The method according to claim 3, characterized in that, include: by PH19 Using the gene as a target, a CRISPR-Cas9-based sgRNA sequence was designed. A DNA fragment containing the sgRNA sequence was ligated into a vector carrying CRISPR-Cas9, and soybeans were transformed to obtain transgenic soybeans with the gene function missing.

6. The method according to claim 5, characterized in that, The nucleotide sequence of the sgRNA action site is: Target1: 5'-GGTCATGTTGCAGTGCCAGGAGG-3' as shown in SEQ ID NO:

6.

7. The use of transgenic soybeans obtained by the method according to any one of claims 3-6 in plant breeding.

8. The application according to claim 7, characterized in that, Breeding methods include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

9. Soybeans PH19 The application of genes in breeding new dwarf varieties is characterized by, The PH19 The gene CDS sequence is shown in SEQ ID NO:

2.

10. The application according to claim 9, characterized in that, The plant in question is soybean.