Breast cancer metastasis dual recognition biosensor and construction method and application thereof

Abstract

The application discloses a breast cancer metastasis double-identification biosensor and a construction method and application thereof, and relates to the technical field of biological detection. The breast cancer metastasis double-identification biosensor comprises a molecular identification system and a sensing substrate MCH / SH-HP / AuPd@CoMOF-E; the molecular identification system comprises an msRP-HP1 / TDN composite probe, an HP2 probe and an SP-Thi signal probe. The biosensor provided by the application has the advantages of high accuracy, good selectivity and high sensitivity, can realize quantitative detection of miRNA 21 and miRNA 105 in clinical blood samples and various cell samples, and has important application value in the fields of early diagnosis of breast cancer and cancer metastasis evaluation.

Description

Technical Field

[0001] This invention relates to the field of biodetection technology, and in particular to a dual-identification biosensor for breast cancer metastasis, its construction method, and its application. Background Technology

[0002] Breast cancer is a highly prevalent malignant tumor. Approximately 90% of breast cancer deaths are not caused by the primary tumor but by tumor recurrence and metastasis. Metastatic malignant tumors are often only detected at advanced stages, making clinical diagnosis and treatment extremely challenging. Therefore, developing innovative detection technologies is of significant clinical importance for the early diagnosis of breast cancer metastasis.

[0003] Studies have shown that abnormal expression of microRNAs (miRNAs) is closely related to cancer occurrence, development, invasion, metastasis, and treatment response. miRNA 21 is a typical oncogenic miRNA, and its expression is upregulated in the early stages of breast cancer. miRNA 105 disrupts the vascular endothelial barrier in metastatic breast cancer cells by targeting the tight junction protein ZO-1, promoting tumor cell migration. Its elevated levels in circulation can be detected before metastasis, making it an important metastasis marker and therapeutic target. Current detection methods typically detect only a single miRNA, which is prone to false positives and false negatives. Simultaneous detection of miRNA 21 and miRNA 105 can significantly improve the specificity and accuracy of early breast cancer diagnosis, and also has prognostic value for metastasis risk assessment.

[0004] DNA walkers are dynamic DNA nanomachines that can move continuously along a preset track. Their mechanical motion enables signal accumulation and output, showing promising applications in molecular transport and biosensing. However, traditional DNA walkers suffer from low effective collision efficiency and limited reaction kinetics due to the random distribution of probes and tracks. Previous studies have shown that local enrichment of DNA probes can significantly improve amplification reaction efficiency. DNA nanostructures can confine reactants to a smaller space, increasing local reagent concentration, generating a spatial confinement effect, enabling controllable dynamic operation, and improving the signal-to-noise ratio. Our research team previously utilized the high mechanical rigidity and abundant modification sites of framework nucleic acids to construct a site-controllable DNA walker assisted by tetrahedral DNA nanostructures, providing a new approach for the detection of highly sensitive biomarkers. However, three-dimensional DNA frameworks suffer from high preparation costs and complex assembly, limiting their widespread application in bioanalysis. There is an urgent need to develop simple and efficient two-dimensional polygonal nucleic acid framework reaction systems. Summary of the Invention

[0005] The purpose of this invention is to provide a dual-identification biosensor for breast cancer metastasis, its construction method, and its applications, thereby addressing the problems existing in the prior art. The biosensor provided by this invention has advantages such as high accuracy, good selectivity, and high sensitivity, enabling the quantitative detection of miRNA 21 and miRNA 105 in clinical blood samples and various cell samples. It has significant application value in predicting early diagnosis of breast cancer and assessing cancer metastasis.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a dual-recognition biosensor for breast cancer metastasis, comprising a molecular recognition system and a sensing substrate MCH / SH-HP / AuPd@CoMOF-E; The molecular recognition system includes an msRP-HP1 / TDN composite probe, an HP2 probe, and an SP-Thi signal probe; The msRP-HP1 / TDN composite probe is obtained by self-assembling the msRP probe and HP1 strand into a triangular DNA framework TDN. The msRP probe is obtained by annealing and hybridizing the Y1, Y2 and Y3 chains; The nucleotide sequences of the Y1 chain, the Y2 chain, and the Y3 chain are shown in SEQ ID NO. 1-3, respectively; The nucleotide sequence of the HP1 chain is shown in SEQ ID NO.6; The triangular DNA framework TDN is obtained by annealing and hybridizing the TS1 and TS2 strands. The nucleotide sequences of the TS1 chain and the TS2 chain are shown in SEQ ID NO.4-5, respectively; The nucleotide sequence of the HP2 probe is shown in SEQ ID NO.9; The SP-Thi signal probe is obtained by mixing and reacting SP probe, gold nanoparticles, and thionine. The nucleotide sequence of the SP probe is shown in SEQ ID NO.8; The sensing substrate MCH / SH-HP / AuPd@CoMOF-E is obtained by coupling the SH-HP chain with the AuPd@CoMOF-E electrode; The nucleotide sequence of the SH-HP chain is shown in SEQ ID NO.7; The AuPd@CoMOF-E electrode is prepared by drop-coating a cobalt MOF composite material loaded with gold-palladium nanoparticles onto the surface of a glassy carbon electrode.

[0007] The present invention also provides a method for constructing the above-mentioned dual-recognition biosensor for breast cancer metastasis, comprising the following steps: The Y1, Y2, and Y3 chains are annealed and hybridized to obtain the msRP probe; the TS1 and TS2 chains are annealed and hybridized to obtain the triangular DNA framework TDN; the msRP probe and HP1 chain are self-assembled into the triangular DNA framework TDN to obtain the msRP-HP1 / TDN composite probe; The SP-Thi signal probe is obtained by mixing and reacting the activated SP probe, the gold nanoparticles, and the thionine. The AuPd@CoMOF-E electrode was prepared by drop-coating the cobalt MOF composite material loaded with gold-palladium nanoparticles onto the surface of a glassy carbon electrode; the sensing substrate MCH / SH-HP / AuPd@CoMOF-E was obtained by coupling the SH-HP chain with the AuPd@CoMOF-E electrode.

[0008] Furthermore, the SP probe was activated using tris(2-carboxyethyl)phosphonic acid hydrochloride.

[0009] Furthermore, the preparation method of the cobalt MOF composite material loaded with gold palladium nanoparticles includes: using cobalt chloride, polyvinylpyrrolidone, and 2,5-dihydroxyterephthalic acid as raw materials, a cobalt MOF material is synthesized by a solvothermal method; using the cobalt MOF material as a substrate, gold palladium nanoparticles are grown in situ on the surface of the substrate by a reduction method to obtain the cobalt MOF composite material loaded with gold palladium nanoparticles.

[0010] Furthermore, the particle size of the gold nanoparticles is 15~20 nm.

[0011] Furthermore, the method for coupling the SH-HP chain with the AuPd@CoMOF-E electrode includes: activating the SH-HP chain with tris(2-carboxyethyl)phosphine hydrochloride, then adding it dropwise onto the AuPd@CoMOF-E electrode, reacting in the dark, and then blocking the inactive sites with mercaptohexanol.

[0012] The present invention also provides the application of the above-described dual-recognition biosensor for breast cancer metastasis in the preparation of detection products for miRNA 21 and / or miRNA 105.

[0013] Furthermore, the testing product is a reagent kit.

[0014] The present invention also provides a detection product for miRNA 21 and / or miRNA 105, including the above-mentioned dual-recognition biosensor for breast cancer metastasis.

[0015] Furthermore, the testing product is a reagent kit.

[0016] The present invention discloses the following technical effects: This invention utilizes a polygonal nucleic acid framework-mediated accelerated nanomachine to fabricate a dual-recognition biosensor for breast cancer metastasis, enabling clinical detection of miRNA 21 and miRNA 105 in clinical blood samples and various cell samples. This invention improves the specificity of the biosensor through the specific recognition of dual-site recognition probes; the construction of DNA nanomachines based on the polygonal nucleic acid framework allows for the recycling of target substances, improving reaction efficiency and enhancing the accuracy and feasibility of the biosensor. When detecting complex biological samples, the biosensor of this invention effectively resists interference from interfering substances, obtaining a sufficiently amplified signal and improving detection sensitivity and specificity.

[0017] The biosensor provided by this invention has advantages such as high accuracy, good selectivity and high sensitivity. It can realize the quantitative detection of miRNA 21 and miRNA 105 in clinical blood samples and various cell samples, and has important application value in predicting early diagnosis of breast cancer and assessing cancer metastasis. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is a schematic diagram illustrating the detection principle of the biosensor of the present invention; wherein, Figure 1 (A) shows the preparation process of AuPd@CoMOF; Figure 1 (B) illustrates the principle for accelerating the startup of nanomachines; Figure 1 (C) is a schematic diagram of signal generation on the surface of the sensing electrode; Figure 2 The image shows the characterization of the nanomaterials in Example 1; where, Figure 2 In the middle (A), the SEM characterization image of CoMOF is shown, with a scale bar of 5 μm; Figure 2 (B) is a SEM image of AuPd@CoMOF with a scale bar of 2 μm; Figure 2 In the middle (C), the image is a SEM image of AuPd@CoMOF with a scale bar of 0.5 μm; Figure 2 The diagram in D shows the elemental distribution of O. Figure 2 The middle (E) diagram shows the elemental distribution of Co, with a scale bar of 0.5 μm. Figure 2 The graph in (F) shows the elemental distribution of C, with a scale bar of 0.5 μm. Figure 2 In the middle (G), there is an overlay diagram of the elemental distributions of O, Co, and C, with a scale bar of 0.5 μm; Figure 2In the middle (H), the XRD characterization diagram of AuPd@CoMOF is shown. The numbers in parentheses above the peaks are Miller indices (crystal plane indices), which are standard symbols used in crystallography to mark different atomic crystal planes inside a crystal. Figure 2 (I) is the EDS characterization diagram of AuPd@CoMOF; Figure 3 This is a feasibility characterization diagram of the biosensor in Example 1; wherein, Figure 3 (A) is a polyacrylamide gel electrophoresis characterization diagram. Lane 1: TS1, Lane 2: TS1+TS2, Lane 3: TDN+msRP, Lane 4: TDN+msRP+HP1. Figure 3 (B) shows the current response curves for different probes. Curve a: MCH / SH-HP / AuPd@CoMOF-E+msRP-HP1 / TDN+HP2+SP-Thi, Curve b: MCH / SH-HP / AuPd@CoMOF-E+msRP-HP1 / TDN+HP2+SP-Thi+miRNA 21, Curve c: MCH / SH-HP / AuPd@CoMOF-E+msRP-HP1 / TDN+HP2+SP-Thi+miRNA 105, Curve d: MCH / SH-HP / AuPd@CoMOF-E+msRP-HP1 / TDN+HP2+SP-Thi+miRNA 21+miRNA 105; Figure 4 This is a graph showing the detection results of the biosensor for target samples of different concentrations in Example 1; where, Figure 4 In the middle (A), the square wave voltammetry (SWV) response curves of miRNA 21 samples at different concentrations are shown; curves a~i represent miRNA 21 samples at 0 aM, 20 aM, 200 aM, 2 fM, 20 fM, 500 fM, 5 pM, 50 pM and 500 pM respectively. Figure 4 (B) is a graph showing the linear relationship between the SWV peak current signal value and the logarithm of the miRNA 21 concentration; Figure 4 The middle (C) shows the SWV response curves of miRNA 105 samples at different concentrations; curves a~i represent miRNA 105 samples at 0 aM, 20 aM, 200 aM, 2 fM, 20 fM, 500 fM, 5 pM, 50 pM and 500 pM respectively. Figure 4 (D) is a graph showing the linear relationship between the SWV peak current signal value and the logarithm of the miRNA 105 concentration; Figure 5 This is a diagram showing the detection and analysis of different cancer cells by the biosensor in Example 1; wherein, Figure 5 (A) shows the electrical response of miRNA 21 in different cancer cells; Figure 5 (B) shows the electrical response of miRNA 105 in different cancer cells; Figure 5 (C) is a schematic diagram of the biosensor distinguishing different cancer cells in Example 2; Figure 6 This is a graph showing the detection results of miRNA levels in clinical blood samples. Detailed Implementation

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0025] This invention constructs a highly efficient biosensor for detecting miRNA based on polygonal nucleic acid framework-mediated accelerated nanomachines. Its fabrication process and detection principle are illustrated in the schematic diagram. Figure 1 )as follows: First, AuPd@CoMOF nanocomposites were prepared and used as electrode modification materials. During synthesis, a divalent cobalt salt precursor and a 2,5-dihydroxyterephthalic acid organic ligand formed a CoMOF support through a coordination reaction. Using chloroauric acid and sodium chloropalladate as precursors, ascorbic acid as a reducing agent, and hexadecylpyridine chloride as a surfactant, AuPd nanoalloy particles were grown in situ, synergistically enhancing the conductivity and catalytic activity of the electrode interface. After modifying the AuPd@CoMOF composite material onto the surface of a glassy carbon electrode, the signal probe SH-HP could self-assemble onto the AuPd@CoMOF-E electrode via Au-S bonds. A triangular DNA nanostructure was used as a framework to confine the nucleic acid reaction elements msRP and HP1 within a narrow space, maintaining a high local probe concentration and achieving a spatial confinement effect. When the target miRNA 21 or miRNA 105 binds to the corresponding recognition site 1 or site 2, respectively, the Y-shaped structure of msRP unwinds, releasing the Y1 probe single strand. The free Y1 single strand can open the adjacent HP1 hairpin structure on the triangular DNA backbone, exposing a new sticky end. This end can further pair complementaryly with HP2, forming an HP1 / HP2 double-stranded structure on the DNA backbone, causing the Y1 strand to dissociate again, thus initiating the next round of HP1 activation and HP1 / HP2 double-strand formation, achieving cascade amplification. As the HP1 and HP2 ends approach each other, a complete synthetic DNA molecule (DNAzyme) structure with enzyme-like catalytic activity is formed, activating its catalytic cleavage activity. Subsequently, the triangular DNA nanobackbone carries two activated DNAzyme probes, efficiently catalyzing the SH-HP probe at the cleavage sensing interface. After SH-HP is cleaved, it produces two single-stranded fragments, of which the SH-HP fragment retained at the electrode interface... The fragment can hybridize complementaryly with the signal probe SP, enriching thionine (Thi) signal molecules on the electrode surface. Under the synergistic catalysis of AuPd@CoMOF, a significantly enhanced current response signal is generated. Based on the above mechanism, this invention constructs a spatially confined, accelerated, high-order signal amplification sensing system capable of highly sensitive detection of miRNA 21 and miRNA 105.

[0026] Example 1 This embodiment provides a dual-identification sensor for breast cancer metastasis based on accelerated nanomachines, and its construction method is as follows: S1. Preparation of dual-site recognition probe msRP: The Y1, Y2 and Y3 chains were mixed in an equal molar ratio and reacted at 95 °C for 10 min. The mixture was then cooled to 25 °C at a rate of 1 °C / min to obtain the Y-type dual-site recognition probe msRP.

[0027] Y1 chain: 5'-CGTAGGTTACACGTTCAGACTGATTTTTCTCTATTCACGTCTATT-3' (SEQ IDNO.1); Y2 chain: 5'-TCAACATCAGTCTGACTCAGACTCCT-3' (SEQ ID NO. 2); Y3 chain: 5'-ACCACAGGAGTCTGAGACGTGTAACCTACG-3' (SEQ ID NO. 3).

[0028] S2. Preparation of triangular DNA framework TDN: The TS1 and TS2 strands were mixed in an equal molar ratio and reacted at 95°C for 10 min. The mixture was then cooled to 25°C at a rate of 1°C / min to obtain the triangular DNA framework TDN.

[0029] TS1 chain: 5'-AATAGACGTGAATAGAGTTTTCATGAGTCAGGGCGACGACATGAGTCAGGGCTTTTGATTCGATGCGTAGGGCGCTCTTCTATATTGTTTTACGAAGCATACGAATCTCACGAAGCATACGA-3' (SEQ IDNO.4); TS2 chain: 5'-GCCCTGACTCATGTCGTCGCCCTGACTCATG-3' (SEQ ID NO. 5).

[0030] Preparation of S3, msRP-HP1 / TDN composite probe: The msRP probe, triangular DNA framework TDN, and HP1 strand were mixed in a molar ratio of 1:1:2 and reacted at 25°C for 3 hours to obtain msRP-HP1 / TDN.

[0031] HP1 chain: 5'-TCGTATGCTTCGTGAGATTCGTATGCTTCGTTTTTGTCAACGCTCCGAGCGTTACACGTTCAGATGAGTGATGCTCTGAACGTGTAACCTACG-3' (SEQ ID NO. 6).

[0032] S4. Construction of the sensing substrate MCH / SH-HP / AuPd@CoMOF-E: First, cobalt chloride, polyvinylpyrrolidone (PVP, K30), and 2,5-dihydroxyterephthalic acid (DHTA) were dissolved in dimethylformamide and reacted at 120°C for 26 h. After the reaction system cooled naturally to room temperature, it was thoroughly washed and dried to obtain CoMOF material. Using the obtained CoMOF material as a substrate, sodium chloropalladate and chloroauric acid as metal precursors, hexadecylpyridine chloride (HDPC) as a surfactant, and ascorbic acid as a reducing agent, corresponding nanoalloys (gold-palladium nanoparticles) were grown in situ on the CoMOF substrate to obtain AuPd@CoMOF composite material. 1 mL of 10 mg AuPd@CoMOF composite material was dispersed in 1 mL of chitosan solution (0.1 wt%), uniformly drop-coated onto the surface of a glassy carbon electrode, and dried at 50°C to obtain AuPd@CoMOF-E electrode. Subsequently, 0.4 µM SH-HP chain was reacted with 1 mM tris(2-carboxyethyl)phosphine hydrochloride at room temperature for 1 h to open the disulfide bonds of SH-HP. After filtration and purification to remove tris(2-carboxyethyl)phosphine hydrochloride, an activated SH-HP probe was obtained. 10 μL of the activated SH-HP probe (0.4 µM concentration) was added dropwise to the surface of the AuPd@CoMOF-E electrode and reacted in the dark for 12 h to obtain the SH-HP chain-modified electrode. Finally, 10 μL of mercaptohexanol (MCH) was added dropwise to the SH-HP chain-modified electrode and reacted for 1 h to block inactive sites, resulting in MCH / SH-HP / AuPd@CoMOF-E.

[0033] SH-HP chain: 5'-SH-(CH2)6-TTTTGACAGTCTAGATCACACTCCATrAGCGTTGACTCTAGACTGTC-3' (SEQ ID NO. 7).

[0034] Preparation of S5 and SP-Thi signal probes: The SP probe was activated with tris(2-carboxyethyl)phosphine hydrochloride (using the same method as the SH-HP chain activation). The activated SP probe (concentration 0.4 µM) was then mixed with gold nanoparticles (20 nm; final concentration in the reaction system was 1 g / L) and thionine (final concentration in the reaction system) and stirred for 2 h. After centrifugation at 13000 rpm for 15 min, the supernatant was removed to obtain the signal probe SP-Thi.

[0035] SP probe: 5'-TGATCTAGACTGTC-SH-(CH2)6-3' (SEQ ID NO.8).

[0036] Example 2 This embodiment provides a dual-identification sensor for breast cancer metastasis based on accelerated nanomachines, and its construction method is as follows: S1. Preparation of dual-site recognition probe msRP: The Y1, Y2 and Y3 chains were mixed in an equal molar ratio and reacted at 90℃ for 12 min. The mixture was then cooled to 20℃ at a rate of 1℃ / min to obtain the Y-type dual-site recognition probe msRP.

[0037] Y1 chain: 5'-CGTAGGTTACACGTTCAGACTGATTTTTCTCTATTCACGTCTATT-3' (SEQ IDNO.1); Y2 chain: 5'-TCAACATCAGTCTGACTCAGACTCCT-3' (SEQ ID NO. 2); Y3 chain: 5'-ACCACAGGAGTCTGAGACGTGTAACCTACG-3' (SEQ ID NO. 3).

[0038] S2. Preparation of triangular DNA framework TDN: The TS1 and TS2 strands were mixed in an equal molar ratio and reacted at 90°C for 12 min. The mixture was then cooled to 20°C at a rate of 1°C / min to obtain the triangular DNA framework TDN.

[0039] TS1 chain: 5'-AATAGACGTGAATAGAGTTTTCATGAGTCAGGGCGACGACATGAGTCAGGGCTTTTGATTCGATGCGTAGGGCGCTCTTCTATATTGTTTTACGAAGCATACGAATCTCACGAAGCATACGA-3' (SEQ IDNO.4); TS2 chain: 5'-GCCCTGACTCATGTCGTCGCCCTGACTCATG-3' (SEQ ID NO. 5).

[0040] Preparation of S3, msRP-HP1 / TDN composite probe: The msRP probe, triangular DNA framework TDN, and HP1 strand were mixed in a molar ratio of 1:1:2 and reacted at 25°C for 2 hours to obtain msRP-HP1 / TDN.

[0041] HP1 chain: 5'-TCGTATGCTTCGTGAGATTCGTATGCTTCGTTTTTGTCAACGCTCCGAGCGTTACACGTTCAGATGAGTGATGCTCTGAACGTGTAACCTACG-3' (SEQ ID NO. 6).

[0042] S4. Construction of the sensing substrate MCH / SH-HP / AuPd@CoMOF-E: First, cobalt chloride, polyvinylpyrrolidone (PVP, K30), and 2,5-dihydroxyterephthalic acid (DHTA) were dissolved in dimethylformamide and reacted at 120°C for 26 h. After the reaction system cooled naturally to room temperature, it was thoroughly washed and dried to obtain CoMOF material. Using the obtained CoMOF material as a substrate, sodium chloropalladate and chloroauric acid as metal precursors, hexadecylpyridine chloride as a surfactant, and ascorbic acid as a reducing agent, corresponding nanoalloys were grown in situ on the CoMOF substrate to obtain AuPd@CoMOF composite material. 1 mL of 10 mg AuPd@CoMOF composite material was dispersed in 1 mL of chitosan solution (0.1 wt%), uniformly drop-coated onto the surface of a glassy carbon electrode, and dried at 50°C to obtain AuPd@CoMOF-E electrode. Subsequently, 0.4 µM SH-HP chain was reacted with 1 mM tris(2-carboxyethyl)phosphonic acid hydrochloride at room temperature for 1 h to open the disulfide bonds of SH-HP. After filtration and purification to remove tris(2-carboxyethyl)phosphonic acid hydrochloride, an activated SH-HP probe was obtained. 10 μL of the activated SH-HP probe (0.3 µM concentration) was added to the surface of the AuPd@CoMOF-E electrode and reacted in the dark for 10 h to obtain the SH-HP chain-modified electrode. Finally, 10 μL of mercaptohexanol (MCH) was added to the SH-HP chain-modified electrode and reacted for 50 min to block inactive sites, resulting in MCH / SH-HP / AuPd@CoMOF-E.

[0043] SH-HP chain: 5'-SH-(CH2)6-TTTTGACAGTCTAGATCACACTCCATrAGCGTTGACTCTAGACTGTC-3' (SEQ ID NO. 7).

[0044] Preparation of S5 and SP-Thi signal probes: The SP probe was activated with tris(2-carboxyethyl)phosphine hydrochloride (using the same method as the SH-HP chain activation). The activated SP probe (concentration 0.3 µM) was then mixed with gold nanoparticles (15 nm; final concentration in the reaction system was 1.5 g / L) and thionine (final concentration in the reaction system was 2 mM) and stirred for 1 h. After centrifugation at 10,000 rpm for 20 min, the supernatant was removed to obtain the signal probe SP-Thi.

[0045] SP probe: 5'-TGATCTAGACTGTC-SH-(CH2)6-3' (SEQ ID NO.8).

[0046] Example 3 This embodiment provides a dual-identification sensor for breast cancer metastasis based on accelerated nanomachines, and its construction method is as follows: S1. Preparation of dual-site recognition probe msRP: The Y1, Y2 and Y3 chains were mixed in equal molar ratio and reacted at 100℃ for 8 min. The mixture was then cooled to 23℃ at a rate of 1℃ / min to obtain the Y-type dual-site recognition probe msRP.

[0047] Y1 chain: 5'-CGTAGGTTACACGTTCAGACTGATTTTTCTCTATTCACGTCTATT-3' (SEQ IDNO.1); Y2 chain: 5'-TCAACATCAGTCTGACTCAGACTCCT-3' (SEQ ID NO. 2); Y3 chain: 5'-ACCACAGGAGTCTGAGACGTGTAACCTACG-3' (SEQ ID NO. 3).

[0048] S2. Preparation of triangular DNA framework TDN: The TS1 and TS2 strands were mixed in an equal molar ratio and reacted at 100°C for 8 min. The mixture was then cooled to 23°C at a rate of 1°C / min to obtain the triangular DNA framework TDN.

[0049] TS1 chain: 5'-AATAGACGTGAATAGAGTTTTCATGAGTCAGGGCGACGACATGAGTCAGGGCTTTTGATTCGATGCGTAGGGCGCTCTTCTATATTGTTTTACGAAGCATACGAATCTCACGAAGCATACGA-3' (SEQ IDNO.4); TS2 chain: 5'-GCCCTGACTCATGTCGTCGCCCTGACTCATG-3' (SEQ ID NO. 5).

[0050] Preparation of S3, msRP-HP1 / TDN composite probe: The msRP probe, triangular DNA framework TDN, and HP1 strand were mixed in a molar ratio of 1:1:2 and reacted at 25°C for 4 hours to obtain msRP-HP1 / TDN.

[0051] HP1 chain: 5'-TCGTATGCTTCGTGAGATTCGTATGCTTCGTTTTTGTCAACGCTCCGAGCGTTACACGTTCAGATGAGTGATGCTCTGAACGTGTAACCTACG-3' (SEQ ID NO. 6).

[0052] S4. Construction of the sensing substrate MCH / SH-HP / AuPd@CoMOF-E: First, cobalt chloride, polyvinylpyrrolidone (PVP, K30), and 2,5-dihydroxyterephthalic acid (DHTA) were dissolved in dimethylformamide and reacted at 120°C for 26 h. After the reaction system cooled naturally to room temperature, it was thoroughly washed and dried to obtain CoMOF material. Using the obtained CoMOF material as a substrate, sodium chloropalladate and chloroauric acid as metal precursors, hexadecylpyridine chloride as a surfactant, and ascorbic acid as a reducing agent, corresponding nanoalloys were grown in situ on the CoMOF substrate to obtain AuPd@CoMOF composite material. 1 mL of 10 mg AuPd@CoMOF composite material was dispersed in 1 mL of chitosan solution (0.1 wt%), uniformly drop-coated onto the surface of a glassy carbon electrode, and dried at 50°C to obtain AuPd@CoMOF-E electrode. Subsequently, 0.4 µM SH-HP chain was reacted with 1 mM tris(2-carboxyethyl)phosphonic acid hydrochloride at room temperature for 1 h to open the disulfide bonds of SH-HP. After filtration and purification to remove tris(2-carboxyethyl)phosphonic acid hydrochloride, an activated SH-HP probe was obtained. 10 μL of the activated SH-HP probe (concentration 0.6 µM) was added dropwise to the surface of the AuPd@CoMOF-E electrode and reacted in the dark for 16 h to obtain the SH-HP chain-modified electrode. Finally, 10 μL of mercaptohexanol (MCH) was added dropwise to the SH-HP chain-modified electrode and reacted for 1 h to block inactive sites, resulting in MCH / SH-HP / AuPd@CoMOF-E.

[0053] SH-HP chain: 5'-SH-(CH2)6-TTTTGACAGTCTAGATCACACTCCATrAGCGTTGACTCTAGACTGTC-3' (SEQ ID NO. 7).

[0054] Preparation of S5 and SP-Thi signal probes: The SP probe was activated with tris(2-carboxyethyl)phosphine hydrochloride (using the same method as the SH-HP chain activation). The activated SP probe (concentration 0.6 µM) was then mixed with gold nanoparticles (20 nm; final concentration in the reaction system was 2 g / L) and thionine (final concentration in the reaction system was 0.5 mM) and stirred for 3 h. After centrifugation at 14000 rpm for 15 min, the supernatant was removed to obtain the signal probe SP-Thi.

[0055] SP probe: 5'-TGATCTAGACTGTC-SH-(CH2)6-3' (SEQ ID NO.8).

[0056] Example 4 The biosensors constructed in Examples 1-3 are used as follows: N1. Mix msRP-HP1 / TDN, HP2 probe, and SP-Thi in a molar ratio of 1:1:1 to obtain a mixed solution with a concentration of 0.4 μM. Mix the solution with the sample to be tested in a volume ratio of 1:10. Take 10 μL and drop it onto the sensing substrate MCH / SH-HP / AuPd@CoMOF-E. React for 30 min.

[0057] HP2 probe: 5'-CAATATAGAAGAGCGCCCTACGCATCGAATCTTTTTCTGAGCATCACTCATCAGAGTTACACGTTGAGTGATGCCGGTCGAAATGGAGTG-3' (SEQ ID NO. 9).

[0058] N2. Using the sensing substrate after the reaction in step N1 as the working electrode, the Ag / AgCl electrode as the reference electrode, and the platinum wire as the auxiliary electrode, a three-electrode system is formed. The current signal is detected in phosphate buffer solution, and a square wave pulse SWV test (potential: -0.1 ~ -0.4 V) is performed. The current signal value is collected and the miRNA concentration is obtained by substituting it into the standard curve.

[0059] A standard curve was constructed by replacing the sample to be tested with miRNA solutions of different concentrations and collecting current signal values.

[0060] Example 5 The performance of the biosensor prepared in Example 1 was tested, including the following experiments: (1) Characterization of nanomaterials like Figure 2 As shown in (A), scanning electron microscopy (SEM) characterization results show that the CoMOF prepared in Example 1 exhibits a uniform polyhedral rod-like morphology with an average diameter of approximately 4 μm. Figure 2As shown in (B), the polyhedral rod-shaped microstructure of AuPd nanoparticles was maintained after further growth on the CoMOF surface. Figure 2 As shown in (C), the high-magnification scanning electron microscope results show that AuPd nanoparticles are uniformly dispersed on the surface of the CoMOF support. Figure 2 Middle (D) - Figure 2 The middle (G) diagram shows the elemental distribution of CoMOF, revealing that C, Co, and O elements are uniformly distributed in the bulk phase of this nanomaterial. X-ray diffraction (XRD) characterization of AuPd@CoMOF yielded the following results: Figure 2 As shown in (H), the results show that AuPd@CoMOF exhibits characteristic diffraction peaks at 2θ of 6.76°, 11.72°, 38.18°, 44.37°, 64.56°, 77.55°, 39.93°, 46.43° and 67.77°, respectively, which correspond to the (-120) and (030) crystal planes of CoMOF, the (111), (200), (220) and (311) crystal planes of Au, and the (111), (200) and (220) crystal planes of Pd. Figure 2 The X-ray energy dispersive spectroscopy (EDS) analysis results shown in (I) further confirm that AuPd@CoMOF contains C, Co, O, Au and Pd elements.

[0061] The characterization results above indicate that the AuPd@CoMOF nanocomposite material has been successfully prepared.

[0062] (2) Feasibility characterization of testing The assembly of the msRP-HP1 / TDN composite probe was verified using polyacrylamide gel electrophoresis (PAGE). Figure 3 As shown in (A), the TS1 probe exhibits a clear, single electrophoretic band in lane 1. When TS1 and TS2 are mixed in an equimolar ratio and subjected to heat annealing, a separate characteristic band with a lower migration rate appears in lane 2, confirming complete hybridization of TS1 and TS2 to form a triangular DNA nanostructure (TDN). Hybridization of TDN with the msRP chain further increases the molecular weight, and the electrophoretic migration rate continues to decrease, corresponding to the band in lane 3. Further addition of the HP1 chain forms a DNA complex with an even larger molecular weight, and the electrophoretic band migration rate further decreases (lane 4). These results demonstrate the successful assembly of msRP-HP1 / TDN.

[0063] Furthermore, the current response performance of the MCH / SH-HP / AuPd@CoMOF-E modified electrode to different DNA probes was further evaluated. Figure 3As shown in Figure (B), in the absence of target miRNAs, only a negligible weak current signal appeared after the electrode was incubated with msRP-HP1 / TDN, HP2, and SP-Thi (curve a), proving that SP-Thi could not bind to the sensing interface. After adding miRNA 21, a locally accelerated high-order signal amplification response was initiated through recognition site 1, resulting in a significant increase in the current signal (curve b). Similarly, after adding miRNA 105, recognition site 2 triggered a signal amplification loop, and the current response was also significantly enhanced (curve c). When miRNA 21 and miRNA 105 were added simultaneously, the current response was similar to that of single-target detection, proving that this sensing system can achieve locally accelerated high-order signal amplification through multi-site recognition.

[0064] (3) Detection performance study Using the biosensor from Example 1, different concentrations of miRNA samples (0 aM, 20 aM, 200 aM, 2 fM, 20 fM, 500 fM, 5 pM, 50 pM, and 500 pM) were detected. Square wave pulse SWV testing was performed, current signals were acquired, and a standard curve was constructed to evaluate the sensitivity of the biosensor (method as in Example 2). Results are as follows: Figure 4 As shown.

[0065] First, the biosensor constructed in this invention was used to quantitatively detect different concentrations of miRNA 21. For example... Figure 4 (A) Figure 4 As shown in (B), the current response intensity of the electrode showed a continuous upward trend as the concentration of miRNA 21 gradually increased from 0 aM to 500 pM. Based on the detection results, a calibration curve was plotted, indicating that within the concentration range of 20 aM to 500 pM, the current intensity (…) i The logarithm of miRNA 21 concentration () lgc 21 The linear relationship is well observed, and its linear regression equation is: i = 0.2477 lgc 21 +4.235, the square of the correlation coefficient (R²) 2 The signal-to-noise ratio (SNR) reached 0.9928. Based on the 3σ method (SNR=3), the detection limit (LOD) of this sensor for miRNA 21 was calculated to be 4.6 aM.

[0066] The biosensor was further used to evaluate the quantitative detection performance of miRNA 105, with the detection concentration range also set from 20 aM to 500 pM. The results are as follows: Figure 4 (C) Figure 4As shown in (D). Experimental data show that the current response intensity corresponds to the logarithm of the miRNA 10⁵ concentration ( lgc 105 It exhibits good linear correlation, and its linear regression equation is: i =0.2233 lgc 105 +3.832, the square of the correlation coefficient (R²) 2 The value is 0.9959. Calculated using the 3σ method, the detection limit of this sensor for miRNA 105 is 5.4 aM.

[0067] Meanwhile, single-base mismatched miRNAs and random sequence miRNAs at 10-fold concentrations were selected as controls (Table 1) to examine the sensor's specific recognition performance. Experimental results showed that only fully complementary miRNAs 21 and 105 elicited significant current responses, while the signal intensity corresponding to the control sequences was less than 3.6% of that of the target analyte. This fully demonstrates that the sensor has extremely strong specific recognition capability for the target miRNA and can effectively avoid detection errors caused by non-specific hybridization.

[0068] Compared to the detection limits (fM~pM) of traditional methods, this biosensor has higher sensitivity and can achieve the detection and analysis of dual miRNAs.

[0069] Table 1. Sequences for specific detection Example 6 Differentiating and identifying different tumor cell lines, and screening for highly metastatic breast cancer cells: Biosensor that blocks the miRNA 105 recognition site: The construction method is the same as in Example 1, except that the miRNA 105 recognition site in msRP-HP1 / TDN is blocked. The blocking operation is as follows: Equimolar amounts of blocker1 are hybridized with msRP-HP1 / TDN at room temperature for 1 h to block the miRNA 105 recognition site.

[0070] Biosensor that blocks the miRNA 21 recognition site: The construction method is the same as in Example 1, except that the miRNA 21 recognition site in msRP-HP1 / TDN is blocked. The blocking operation is as follows: Equimolar amounts of blocker2 are hybridized with msRP-HP1 / TDN at room temperature for 1 h to block the miRNA 21 recognition site.

[0071] blocker1: 5'-TGTGGT-3'.

[0072] blocker2: 5'-TGTTGA-3'.

[0073] The biosensor from Example 1, with its miRNA 105 recognition site blocked, was used to detect miRNA 21 in five cell lines: HeLa cervical cancer cells, TPC-1 thyroid cancer cells, MCF-7 breast cancer cells, HepG2 liver cancer cells, and MDA-MB-231 breast cancer cells. Before quantitative detection, total RNA was extracted from the cell suspension using a cell RNA extraction kit (trizol). The miRNA 21 detection method was the same as in Example 4, and the current intensity induced by different intracellular miRNA 21 was recorded. The results are shown in [Figure 4]. Figure 5 (A) The results showed that miRNA 21 was expressed in all of the above-mentioned cancer cell types, and the expression level of miRNA 21 in breast cancer cells was significantly higher than that in other types of cancer cells.

[0074] Further detection of miRNA 105 using a biosensor that blocks the miRNA 21 recognition site yielded the corresponding current signal changes, as shown below. Figure 5 As shown in (B). Compared with MCF-7 cells, the current signal of highly metastatic malignant MDA-MB-231 cells was significantly enhanced, proving that the expression level of miRNA 105 in MDA-MB-231 cells was significantly increased.

[0075] Experimental results show that miRNA 21 can effectively distinguish breast cancer cells from other types of cancer cells, while miRNA 105 can further characterize the metastatic characteristics of breast cancer, achieving precise identification of highly metastatic breast cancer cells. (See schematic diagram below.) Figure 5 (C)

[0076] Example 7 Analysis and detection of endogenous miRNAs in clinical serum samples: Clinical blood samples were collected from a hospital in Xuzhou City on January 8, 2025, including three serum samples from healthy volunteers and three serum samples from patients with metastatic breast cancer. Before testing, miRNAs were extracted from each group of serum samples using the TRIzol method. Detection was then performed using a biosensor that blocked the miRNA 105 recognition site or a biosensor that blocked the miRNA 21 recognition site, as constructed in Example 6, following the same method as in Example 4. Each sample was tested in six parallel replicates.

[0077] Depend on Figure 6The test results show that neither miRNA 21 nor miRNA 105 was significantly overexpressed in the three serum samples from healthy volunteers. Conversely, both miRNAs were highly expressed in the serum samples from metastatic breast cancer patients. These results confirm that the biosensor constructed in this invention can effectively distinguish between breast cancer patients and healthy individuals by detecting the expression levels of miRNA 21 and miRNA 105 in serum, which has significant clinical implications for rapid and accurate detection of breast cancer.

[0078] To further verify the reliability and detection accuracy of this sensing system, commercially available qRT-PCR miRNA detection kits (MyBioSource MBS826049 and MBS825601, USA) were used to conduct control tests on serum samples from the same batch. Student's t-test was used to statistically analyze the detection results of the method of this invention and the standard qRT-PCR method. The results showed that within the 95% confidence interval, there was no statistically significant difference between the two detection methods, indicating extremely high data consistency. This result fully demonstrates that the biosensor provided by this invention is suitable for the accurate detection of endogenous miRNAs in actual biological samples and has good clinical application feasibility.

[0079] In summary, the dual-site identification biosensor constructed in this invention can not only accurately distinguish breast cancer cells from other tumor cells, but also further differentiate between ordinary breast cancer cells and highly metastatic breast cancer cells. It has good specificity, anti-interference ability and detection sensitivity, providing a brand-new technical means and detection tool for early screening, clinical diagnosis and prognostic assessment of breast cancer metastasis.

[0080] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A dual-identification biosensor for breast cancer metastasis, characterized in that, This includes the molecular recognition system and the sensing substrate MCH / SH-HP / AuPd@CoMOF-E; The molecular recognition system includes an msRP-HP1 / TDN composite probe, an HP2 probe, and an SP-Thi signal probe; The msRP-HP1 / TDN composite probe is obtained by self-assembling the msRP probe and HP1 strand into a triangular DNA framework TDN. The msRP probe is obtained by annealing and hybridizing the Y1, Y2 and Y3 chains; The nucleotide sequences of the Y1 chain, the Y2 chain, and the Y3 chain are shown in SEQ ID NO. 1-3, respectively; The nucleotide sequence of the HP1 chain is shown in SEQ ID NO.6; The triangular DNA framework TDN is obtained by annealing and hybridizing the TS1 and TS2 strands. The nucleotide sequences of the TS1 chain and the TS2 chain are shown in SEQ ID NO.4-5, respectively; The nucleotide sequence of the HP2 probe is shown in SEQ ID NO.9; The SP-Thi signal probe is obtained by mixing and reacting SP probe, gold nanoparticles, and thionine. The nucleotide sequence of the SP probe is shown in SEQ ID NO.8; The sensing substrate MCH / SH-HP / AuPd@CoMOF-E is obtained by coupling the SH-HP chain with the AuPd@CoMOF-E electrode; The nucleotide sequence of the SH-HP chain is shown in SEQ ID NO.7; The AuPd@CoMOF-E electrode is prepared by drop-coating a cobalt MOF composite material loaded with gold-palladium nanoparticles onto the surface of a glassy carbon electrode.

2. A method for constructing a dual-recognition biosensor for breast cancer metastasis as described in claim 1, characterized in that, Includes the following steps: The Y1, Y2, and Y3 chains are annealed and hybridized to obtain the msRP probe; the TS1 and TS2 chains are annealed and hybridized to obtain the triangular DNA framework TDN; the msRP probe and HP1 chain are self-assembled into the triangular DNA framework TDN to obtain the msRP-HP1 / TDN composite probe; The SP-Thi signal probe is obtained by mixing and reacting the activated SP probe, the gold nanoparticles, and the thionine. The AuPd@CoMOF-E electrode was prepared by drop-coating the cobalt MOF composite material loaded with gold-palladium nanoparticles onto the surface of a glassy carbon electrode; the sensing substrate MCH / SH-HP / AuPd@CoMOF-E was obtained by coupling the SH-HP chain with the AuPd@CoMOF-E electrode.

3. The method for constructing a dual-recognition biosensor for breast cancer metastasis as described in claim 2, characterized in that, The SP probe was activated using tris(2-carboxyethyl)phosphonic acid hydrochloride.

4. The method for constructing a dual-recognition biosensor for breast cancer metastasis as described in claim 2, characterized in that, The preparation method of the cobalt MOF composite material loaded with gold and palladium nanoparticles includes: using cobalt chloride, polyvinylpyrrolidone, and 2,5-dihydroxyterephthalic acid as raw materials, a cobalt MOF material is synthesized by a solvothermal method; using the cobalt MOF material as a substrate, gold and palladium nanoparticles are grown in situ on the surface of the substrate by a reduction method to obtain the cobalt MOF composite material loaded with gold and palladium nanoparticles.

5. The method for constructing a dual-recognition biosensor for breast cancer metastasis as described in claim 2, characterized in that, The particle size of the gold nanoparticles is 15-20 nm.

6. The method for constructing a dual-recognition biosensor for breast cancer metastasis as described in claim 2, characterized in that, The method for coupling the SH-HP chain with the AuPd@CoMOF-E electrode includes: activating the SH-HP chain with tris(2-carboxyethyl)phosphine hydrochloride, then adding it dropwise onto the AuPd@CoMOF-E electrode, reacting in the dark, and then blocking the inactive sites with mercaptohexanol.

7. The application of the breast cancer metastasis dual-recognition biosensor as described in claim 1 in the preparation of detection products for miRNA 21 and / or miRNA 105, characterized in that, When preparing the detection product for miRNA 21, blocker1 was used to block the miRNA 105 recognition site in the msRP-HP1 / TDN composite probe; When preparing the detection product of miRNA 105, blocker2 was used to block the miRNA 21 recognition site in the msRP-HP1 / TDN composite probe; The nucleotide sequence of blocker1 is TGTGGT; the nucleotide sequence of blocker2 is TGTTGA.

8. The application as described in claim 7, characterized in that, The testing product is a reagent kit.

9. A detection product for miRNA 21 and / or miRNA 105, characterized in that, Includes blocker1, blocker2 and the dual-identification biosensor for breast cancer metastasis as described in claim 1; The nucleotide sequence of blocker1 is TGTGGT; the nucleotide sequence of blocker2 is TGTTGA.

10. The detection product for miRNA 21 and / or miRNA 105 as described in claim 9, characterized in that, The testing product is a reagent kit.

Images