Phalaenopsis aphrodite farnesyltransferase gene and application thereof in regulating synthesis of flavonoids in plant leaves
By cloning the FLS gene of Phalaenopsis orchid and verifying its in vitro enzyme activity, the problem of the scarcity of FLS gene resources in orchids has been solved. This has enabled a significant increase in flavonoid content and flower color regulation in heterologous plants, filling a technological gap in Phalaenopsis flower color improvement and breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- JIANGSU FOOD & PHARMA SCI COLLEGE
- Filing Date
- 2026-04-13
- Publication Date
- 2026-07-14
AI Technical Summary
Orchids, especially Phalaenopsis, have scarce FLS gene resources, their functional research is lagging behind, and there is a lack of evidence of in vitro enzyme activity. Existing technologies cannot be directly applied to the improvement of flower color and metabolic engineering breeding of Phalaenopsis.
The FLS gene of Phalaenopsis orchid was cloned, a recombinant expression vector was constructed, prokaryotic expression and in vitro enzyme activity were verified, and its function of increasing the content of flavonoids in the heterologous plant tobacco was verified by genetic transformation and metabolomics technology.
It provides a specific FLS gene resource for Phalaenopsis orchids, which significantly increases the flavonoid content in heterologous plants and changes the composition ratio of anthocyanins, providing technical support for Phalaenopsis orchid color improvement and breeding.
Smart Images

Figure CN122382091A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of plant molecular biology and genetic engineering technology, and specifically relates to a Phalaenopsis orchid. PaFLS Genes and their application in regulating flavonoid content in plant leaves. Background Technology
[0002] Flavonoids are a class of secondary metabolites widely found in the plant kingdom, possessing various biological activities such as antioxidant, anti-inflammatory, and antibacterial properties. They play important roles in plant flower color formation, stress resistance, and human health. Phalaenopsis aphrodite, a representative ornamental plant of the Orchidaceae family, has flowers rich in various flavonoid chemical components. These components are not only the key material basis for flower color development but also endow Phalaenopsis with potential medicinal value. Therefore, identifying the key enzyme genes regulating flavonoid synthesis in Phalaenopsis and elucidating their functions is of great significance for improving flower color and creating high-flavonoid plant materials.
[0003] Flavonol synthase (FLS) is one of the core enzymes in the flavonoid metabolic pathway in plants. It catalyzes the conversion of dihydroflavonols to flavonols, directly affecting the accumulation levels of flavonols and total flavonoids in plants. Currently, research on the FLS gene mainly focuses on species such as Arabidopsis thaliana, petunia, apple, and tea, and the research content mainly involves gene cloning, expression pattern analysis, and heterologous expression in model plants. For example, existing technology has cloned the FLS gene from tea and introduced it into tobacco through Agrobacterium-mediated transformation, confirming that it can increase the flavonol content in transgenic tobacco leaves. However, the above-mentioned existing technologies still have the following problems and shortcomings: (1) There is a lack of key regulatory genes for flower color formation in orchids, and functional research is lagging behind. The FLS gene of orchids, especially Phalaenopsis, has not been systematically cloned or its function reported. Due to the significant differences in sequence structure, enzymatic characteristics and substrate preference of FLS genes in different plant groups, existing FLS genes from non-orchid sources are difficult to be directly applied to the improvement of flower color or metabolic engineering breeding of Phalaenopsis.
[0004] (2) The methods for functional verification are incomplete, and there is a lack of evidence of in vitro enzyme activity. Most existing studies only use real-time quantitative PCR to detect the correlation between the expression level of the FLS gene and the flavonoid content, or rely solely on changes in phenotype and metabolites after genetic transformation to infer gene function. Although such methods can indirectly reflect the role of the gene, they cannot directly prove that the protein encoded by the gene has the catalytic activity of flavonol synthase. The lack of direct evidence of in vitro enzyme activity makes the confirmation of gene function uncertain.
[0005] (3) No systematic functional verification and evaluation of the Phalaenopsis FLS gene has been conducted. Although the FLS gene has been used to increase the flavonoid content of some plants, there are no reports on whether the Phalaenopsis FLS gene has the ability to regulate the synthesis of flavonoids in heterologous plants (such as tobacco), or whether its effect is significant. Existing technologies also do not provide in vitro enzymatic data on the protein encoded by the Phalaenopsis FLS gene and verification of its metabolic effects in plants.
[0006] In summary, there is an urgent need in this field to provide an FLS gene derived from Phalaenopsis orchids and to establish a complete functional verification system from gene cloning, protein expression, in vitro enzyme activity verification to plant genetic transformation and metabolomics detection, so as to make up for the shortcomings of existing technologies in the confirmation of FLS gene resources and functions in orchids. Summary of the Invention
[0007] To address the shortcomings of existing technologies, the present invention aims to provide an FLS gene and its encoded protein derived from Phalaenopsis orchids, filling the gap in FLS gene resources for orchids; to establish a method for prokaryotic expression and in vitro enzyme activity verification of this gene, obtaining direct evidence of its catalytic function; and to verify the function of this gene in increasing flavonoid content in the heterologous plant tobacco through genetic transformation and metabolomics technologies, thereby providing new gene resources and technical support for Phalaenopsis flower color improvement and breeding of high-flavonoid plants.
[0008] This invention is achieved through the following technical solution: A type of Phalaenopsis orchid PaFLS The gene, whose amino acid sequence is shown in SEQ ID No. 1.
[0009] Furthermore, containing the aforementioned PaFLS Recombinant gene expression vectors.
[0010] Furthermore, the aforementioned PaFLS Proteins encoded by genes.
[0011] Furthermore, the aforementioned PaFLS The application of genes in regulating the synthesis of flavonoids in plant leaves is characterized in that the regulation of flavonoid synthesis in plant leaves includes promoting the synthesis of flavonoids.
[0012] Furthermore, the application includes the following steps: (1) constructing a system containing... PaFLS (2) Transforming the constructed recombinant expression vector into plant tissues or plant cells; (3) ... PaFLS The gene is overexpressed in plant tissues or cells.
[0013] Furthermore, utilizing the aforementioned PaFLSA method for gene regulation of flavonoid synthesis in plant leaves includes the following steps: (1) constructing a recombinant expression vector containing the gene described in claim 1; (2) transforming the constructed recombinant expression vector into recipient plant tissues by freeze-thaw method; and (3) overexpressing the gene encoding the gene described in claim 1 in plant tissues or cells.
[0014] Furthermore, the plant in question is a Phalaenopsis orchid. Phalaenopsis aphrodite Furthermore, the aforementioned PaFLS The application of genes in Phalaenopsis orchid breeding, wherein the breeding refers to the cultivation of Phalaenopsis orchids with new flower colors.
[0015] Furthermore, the aforementioned PaFLS Gene cloning methods include the following steps: Using fresh Phalaenopsis orchid leaves as material, a rapid cDNA end amplification technique was employed with degenerate primers to clone the middle fragment of the FLS gene. The 3' and 5' ends were then amplified using nested PCR. DNAMAN software was used to splice the three sequences to obtain the complete Phalaenopsis orchid FLS gene, which is the... PaFLS Gene; The degenerate primer sequences are shown below: F: CARGARGARAARGAGGTKTA; R:ATGTGRMNGANRAGGGCAT.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. Existing FLS genes are mostly derived from non-orchidaceous plants such as Arabidopsis thaliana and tea trees. Due to significant differences in FLS sequences and enzymatic characteristics among different plants, these genes cannot be directly applied to improve the flower color of Phalaenopsis orchids. This invention clones and verifies the PaFLS gene of Phalaenopsis orchids for the first time, providing a PaFLS gene resource specifically for Phalaenopsis orchids. This fills a gap in the research on gene resources and functions of orchidaceous plants and provides a dedicated gene element for subsequent precision molecular breeding of Phalaenopsis orchids.
[0017] 2. This invention achieves functional verification of significantly increasing flavonoid content in heterologous plants: through genetic transformation and metabolomics technologies, the high efficiency of this gene in improving the metabolic quality of heterologous plants was confirmed. Increased accumulation of flavonoid products was observed in transgenic tobacco leaves. PaFLS High gene expression directly leads to a significant increase in the content of flavonoid components.
[0018] 3. Since flavonoids are the main coloring substances in Phalaenopsis orchids, this invention can not only increase flavonoid content, but also change the composition ratio of pigments in petals by regulating the expression level of this gene, laying a technical foundation for cultivating Phalaenopsis orchids with new flower colors. This invention provides... PaFLS Genes are the key material basis for regulating flower color, providing new technical support for improving the flower color of ornamental plants. Attached Figure Description
[0019] Figure 1 This is an RNA electrophoresis image, where 1: DL2000 DNA Marker; 2: RNA; 3: RNA; Figure 2 This is a diagram showing the cloning results of the core fragment of the FLS gene, where 1: DL2000 DNA Marker; 3: FLS; Figure 3 This is a diagram showing the cloning results of the 3' end fragment of the FLS gene, where 1: DL2000 DNA Marker; 3: FLS; Figure 4 This is a diagram showing the cloning results of the 5' end fragment of the FLS gene, where 1: DL2000 DNA Marker; 3: FLS; Figure 5 This is a diagram showing the PCR validation results of the full-length sequence, where 1: DL2000 DNA Marker; 2-5: FLS; Figure 6 The image shows the results of double enzyme digestion verification of the recombinant vector, where M: DNA Marker; 2: pET-30a(+)-FLS double enzyme digestion; Figure 7 The image shows the expression results of FLS protein in Escherichia coli BL21. In the figure, M: Protein Marker; 0: Empty vector control; 1: Whole bacteria induced at 15℃ for 16 h; 2: Whole bacteria induced at 37℃ for 16 h; 3: Supernatant after whole bacterial lysis; 4: Precipitate after whole bacterial lysis; 5-7: 50 mM imidazole elution fractions; 8-12: 100 mM imidazole elution fractions; 13-14: 500 mM imidazole elution fractions; 15: Western Blot Marker; 16: Western blot analysis of FLS protein. Figure 8 HPLC detection of FLS protein in vitro enzymatic reaction products, where a: mixed reference standard; b: FLS protein catalyzes the conversion of dihydroquercetin to quercetin; c: blank carrier control; peak 1: dihydroquercetin; peak 2: quercetin; Figure 9These are representative images of transgenic tobacco plants overexpressing the FLS gene. Among them, a: screening culture of transgenic tobacco seedlings; b: rooting culture of transgenic tobacco seedlings; c and d: transgenic tobacco lines. Figure 10 The image shows a screenshot of the PCR detection of transgenic tobacco, where L1, L2, L4, L6, and L8 are positive transformation lines. Figure 11 The image shows the results of flavonoid content detection in genetically modified tobacco. Detailed Implementation
[0020] The present invention will now be described in detail with reference to specific embodiments.
[0021] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.
[0022] This invention successfully cloned and replicated fresh Phalaenopsis orchid leaves. PaFLS The gene was identified, and its function in increasing flavonoid content in the heterologous plant tobacco was verified using genetic transformation and metabolomics technologies. The specific process was as follows: Step 1: Phalaenopsis Orchid FLS Gene cloning: Using rapid cDNA end amplification technology, degenerate primers were first designed to clone the middle fragment of the FLS gene. Then, nested PCR was used to amplify the 3' and 5' end sequences. The three sequences were then spliced together using DNAMAN software to obtain the complete Phalaenopsis orchid. FLS Gene.
[0023] Step 2: Construction of the prokaryotic expression vector: Using the coding region sequence of the Phalaenopsis orchid FLS gene as a template, specific primers with restriction enzyme sites were designed, and the target gene fragment was obtained by PCR amplification. The target gene fragment and the prokaryotic expression vector pET-30a(+) were double-digested with restriction endonucleases, and after recovery by agarose gel electrophoresis, the target gene was ligated into the linearized vector using T4 DNA ligase. The vector was transformed into competent E. coli cells, positive clones were screened, and sequencing was performed to verify the results, thus obtaining the recombinant prokaryotic expression vector.
[0024] Step 3: Induction and Purification of Recombinant Protein: The correctly sequenced recombinant prokaryotic expression vector was transformed into *E. coli* expression strain BL21(DE3), and positive transformants were obtained after antibiotic screening. Single colonies were picked and cultured in liquid culture. Once the bacterial concentration reached a suitable OD value, an inducer (isopropyl-β-D-thiogalactoside, IPTG) was added to induce expression, enabling efficient expression of the recombinant protein in *E. coli*. The bacterial cells were collected and lysed by ultrasonic or high-pressure disruption. The supernatant and precipitate were separated by centrifugation. Nickel column affinity chromatography was used to purify the target recombinant protein from the supernatant, utilizing the principle that the polyhistidine tag (His-tag) carried by the recombinant protein specifically binds to nickel ions. The purified product was identified by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot.
[0025] Step 3: In vitro enzyme activity verification of the protein: Using dihydroquercetin as a substrate, a 500 μL enzymatic reaction system contained 20 mmol / L Tris-HCl buffer (pH 7.5), 40 μmol / L ferrous sulfate, 1 mmol / L α-ketoglutarate, 20 μmol / L dihydroquercetin, 1 mg sodium ascorbate, 0.25 mg catalase, 0.05 mg bovine serum albumin (BSA), and 100 μg of purified recombinant FLS protein. The reaction system was incubated at 30°C for 30 minutes. The reaction was then terminated by adding an equal volume of EDTA, followed by extraction with 500 μL ethyl acetate. The ethyl acetate layer was aspirated, dried under nitrogen, and finally reconstituted with 1 mL of methanol. The reaction products were detected by high performance liquid chromatography (HPLC) under the following chromatographic conditions: detection wavelength of 360 nm, with all other conditions as before. The amount of flavonol products (such as quercetin) produced was detected to confirm that the recombinant protein has the catalytic activity of flavonol synthase.
[0026] Step 4: Plant overexpression vector pHG-FLS Construction: Using Phalaenopsis orchids FLS Using the coding region sequence of the gene as a template, specific primers with restriction enzyme sites were designed, and the target gene fragment was obtained by PCR amplification. The target gene fragment and the plant binary expression vector (pHG vector) were double-digested with restriction endonucleases, respectively. After recovery by agarose gel electrophoresis, the target gene was ligated into the linearized vector using T4 DNA ligase. The vector was transformed into competent E. coli cells, positive clones were screened, and sequencing was performed to verify the results, thus obtaining the recombinant plant expression vector.
[0027] Step 5: Contains pHG-FLSPreparation of recombinant Agrobacterium: The above recombinant plant expression vector was transformed into Agrobacterium competent cells (such as GV3101 strain) by freeze-thaw method. Positive transformants were obtained by antibiotic screening and verified by colony PCR to obtain recombinant Agrobacterium strains containing the target gene.
[0028] Step Six: Cultivation of Transgenic Tobacco: Wild-type Nicotiana benthamiana seeds were used as material. After surface sterilization, they were inoculated into MS medium for aseptic germination culture to obtain sterile seedlings. Sterile tobacco leaves were taken, the midrib was removed, and leaf disc explants were prepared. The explants were placed in an inoculation solution containing recombinant Agrobacterium and shaken for infection. They were then rinsed with MS culture medium, the surface moisture was absorbed, and they were transferred to MS differentiation medium for co-culture. After co-culture, the explants were transferred to MS selection medium containing screening antibiotics and cultured under light conditions to induce adventitious bud differentiation. When the adventitious buds reached a suitable size, the buds were excised and transferred to MS rooting medium to induce rooting, obtaining complete transgenic tobacco plants.
[0029] Step 7: Molecular Detection of Transgenic Tobacco: Genomic DNA was extracted from the leaves of transgenic tobacco plants and amplified by PCR using primers specific to the target gene to identify positive transgenic plants. Total RNA was further extracted from positive plants, and cDNA was synthesized by reverse transcription. The expression level of the target gene in transgenic tobacco was detected using real-time quantitative PCR, with the housekeeping gene used as an internal control. -ΔΔCT The relative expression level is calculated using this method.
[0030] Step 8: Metabolomics Analysis of Transgenic Tobacco: Leaves from transgenic tobacco lines with high expression of the target gene and wild-type control plants were selected. Metabolites were extracted using methanol solution via ultrasonic extraction, followed by centrifugation and filtration to obtain samples. Untargeted metabolomics detection was performed on the samples using ultra-high performance liquid chromatography-tandem mass spectrometry (UPLC-MS / MS). UPLC conditions included a C18 reversed-phase column with gradient elution using formic acid-water and acetonitrile as the mobile phase; mass spectrometry conditions included an electrospray ionization source, acquiring data in both positive and negative ion modes. The raw data underwent preprocessing including peak extraction, noise reduction, and peak alignment, and were compared with a metabolite database for identification. Principal component analysis and partial least squares discriminant analysis were used to screen for differentially expressed metabolites between transgenic and wild-type plants, focusing on changes in flavonoid content to verify the regulatory function of the target gene on flavonoid synthesis.
[0031] To further illustrate the technical means and effects of the present invention, the present invention will be further described below in conjunction with embodiments and accompanying drawings.
[0032] Example 1 (1) Sample processing: The material used in this embodiment is fresh Phalaenopsis orchid leaves. In May 2025, the leaf tissue was placed into sterilized centrifuge tubes, immediately placed in liquid nitrogen for quick freezing, and then stored in a -80°C freezer.
[0033] (2) Leaf RNA extraction: Leaf RNA was extracted using the TIANGEN Plant RNA Extraction Kit (DP432), and cDNA was synthesized using a reverse transcription kit. RNA was detected by 1.2% agarose gel electrophoresis. Figure 1 As shown, the lanes showed virtually no diffusion and no protein or DNA contamination. Two bands, 28S and 18S, were visible, with the 28S band being 1.5 to 2 times brighter than the 18S band, indicating that the RNA was intact and undegraded. (3) Degenerate primer design: Search for FLS sequences of closely related species on NCBI, and use DNAMAN software to perform multiple sequence alignment to identify conserved regions with low variation. Degenerate sites in conserved regions have base differences. When designing primers, all possible bases at degenerate sites should be included. Degenerate primers were designed using Primer 5.0 software.
[0034] The degenerate primer sequences are as follows: F: CARGARGARAARGAGGTKTA; R:ATGTGRMNGANRAGGGCAT.
[0035] (4) Cloning of the core fragment: Using cDNA as a template, the core fragment of the Phalaenopsis orchid FLS gene was amplified using degenerate primers. The PCR reaction system was as follows: 3 μL template cDNA, 1.5 μL forward primer (Y1 / Y3), 1.5 μL reverse primer (Y2 / Y4), 12.5 μL 2×Pfu PCR Mix, 6.5 μL sterile ddH2O, and a total reaction volume of 25 μL. The PCR amplification program was as follows: 94℃ pre-denaturation for 4 min, 94℃ denaturation for 1 min, 50℃ annealing for 40 s, 72℃ extension for 1 min, repeated 35 times, with a final extension of 10 min at 72℃. The obtained PCR products were examined by agarose gel electrophoresis. The target band was then excised from the gel and the amplified product was purified.
[0036] like Figure 2 As shown, an amplified FLS gene product of approximately 500 bp was obtained. The sequence obtained after sequencing was compared with the BLAST sequence on the NCBI website. The results showed that the FLS gene sequence similarity with closely related plants was 95.87%, and the sequence was a fragment of the Phalaenopsis orchid FLS gene.
[0037] SEQ ID No.1 GATATCGGCGGTGGTGATGAGGAGAAGGTGATGGAGGCGGTGGTGGAGGCGGCGAGGGAGTGGGGGATATTCCAGGTGGTGAACCACGGGGTTCCGGCGGAGGCGGTGAGGAAGCTACAGAGAGTCGGGAAAGAGTTTTTCGAGTTGCCTCAGGAGGAGAAGGATAAGTATGCGATGAAGGAAGGGAAGCTTGAGGGATACGGGACTAAGCTTCAGAAGGAGGTTGCCGGGAAGAAGGCTTGGGTTGATTTTCTGTTTCATAATGTGTGGCCGCCCGCGAGTATTGATCATCGGGTCTGGCCCGAAAACCCGCCCGATTACAGGAAAGTAAATGAGGAATATGCTCAATACCTTCTGACTGTGGTAGAAAATCTATTGAAGTGGCTTTCTAGAGGGCTAGGGCTTGAAGGAAATGTGCTGAAGATGGCATTGGGTGGTGGTGAGATGGAATATTTACTGAAAATCAATTATTACCCTCCATGCCCTAGACCTGATCTGGCTTTGGGTGTGGTGGCCCACACTGATCTATCTGCAATTACCATTTTGGTCCCCAATGAGGTCCCTGGCTTACAAGTTTTCAGAAAT (5) Transformation of Escherichia coli DH5α competent cells and screening of positive clones: The purified gene fragment was added with an "A" tail using the TaKaRa A-Tailing kit, and then the target gene was ligated into a plasmid vector. 1 μL of pMD 18-T Vector reagent, 4 μL of gel-recovered DNA solution, and 5 μL of Solution I ligation solution were added to a microcentrifuge tube and reacted at 16℃ for 1.5 h. Then, E. coli DH5α competent cells were transformed on a sterile operating table: the competent cells were thawed on ice, and 10 μL of the ligation product from the previous step was added to 100 μL of E. coli DH5α competent cells, and gently tapped to mix; the cells were incubated on ice for 30 min to allow the cells to adsorb DNA; the cells were then incubated in a 42°C water bath for 90 s to allow the cells to take up DNA; the centrifuge tubes were then quickly transferred to an ice bath to cool for 2–3 min, without shaking during this time; 900 μL of ampicillin-free LB broth was added to the centrifuge tubes, and the cells were incubated at 37°C with shaking at 190 rpm for 1 h to allow the cells to recover; a certain amount of the bacterial culture was evenly spread on LB agar plates and incubated at 37°C for 12–16 h. Several white single colonies were picked and placed in 20 μL of sterile water as templates for direct colony PCR verification of positive clones.
[0038] (6) Plasmid extraction and sequencing: Extract the plasmid from the positive bacterial solution in the previous step using a plasmid extraction kit.
[0039] (7) Cloning of the 3' end of the FLS gene: The 3' end was cloned using the rapid amplification of cDNA ends (RACE) technology, which is based on nested PCR and falling PCR to amplify the 3' end of the gene. The self-designed specific primer F3 was used as the upstream primer, and a universal primer 3' RACE Outer Primer containing a partial adapter sequence was used as the downstream primer. The first strand of cDNA was used as a template for the first round of PCR amplification. Then, the self-designed specific primer F4 was used as the upstream primer, and a universal primer 3' RACE Inner Primer containing a partial adapter sequence was used as the downstream primer. The first round of PCR products was used as a template for the second round of PCR amplification, thereby amplifying the DNA fragment at the 3' end of the gene.
[0040] The specific primer F3 sequence is as follows: AGGCACCCCAGGCTTTACAC; The specific primer F4 sequence is as follows: CTGGCGTAATAGCGAAGAGGC.
[0041] Add 1 μL of 3' adaptor prime, 3 μL of RNA, and 6 μL of enzyme-free ddH2O to a microcentrifuge tube. Mix well and centrifuge briefly. Incubate at 65°C for 5 min, then on ice for 2 min. Add 10 μL of Reverse Transcriptase Mix (RNase H-) to the above system, mix well, centrifuge briefly, incubate at 50°C for 30 min, and heat at 85°C for 1 min to obtain the cDNA solution. The first round of PCR amplification reaction system is: 13.5 μL Taq SuperMix, 0.5 μL cDNA, 0.5 μL 3' RACEOuter primer, 0.5 μL specific primers F1 / F3 (designed according to the core fragment), and 5 μL enzyme-free ddH2O. A landing PCR amplification program was used: 94℃ pre-denaturation for 60 s, 94℃ denaturation for 30 s, 70℃ annealing for 30 s, and 72℃ extension for 60 s. This cycle was repeated 10 times, with the temperature decreasing by 1℃ for each cycle. After the temperature dropped to 60℃, the cycle was 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 60 s, and a final 8 min extension at 72℃. The product was then stored at 16℃. The second round PCR reaction system consisted of: 13.5 μL Taq SuperMix, 0.5 μL of the first round PCR product, 0.5 μL 3'RACE Inner Primer, 0.5 μL of specific primers F2 / F4, and 5 μL of enzyme-free ddH2O. The PCR amplification program was the same as the first round. PCR products were examined using 1.2% agarose gel electrophoresis. The target band was excised, recovered from the gel, ligated into the pMD 18-T vector, transformed into *E. coli* DH5α competent cells, and positive colonies were selected using a blue-white screening method. Plasmids were extracted and sequenced.
[0042] like Figure 3 As shown, an FLS gene amplification product of approximately 400 bp was obtained. Sequencing results revealed that both sequences had polyadenylated tails (PolyA tails), indicating that the obtained sequences were 3' end sequences. BLAST alignment in the NCBI database showed a 98.21% similarity to the FLS gene sequence of closely related plants.
[0043] (8) Cloning of the 5' end of the FLS gene: The 5' end of the gene is cloned using a specific sequence in the mRNA as a binding site, and first-strand cDNA is synthesized using specific reverse transcription primers. 10-15 (dC) residues are added under the action of TdT enzyme. Using the 5' adapter primer as the upstream primer and the specific primer R4 as the downstream primer, and the cDNA as the template, the first round of PCR amplification is performed. Then, using the 5' RACE Outer Primer as the upstream primer and another specific primer R5 as the downstream primer, and using the first round of PCR products as the template, the cDNA fragment at the 5' end of the F3H gene is amplified.
[0044] The specific primer R4 sequence is as follows: CATACGAGCCGGAAGCATAAAG; The specific primer R5 sequence is as follows: GCTGCAAGGCGATTAAGTTGG.
[0045] Add 1 μL of 5' RACE reverse transcription primers R0 / R1, 3 μL of RNA, and 6 μL of enzyme-free ddH2O to a microcentrifuge tube. Briefly centrifuge to mix, incubate at 65°C for 5 min, then on ice for 2 min. Add 10 μL of Reverse Transcriptase Mix, incubate at 50°C for 30 min, and heat at 85°C for 1 min to eliminate RNA secondary structures. Add 7 μL of RNase H Mix to the above 20 μL cDNA solution, and incubate in a PCR instrument at 37°C for 20 min, 70°C for 10 min, 16°C for 1 min, and on ice for 3 min for RNase H digestion. Mix the above cDNA product with 73 μL of enzyme-free ddH2O and 100 μL of isopropanol, and purify the cDNA using a SanPrep column DNA gel extraction kit. The following reaction mixture was prepared using TdT terminal transferase with added (dC) residues: 38.5 μL cDNA, 0.5 μL dCTP, and 10 μL 5×TdT Buffer were mixed and incubated at 94°C for 3 min. After heating, the mixture was incubated on ice for 3 min. Then, 1.5 μL of TdT enzyme was added, and the mixture was incubated at 37°C for 15 min, 70°C for 10 min, and 16°C for 1 min. The first round of PCR amplification consisted of: 13.5 μL Taq SuperMix, 0.5 μL cDNA, 0.5 μL 5' adaptor primer, 0.5 μL specific primers R2 / R4, and 5 μL enzyme-free ddH2O. The landing PCR amplification program was used, following the same method as above. The second round of PCR consisted of: 13.5 μL Taq SuperMix, 0.5 μL of the first round PCR product, 0.5 μL 5' RACE Outer Primer, 0.5 μL specific primers R3 / R5, and 5 μL enzyme-free ddH2O. The second round also used the landing PCR amplification procedure, following the same method as above. PCR products were examined using 1.2% agarose gel electrophoresis. The target band was excised, recovered from the gel, and ligated into the pMD 18-T vector. This vector was then transformed into *E. coli* DH5α competent cells. Positive colonies were selected using the blue-white screening method, and plasmids were extracted and sequenced. DNAMAN software was used to assemble the middle, 5', and 3' ends of the F3H and FLS genes into a complete sequence.
[0046] like Figure 4 As shown, an amplified FLS gene of approximately 500 bp was obtained. The sequence was compared with the FLS gene sequence of closely related plants in the NCBI database by BLAST. The results showed that the similarity was 94.24%.
[0047] (9) PCR verification of the full-length sequence: primers FLS-F / R were designed at the 5' and 3' ends of the FLS gene, respectively, and amplified using Phalaenopsis cDNA as a template; The primer FLS-F / R sequence is as follows: FLS-FF:CACCAAAGTTTCTAATGGCGG; FLS-R:GGAAAACAAGTAGATGTTGGCTAC.
[0048] PCR reaction system: 2 μL template cDNA, 1 μL each of forward and reverse primers, 12.5 μL 2×Pfu PCR Mix, and 8.5 μL ddH2O. Amplification program: 94℃ pre-denaturation for 4 min, 94℃ denaturation for 1 min, 55℃ annealing for 40 s, 72℃ extension for 1 min, repeated 35 times, followed by a final extension at 72℃ for 10 min. Reaction products were detected by 1.2% agarose gel electrophoresis. The PCR products were ligated with an "A" tail to the pMD 18-T vector to construct the pMD 18-T-F3H and pMD 18-T-FLS recombinant vectors. These vectors were transformed into *E. coli* DH5α competent cells, and plasmids of positive clones were extracted and sequenced to verify sequence consistency with the spliced sequences.
[0049] like Figure 5 As shown, the complete FLS gene sequence was obtained with a total length of 1231 bp, including a 50 bp 5' untranslated region, a 170 bp 3' untranslated region, and a 1011 bp open reading frame encoding 336 amino acids. PCR verification results showed electrophoretic bands of the predicted size, and sequencing results were consistent with the spliced sequence.
[0050] (10) Double enzyme digestion verification of prokaryotic expression vector: The FLS gene was ligated into the pET-30a(+) vector by double enzyme digestion. The recombinant vector was then double-digested to verify whether the ligation was successful. Figure 6 As shown, the recombinant vectors were all digested with enzymes and produced two bands, the size of which was consistent with that of the FLS gene and the vector, indicating that the vector construction was successful.
[0051] (11) Induction and activity verification of FLS gene in prokaryotes: The recombinant vector was introduced into Escherichia coli BL21, and IPTG was used to induce expression at 15℃ and 37℃. FLS showed a band at approximately 38 kDa, consistent with the results predicted by bioinformatics analysis. Based on the size of the protein band, the optimal expression temperature for FLS protein was determined to be 37℃. After the bacterial culture induced at the optimal temperature was lysed and centrifuged, the precipitate and supernatant were subjected to SDS-PAGE electrophoresis, respectively. The results showed that both proteins existed in the form of soluble protein and inclusion body protein. At the same time, the Western blot results showed that the protein in the supernatant produced specific bands at the corresponding positions, indicating that the protein expression was accurate. The protein taken from the supernatant was purified by nickel column affinity chromatography, and the SDS-PAGE electrophoresis results were as follows. Figure 7 In this experiment, imidazole concentrations of 50 mM, 100 mM, and 500 mM were selected for protein elution. The results showed that the purification effect of FLS protein was good, with almost no impurities. The optimal elution concentration was 100 mM.
[0052] (12) Catalytic activity experiment of FLS-expressed protein: The purified protein was subjected to an in vitro enzymatic reaction to verify its function. The HPLC results of the reaction products are shown below. Figure 8 Using dihydroquercetin as a substrate and empty-vector induced protein as a control, the purified protein was added for catalysis. Dihydroquercetin and quercetin appeared at the same retention time as the control, while the blank control had no product peak, indicating that the FLS protein has catalytic activity.
[0053] (13) Acquisition and molecular detection of transgenic tobacco: After co-culture, screening culture, and rooting culture, tobacco plants transformed with the FLS gene were successfully obtained. Eight transgenic tobacco lines were selected for PCR detection. Figure 9 Electrophoretic bands appeared at positions similar in size to the open reading frame, identifying L1, L2, L4, L6, and L8 as positive transformation lines. Figure 10 ).
[0054] (14) Determination of flavonoid content in genetically modified tobacco: Leaves from L1, L2, L4, L6, and L8 positive transgenic tobacco plants and wild-type control plants were selected. After being rapidly ground into a fine powder by liquid nitrogen freezing, 0.1 g of the lyophilized powder was accurately weighed and added to 1.5 mL of 70% methanol aqueous solution containing 1% formic acid. Extraction was performed at room temperature with ultrasonic assistance for 30 minutes, followed by centrifugation at 12,000 rpm for 15 minutes at 4°C. The supernatant was filtered through a 0.22 μm organic phase microporous membrane and stored in a brown sample vial protected from light. High-performance liquid chromatography (HPLC) was used for separation and detection. A C18 reversed-phase column was used as the stationary phase, and gradient elution was performed using 0.1% formic acid-water solution and acetonitrile as the mobile phase. The flow rate was set at 1.0 mL / min, the column temperature was maintained at 30°C, and the injection volume was 10 μL. Quercetin and kaempferol were detected at 360 nm, and myricetin was detected at 370 nm. Precisely weighed kaempferol, quercetin, and myricetin standards were used to prepare gradient concentration mixed standard solutions. Qualitative analysis was performed based on retention time, and quantitative analysis was conducted using peak area using the external standard method. Three biological replicates were set up for each sample. Data are expressed as mean ± standard deviation. Results are as follows: Figure 11 As shown, compared with wild-type tobacco, the contents of kaempferol, quercetin, and myricetin in transgenic tobacco lines all showed a significant upward trend. This result indicates that the successful expression of the exogenous gene in tobacco effectively enhanced the metabolic flux of the upstream flavonoid synthesis pathway, promoting the conversion and accumulation of dihydrokaempferol, dihydroquercetin, and dihydromyricetin into their corresponding flavonol products, further confirming the positive regulatory function of the target gene on the flavonol branch metabolic network.
[0055] The above description of the embodiments is only for illustrating the technical concept and features of the present invention. Its purpose is to enable those skilled in the art to understand the content of the present invention and implement it accordingly. Those skilled in the art can obviously easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative effort. Therefore, the above embodiments should not be used to limit the scope of protection of the present invention. All improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be covered within the scope of protection of the present invention.
Claims
1. Separated from Phalaenopsis orchids PaFLS Genes, characterized by, The amino acid sequence is shown in SEQ ID No.
1.
2. Containing the contents of claim 1 PaFLS Recombinant gene expression vectors.
3. The claim 1 PaFLS Proteins encoded by genes.
4. As described in claim 1 PaFLS The application of genes in regulating flavonoid synthesis in plant leaves is characterized by, The regulation of flavonoid synthesis in plant leaves includes promoting flavonoid synthesis.
5. The application according to claim 4, characterized in that, Includes the following steps: (1) Construct a recombinant expression vector containing the gene of claim 1; (2) Transform the constructed recombinant expression vector into plant tissues or plant cells; (3) Overexpress the gene of claim 1 in plant tissues or cells.
6. The application according to claim 4 or 5, characterized in that: The plant in question is a Phalaenopsis orchid. Phalaenopsis aphrodite .
7. Using the method described in claim 1 PaFLS A method for regulating flavonoid synthesis in plant leaves using gene regulation, characterized in that, Includes the following steps: (1) Construct a recombinant expression vector containing the gene described in claim 1; (2) Transform the constructed recombinant expression vector into recipient plant tissues by freeze-thaw method; (3) Overexpress the gene encoding the gene described in claim 1 in plant tissues or cells.
8. The method according to claim 7, characterized in that: The plant in question is a Phalaenopsis orchid. Phalaenopsis aphrodite .
9. As described in claim 1 PaFLS The application of genes in Phalaenopsis orchid breeding is characterized by, The breeding program aims to develop new varieties of Phalaenopsis orchids with new flower colors.
10. The claim 1 PaFLS A gene cloning method, characterized in that, Includes the following steps: Using fresh Phalaenopsis orchid leaves as material, a rapid cDNA end amplification technique was employed with degenerate primers to clone the middle fragment of the FLS gene. The 3' and 5' ends were then amplified using nested PCR. DNAMAN software was used to splice the three sequences to obtain the complete Phalaenopsis orchid FLS gene, which is the... PaFLS Gene; The degenerate primer sequences are shown below: F: CARGARGARAARGAGGTKTA; R:ATGTGRMNGANRAGGGCAT.