Mammalian cells stably expressing hirudin fusion protein and construction method and application thereof
By constructing a hirudin-3×FLAG tag fusion gene in mammalian cells and inserting it into an expression vector, the hirudin fusion protein was efficiently and stably expressed, solving the problems of low yield and high cost in hirudin production. This provides a large-scale, low-cost production pathway with significant economic and social benefits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
- Filing Date
- 2026-03-23
- Publication Date
- 2026-07-14
AI Technical Summary
Existing methods for producing hirudin suffer from problems such as low yield, low activity, and high cost, especially in terms of shortcomings in commercialization methods and microbial expression systems.
A mammalian cell that stably expresses hirudin fusion protein was constructed by synthesizing the hirudin-3×FLAG tag fusion gene, inserting it into an expression vector, and transfecting it into mammalian cells to achieve efficient and stable expression of the hirudin fusion protein.
This study achieved efficient and stable expression of hirudin fusion protein with high anticoagulant potency, solving the problems of low yield and high cost in existing technologies, and opening up a large-scale, low-cost production path with great economic value and social benefits.
Smart Images

Figure CN122382136A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a mammalian cell that stably expresses hirudin fusion protein, its construction method, and its application. Background Technology
[0002] Hirudin, derived from the medicinal leech *Hirudo medicinalis*, is a specific thrombin inhibitor composed of 65-66 amino acids. It exerts a potent anticoagulant effect by forming a highly stable complex with thrombin in a 1:1 ratio, blocking the active site of thrombin. Numerous studies have shown that hirudin's anticoagulant potency is far superior to heparin and is independent of antithrombin III. It has demonstrated significant clinical value in preventing deep vein thrombosis, treating unstable angina, and disseminated intravascular coagulation (DIC), and is considered one of the most promising new anticoagulant drugs.
[0003] Currently, the production of commercial hirudin mainly relies on the following technological pathways: First, natural extraction, which involves direct collection and extraction from the salivary glands of live leeches. This method not only has extremely limited yields and high costs, but also carries the risk of contamination by animal-derived pathogens, severely restricting its large-scale clinical application. Second, recombinant microbial expression systems, including fermentation production using engineered bacteria such as Escherichia coli and yeast. Although this method increases yield to some extent, the prokaryotic system lacks the post-translational modification mechanisms specific to eukaryotic cells, resulting in expression products often existing in inclusion body form with low activity. While eukaryotic microbial systems such as yeast possess certain modification capabilities, their glycosylation patterns differ significantly from those of mammals, potentially leading to increased immunogenicity and shortened half-life of the product.
[0004] In view of this, it is necessary to provide a mammalian cell that stably expresses hirudin fusion protein to overcome the shortcomings of the prior art. Summary of the Invention
[0005] The purpose of this invention is to provide a mammalian cell that stably expresses hirudin fusion protein, its construction method, and its applications. This addresses the problems of low yield, low activity, and high cost associated with hirudin prepared using existing conventional commercial methods.
[0006] In a first aspect, the present invention provides a method for constructing mammalian cells stably expressing hirudin fusion protein, comprising the following steps: synthesizing a hirudin-3×FLAG tag fusion gene; amplifying the hirudin-3×FLAG tag fusion gene by PCR and inserting it into the multiple cloning site of an expression vector to obtain a recombinant expression vector; transfecting the recombinant expression vector into mammalian cells to obtain mammalian cells stably expressing hirudin fusion protein; wherein the nucleotide sequence of the hirudin-3×FLAG tag fusion gene is shown in SEQ ID NO.1.
[0007] In this invention, the inventors discovered that fusing hirudin with a 3×FLAG tag, inserting it into an expression vector, and then transferring it into mammalian cells can achieve efficient and stable expression of hirudin fusion protein. Furthermore, the hirudin fusion protein stably expressed in these mammalian cells exhibits high anticoagulant potency. This mammalian cell method opens up a new technological pathway for the large-scale, low-cost production of hirudin fusion protein, solving the industrial bottlenecks of low product activity and high costs associated with existing microbial expression systems and natural extraction methods. It has significant economic and social value in the development of antithrombotic drugs. In addition, the method for constructing mammalian cells that stably express hirudin fusion protein provided by this invention is simple, uses inexpensive and readily available raw materials, and is suitable for large-scale production and application of hirudin fusion protein.
[0008] In some implementations, in the step of inserting the hirudin-3×FLAG tag fusion gene into the multiple cloning site of the expression vector after PCR amplification, the nucleotide sequences of the primer pairs used for PCR amplification are shown in SEQ ID NO.2-3.
[0009] In some implementations, the expression vector includes the pcDNA3.1-Kozak vector, which is used in the step of inserting the hirudin-3×FLAG tag fusion gene into the multiple cloning site of the expression vector after PCR amplification.
[0010] In some implementations, the insertion method in the step of inserting the hirudin-3×FLAG tag fusion gene into the multiple cloning site of the expression vector after PCR amplification includes a seamless cloning method.
[0011] In some implementations, the step of transfecting the recombinant expression vector into mammalian cells specifically includes: transfection using the Lipo8000 transfection reagent; the mammalian cells include HEK293T cells.
[0012] In a second aspect, the present invention provides a mammalian cell stably expressing a hirudin fusion protein, which is constructed by any of the above-described construction methods.
[0013] In a third aspect, the present invention provides the use of mammalian cells as described above in the preparation of hirudin fusion proteins.
[0014] In a fourth aspect, the present invention provides a method for preparing a hirudin fusion protein, comprising the following steps: culturing the above-mentioned mammalian cells and expressing the hirudin fusion protein to obtain a culture; and isolating the hirudin fusion protein from the culture.
[0015] In a fifth aspect, the present invention provides a hirudin fusion protein prepared by the above-described preparation method.
[0016] In some implementations, the anticoagulant titer of the hirudin fusion protein is 45-55 ATU / ml.
[0017] The beneficial effects of this invention are as follows: Unlike existing technologies, this invention achieves efficient and stable expression of hirudin fusion protein by fusing hirudin with a 3×FLAG tag, inserting it into an expression vector, and then transforming it into mammalian cells. Furthermore, the hirudin fusion protein stably expressed in these mammalian cells exhibits high anticoagulant potency. Simultaneously, these mammalian cells provide a novel technological pathway for the large-scale, low-cost production of hirudin fusion protein, overcoming the industrial bottlenecks of low product activity and high costs associated with existing microbial expression systems and natural extraction methods. This has significant economic and social value in the development of antithrombotic drugs. In addition, the method for constructing mammalian cells that stably express hirudin fusion protein provided by this invention is simple, and the raw materials used are inexpensive and readily available, making it suitable for large-scale production and application of hirudin fusion protein. Attached Figure Description
[0018] Figure 1 This is a flowchart of the method for constructing mammalian cells that stably express hirudin fusion protein in this invention; Figure 2 This is a map of the recombinant expression plasmid pcDNA3.1-HN-3FLAG in Example 1 of this invention; Figure 3 The results of double enzyme digestion identification of the recombinant expression plasmid pcDNA3.1-HN-3FLAG in Example 1 of this invention; Figure 4 The images show the fluorescence microscopy evaluation results of the transient transfection efficiency of HEK293T cells in Example 2 of this invention, where the left image is the bright field and the right image is the fluorescence field. Figure 5 The results of RT-qPCR detection of hirudin transcription level in hirudin fusion protein in Example 3 of this invention; Figure 6 The results of Western blot identification of the hirudin fusion protein in Example 4 of this invention; Figure 7The results of ELISA determination of hirudin fusion protein in culture supernatant in Example 5 of the present invention are shown. (A) is the standard curve of hirudin ELISA kit; (B) is the result of hirudin fusion protein titer analysis in culture supernatant sample. Figure 8 The results of determining the anticoagulant potency of hirudin fusion protein using the chromogenic substrate method in Example 6 of the present invention are shown. (A) is the hirudin standard curve; (B) is the analysis result of the anticoagulant potency of hirudin fusion protein in the culture supernatant sample. Detailed Implementation
[0019] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0020] Experimental methods not specifically described in the examples are generally performed according to conventional experimental methods in the field of molecular biology, including but not limited to those described in *Molecular Cloning: A Laboratory Manual* by M.R. Green and *Molecular Biology* by Robert F. Weaver, or according to the experimental methods recommended by the reagent kit and instrument manufacturers. Unless otherwise specified, all reagents and biological materials used in the examples are commercially available.
[0021] Currently, conventional commercial methods for preparing hirudin suffer from problems such as low yield, low activity, and high cost.
[0022] To address the problems of low yield, low activity, and high cost associated with the preparation of hirudin using existing conventional commercial methods, this invention provides a mammalian cell that stably expresses a hirudin fusion protein, its construction method, and its applications.
[0023] In a first aspect, the present invention provides a method for constructing mammalian cells stably expressing hirudin fusion protein, comprising the following steps: synthesizing a hirudin-3×FLAG tag fusion gene; amplifying the hirudin-3×FLAG tag fusion gene by PCR and inserting it into the multiple cloning site of an expression vector to obtain a recombinant expression vector; transfecting the recombinant expression vector into mammalian cells to obtain mammalian cells stably expressing hirudin fusion protein; wherein the nucleotide sequence of the hirudin-3×FLAG tag fusion gene is shown in SEQ ID NO.1.
[0024] The method for constructing mammalian cells stably expressing hirudin fusion protein provided by this invention involves fusing hirudin with a 3×FLAG tag, inserting it into an expression vector, and then transforming it into mammalian cells, which enables efficient and stable expression of the hirudin fusion protein. Furthermore, the hirudin fusion protein stably expressed by these mammalian cells exhibits high anticoagulant potency. This method also opens up a new technological path for the large-scale, low-cost production of hirudin fusion protein, solving the industrial bottlenecks of low product activity and high costs associated with existing microbial expression systems and natural extraction methods. It has significant economic and social value in the field of antithrombotic drug development. In addition, the method for constructing mammalian cells stably expressing hirudin fusion protein provided by this invention is simple, uses inexpensive and readily available raw materials, and is suitable for large-scale production and application of hirudin fusion protein.
[0025] In some implementations, in the step of inserting the hirudin-3×FLAG tag fusion gene into the multiple cloning site of the expression vector after PCR amplification, the nucleotide sequences of the primer pairs used for PCR amplification are shown in SEQ ID NO.2-3.
[0026] It is understood that PCR amplification is a conventional technique in the existing technology. Those skilled in the art can select a suitable PCR amplification system and procedure based on the gene to be amplified to achieve efficient amplification. Furthermore, the primer pairs used for PCR amplification can be designed using conventional primer design software based on the sequence of the gene to be amplified, as long as efficient amplification of the gene can be achieved. For example, in this invention, the preferred nucleotide sequences of the primer pairs used for PCR amplification are as shown in SEQ ID NO. 2-3.
[0027] In some implementations, the expression vector includes the pcDNA3.1-Kozak vector, which is used in the step of inserting the hirudin-3×FLAG tag fusion gene into the multiple cloning site of the expression vector after PCR amplification.
[0028] It is understood that the expression vector can be any conventional expression vector in the existing technology, as long as it can efficiently express the target gene in mammalian cells, depending on the actual needs of use. For example, in this invention, the expression vector preferably includes the pcDNA3.1-Kozak vector.
[0029] In some implementations, the insertion method in the step of inserting the hirudin-3×FLAG tag fusion gene into the multiple cloning site of the expression vector after PCR amplification includes a seamless cloning method.
[0030] It is understandable that the insertion method can be chosen from conventional insertion methods in the existing technology, depending on the actual needs of use, as long as it enables the target gene to be efficiently inserted into the expression vector. For example, in this invention, the insertion method preferably includes a seamless cloning method.
[0031] In some implementations, the step of transfecting the recombinant expression vector into mammalian cells specifically includes: transfection using the Lipo8000 transfection reagent; the mammalian cells include HEK293T cells.
[0032] It is understood that the transfection reagent in the transfection step can be any conventional transfection reagent in the prior art, as long as it can efficiently transfer the expression vector into mammalian cells, depending on the actual needs of use. For example, in this invention, transfection specifically includes: preferably using Lipo8000 transfection reagent for transfection. Furthermore, the mammalian cells can be any conventional mammalian cells in the prior art, as long as they can efficiently express the target gene, depending on the actual needs of use. For example, in this invention, the mammalian cells preferably include HEK293T cells.
[0033] In a second aspect, the present invention provides a mammalian cell stably expressing a hirudin fusion protein, which is constructed by any of the above-described construction methods.
[0034] The mammalian cells provided by this invention can efficiently and stably express hirudin fusion protein, and the hirudin fusion protein stably expressed by these mammalian cells has a high anticoagulant potency. At the same time, these mammalian cells open up a new technical path for the large-scale, low-cost production of hirudin fusion protein, solving the industrial bottlenecks of low product activity and high cost of natural extraction methods in existing microbial expression systems. This invention has great economic value and social benefits in the field of antithrombotic drug development.
[0035] In a third aspect, the present invention provides the use of mammalian cells as described above in the preparation of hirudin fusion proteins.
[0036] In this invention, a hirudin fusion protein with high anticoagulant potency can be efficiently and stably produced using mammalian cells, which has good application prospects in the field of antithrombotic drug development.
[0037] In a fourth aspect, the present invention provides a method for preparing a hirudin fusion protein, comprising the following steps: culturing the above-mentioned mammalian cells and expressing the hirudin fusion protein to obtain a culture; and isolating the hirudin fusion protein from the culture.
[0038] In this invention, there are no special requirements for the culture method and culture conditions; it is sufficient to ensure the normal growth of mammalian cells. Furthermore, the methods for isolating the aforementioned hirudin fusion protein from the culture are all conventional methods in the art.
[0039] In some embodiments, the culture medium used in the preparation of the hirudin fusion protein is a culture medium in the art that allows mammalian cells to grow normally, preferably a high-glucose DMEM medium containing 10% fetal bovine serum (FBS).
[0040] In a fifth aspect, the present invention provides a hirudin fusion protein prepared by the above-described preparation method.
[0041] The hirudin fusion protein provided by this invention has a high anticoagulant potency, and therefore has good application prospects.
[0042] In some implementations, the anticoagulant titer of the hirudin fusion protein is 45-55 ATU / ml, for example, 45 ATU / ml, 47 ATU / ml, 50 ATU / ml, 53 ATU / ml, 55 ATU / ml, or other values within this range.
[0043] The following are some specific embodiments. It should be noted that the embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.
[0044] Please see Figure 1 This is a flowchart illustrating the method for constructing mammalian cells stably expressing hirudin fusion protein according to the present invention. Specifically, the method for constructing mammalian cells stably expressing hirudin fusion protein includes the following steps: synthesizing a hirudin-3×FLAG tag fusion gene; amplifying the hirudin-3×FLAG tag fusion gene by PCR and inserting it into the multiple cloning site of an expression vector to obtain a recombinant expression vector; transfecting the recombinant expression vector into mammalian cells to obtain mammalian cells stably expressing hirudin fusion protein; wherein, the nucleotide sequence of the hirudin-3×FLAG tag fusion gene is shown in SEQ ID NO.1.
[0045] Example 1: Construction and identification of expression plasmid containing hirudin-3×FLAG tag fusion gene The hirudin coding sequence was obtained from GenBank accession number MK947218.1, and its full-length CDS region was selected as the target gene. A 3×FLAG tag was ligated to the C-terminus of hirudin to construct a hirudin-3×FLAG tag fusion gene (its nucleotide sequence is shown in SEQ ID NO.1), which was synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0046] The nucleotide sequence of the hirudin-3×FLAG tag fusion gene is as follows: ATGTTCTCTCTGAAGCTATTTCTTGTCCTCTTGGCTGTTTGCATCTGCGTGTCTCAAGCAAATCGTTACTCTGTCTGTACTGAAACTGGTCAAAACCTTTGCCTTTGCGAGGGAAGTGATCTTTGCTCTCTCGATAACCATTGCGAAATAGGCTCTAATGGAAAGAATAGA TGTGTCAAAGGAGAAGGAAAACCAAAGAAGCCTCAAAGCAATTCTGACTTGCCTGAGGAGAAGTATGAACCAATCCCAATTGAAGACTACGATAAAgactacaaggacgacgacgacaaggactacaaggacgacgacgacaaggactacaaggacgacgacgacaag(SEQ ID NO.1).
[0047] Primers were designed based on the synthesized hirudin-3×FLAG tag fusion gene (HN-3FLAG) and pcDNA3.1-Kozak vector sequence (see Table 1 below). The pcDNA3.1-Kozak vector was linearized using a circular amplification method, and then the hirudin-3×FLAG tag fusion gene was directionally inserted into the multiple cloning site of the pcDNA3.1-Kozak vector using seamless cloning technology to construct the recombinant expression plasmid pcDNA3.1-HN-3FLAG (its map is shown below). Figure 2 (As shown).
[0048] Table 1 Primer sequence listing
[0049] Next, the recombinant plasmid was transformed into *E. coli* DH5α competent cells. Positive clones were obtained after selection using appropriate antibiotic plates, and the plasmid was extracted. Double enzyme digestion and Sanger sequencing were used to verify the size and sequence correctness of the inserted fragment. Specifically, double enzyme digestion analysis using restriction endonucleases BgIII and EcoNI showed two main bands of approximately 993 bp and 4649 bp on electrophoresis, consistent with the theoretical fragment size (e.g., ...). Figure 3 (As shown). Further Sanger sequencing was performed on the full-length insert and the connecting regions at both ends, and the sequencing results were consistent with the designed sequence. These results indicate that the pcDNA3.1-HN-3FLAG vector was successfully constructed and can be used for subsequent expression and functional evaluation.
[0050] Example 2: HEK293T cell culture, transfection, and sample collection HEK293T cells were cultured and passaged in high-glucose DMEM medium containing 10% fetal bovine serum (FBS) at 37°C and 5% CO2 using standard methods. One day prior to transfection, HEK293T cells were seeded into 6-well cell culture plates to achieve 60%-70% confluence at transfection. Plasmid transfection was performed using Lipo8000 transfection reagent, with an EGFP reporter plasmid used as a technical control to verify transfection efficiency and the procedure.
[0051] The experimental groups included a recombinant expression plasmid transfection group (pcDNA3.1-HN-3FLAG), an empty vector transfection group (pcDNA3.1-Kozak), and an untransfected control group (WT). HEK293T cells were observed under fluorescence microscopy 24 hours post-transfection, and the results are as follows: Figure 4 As shown.
[0052] from Figure 4 As can be seen, the technical control group showed clear and widely distributed green fluorescent positive cells in the field of view, indicating a high cell transfection efficiency; the untransfected control group showed no specific green fluorescent signal, and only appeared as background under the microscope.
[0053] Finally, cells and culture supernatant were collected 36 hours after transfection. Cell samples were used for transcriptional level detection and protein expression identification, while supernatant samples were used for evaluating secretion titer and anticoagulant activity.
[0054] Example 3: RT-qPCR detection of hirudin transcription level in hirudin fusion protein Total RNA was extracted from cells in Example 2 using the TRIzol method, and the RNA was reverse transcribed into cDNA according to the reverse transcription kit instructions. RT-qPCR was performed using the SYBR system. The reaction mixture consisted of: 10 μL SYBR Green qPCR Mix, 1 μL each of forward and reverse primers (sequences shown in Table 2 below), 1 μL cDNA template, and ddH2O to a final volume of 20 μL. The amplification program was: 95℃ pre-denaturation for 30 s; followed by 40 cycles: 95℃ denaturation for 5 s, 60℃ annealing / extension for 30 s. Melting curves were constructed after amplification. β-Actin was used as an internal control gene, and 2... ΔΔCt The method calculates the relative expression level, and the results are as follows: Figure 5 As shown.
[0055] Table 2 Primer sequence listing
[0056] from Figure 5As can be seen, compared with the untransfected group, the relative expression level of hirudin gene in the pcDNA3.1-HN-3FLAG transfection group was significantly increased, approximately 5 × 10⁻⁶. 4 The number of transfected genes was twice that of transfected genes; conversely, the empty vector group and the untransfected group showed almost no transcription of the gene.
[0057] Example 4: Western blot identification of hirudin fusion protein expression Cell samples from each group in Example 2 were collected, and total protein was extracted using RIPA lysis buffer. Protein concentration was determined using the BCA method. 20 μg of sample was loaded onto each well for 15% SDS-PAGE electrophoresis at 80V for 30 min, followed by 120V for 60 min. Protein was then transferred to a PVDF membrane at 200 mA for 1 h. The membrane was blocked with 5% skim milk powder at room temperature for 2 h, incubated overnight with primary antibody at 4°C, and then incubated with secondary antibody at room temperature for 1 h. ECL chemiluminescence substrate was used for color development, with GAPDH as an internal control. The results are as follows: Figure 6 As shown.
[0058] from Figure 6 As can be seen, the pcDNA3.1-HN-3FLAG transfection group showed a major positive band of approximately 13 kDa, while no corresponding signal was observed in the empty vector group and the untransfected group.
[0059] Example 5: ELISA detection of hirudin fusion protein content in culture supernatant Cell culture supernatants from each group in Example 2 were collected, and hirudin ELISA kits were used to detect hirudin fusion protein. After pre-coated plates were equilibrated at room temperature, standard wells, sample wells, and blank wells were set up: 50 μL of different concentrations of standards (0, 25, 50, 100, 200, 400 U / ml) were added to the standard wells; 10 μL of supernatant and 40 μL of diluent were added to the sample wells; and the corresponding volume of diluent was added to the blank wells, without adding any sample. 100 μL of HRP-labeled detection antibody was added to each well, and the plate was incubated at 37°C for 60 min, followed by 5 washes. 50 μL each of substrate A and B were added to each well, and the reaction was carried out at 37°C in the dark for 15 min. 50 μL of stop solution was added to terminate the reaction, and the OD value was measured at 450 nm within 15 min. The standard concentration was used as the OD value. 450 A standard curve was plotted and interpolated to calculate the activity of the hirudin fusion protein in the sample; the result was multiplied by the dilution factor (1:5) to convert it into the actual potency of the sample. Since the standards in this kit are calibrated in activity units, U / mL represents the functional potency based on the kit-calibrated system. The measurement results are as follows: Figure 7 As shown.
[0060] from Figure 7 As can be seen from the data, a standard curve was established using the hirudin ELISA kit standards. Figure 7A), and fitted within the range of 0-400 U / ml, the results showed that the standard curve had good linear correlation, and its linear regression equation was OD. 450 =0.0055C+0.1587, correlation coefficient R 2 =0.9901; Based on this standard curve, quantitative conversion was performed on the culture supernatant sample ( Figure 7 (B) The titer of the hirudin fusion protein in the culture supernatant of the experimental group was calculated to be 148.3 U / mL, which was statistically significant compared with the WT group. These results indicate that the hirudin fusion protein can be expressed in HEK293T cells and secreted into the culture supernatant.
[0061] Example 6: Determination of the anticoagulant potency of hirudin fusion protein using a chromogenic substrate method The anticoagulant activity of the hirudin fusion protein was determined using the Chromozym TH chromogenic substrate method, and the anticoagulant titer was calculated using a standard curve. Thrombin standard was prepared as a 10 IU / ml working solution; hirudin standard was prepared in a series of solutions at 0, 10, 15, 20, 30, 50, and 70 ATU / ml. In a 96-well microplate, 25 μL of the standard solution was added to each well, followed by 25 μL of thrombin solution, and incubated at 37°C for 5 min. Then, 25 μL of 2 mmol / L Chromozym TH substrate solution was added, and the reaction was incubated at 37°C for 2 min. Finally, 125 μL of acetic acid was added to terminate the reaction. After termination, the absorbance was measured at 405 nm. Thrombin-free blank wells were used for background correction, and all readings were subtracted from the blank using the following formula: OD corr =OD 405 -OD Blank The activity of hirudin standard (ATU / ml) was plotted on the x-axis, and OD... corr Establish a standard curve for the ordinate and use it to measure the OD of the sample. corr The anticoagulant titer of the hirudin fusion protein in the sample was calculated by reverse calculation, and the result is expressed as ATU / mL. Specific test results are as follows: Figure 8 As shown.
[0062] from Figure 8 As can be seen from this, within the fitting interval, OD corr It showed a linear negative correlation with the anticoagulant potency of hirudin, and the linear regression equation was OD. corr = 0.0116×C+1.056 (C: ATU / ml), R²=0.9946 ( Figure 8 A); Sample OD 405 It is 0.557, corresponding to OD corr The value was 0.503, which converted to an anticoagulant titer of leech fusion protein of 47.85±2.54 ATU / ml (mean±SD, n=9); Figure 8B).
[0063] In summary, this invention achieves efficient and stable expression of hirudin fusion protein by fusing hirudin with a 3×FLAG tag, inserting it into an expression vector, and then transforming it into mammalian cells. Furthermore, the hirudin fusion protein stably expressed in these mammalian cells exhibits high anticoagulant potency. This mammalian cell method opens up a novel technological pathway for the large-scale, low-cost production of hirudin fusion protein, overcoming the industrial bottlenecks of low product activity and high costs associated with existing microbial expression systems and natural extraction methods. It possesses significant economic and social value in the field of antithrombotic drug development.
[0064] It should be noted that all the above embodiments belong to the same inventive concept, and the descriptions of each embodiment have different focuses. Where the description in a particular embodiment is not detailed, please refer to the description in other embodiments.
[0065] The embodiments described above are merely illustrative of implementation methods of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A method for constructing mammalian cells stably expressing hirudin fusion protein, characterized in that, Includes the following steps: Synthetic hirudin-3×FLAG tag fusion gene; The hirudin-3×FLAG tag fusion gene was amplified by PCR and then inserted into the multiple cloning site of the expression vector to obtain the recombinant expression vector; The recombinant expression vector was transfected into mammalian cells to obtain mammalian cells that stably express the hirudin fusion protein; The nucleotide sequence of the hirudin-3×FLAG tag fusion gene is shown in SEQ ID NO.
1.
2. The construction method according to claim 1, characterized in that, In the step of inserting the hirudin-3×FLAG tag fusion gene into the multiple cloning site of the expression vector after PCR amplification, the nucleotide sequences of the primer pairs used for PCR amplification are shown in SEQ ID NO.2-3.
3. The construction method according to claim 1, characterized in that, In the step of inserting the hirudin-3×FLAG tag fusion gene into the multiple cloning site of the expression vector after PCR amplification, the expression vector includes the pcDNA3.1-Kozak vector.
4. The construction method according to claim 1, characterized in that, In the step of inserting the hirudin-3×FLAG tag fusion gene into the multiple cloning site of the expression vector after PCR amplification, the insertion method includes a seamless cloning method.
5. The construction method according to claim 1, characterized in that, In the step of transfecting the recombinant expression vector into mammalian cells, the transfection specifically includes: transfection using Lipo8000 transfection reagent; the mammalian cells include HEK293T cells.
6. A mammalian cell stably expressing a hirudin fusion protein, characterized in that, It is constructed by the construction method of any one of claims 1-5.
7. The use of mammalian cells as described in claim 6 in the preparation of hirudin fusion protein.
8. A method for preparing a hirudin fusion protein, characterized in that, Includes the following steps: The mammalian cells of claim 7 are cultured and the hirudin fusion protein is expressed to obtain a culture. The hirudin fusion protein was isolated from the culture.
9. A hirudin fusion protein, characterized in that, It is prepared by the preparation method described in claim 8.
10. The hirudin fusion protein according to claim 9, characterized in that, The anticoagulant titer of the hirudin fusion protein is 45-55 ATU / ml.