A kit for rapidly detecting taenia saginata by using CRISPR-Cas12a and a detection method thereof

By combining RPA and CRISPR-Cas12a technologies, designing specific primers and crRNA, and utilizing the trans-cleavage activity of the CRISPR-Cas12a protein, a rapid, accurate, and sensitive detection of beef tapeworm was achieved. This solves the problems of cumbersome detection, long cycle, and high cost in existing technologies, and enables efficient identification of beef tapeworm DNA.

CN122382205APending Publication Date: 2026-07-14INST OF PARASITIC DISEASE PREVENTION & CONTROL CHINESE CENT FOR DISEASE CONTROL & PREVENTION (NAT RES CENT FOR TROPICAL DISEASES) +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610726841.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-25
Publication Date
2026-07-14

Smart Images

  • Figure CN122382205A_ABST
    Figure CN122382205A_ABST
Patent Text Reader

Abstract

The application provides a kit for rapidly detecting Taenia saginata by using CRISPR-Cas12a, which comprises the following components: an upstream primer, a downstream primer, crRNA, CRISPR-Cas12a protein and a single-stranded DNA reporter molecule; the sequence of the upstream primer is shown as SEQ ID NO:1, the sequence of the downstream primer is shown as SEQ ID NO:2, and the sequence of the crRNA is shown as SEQ ID NO:3. The application also provides a method for detecting Taenia saginata by using the kit. The primer and the crRNA provided by the application are suitable for rapid detection of Taenia saginata, the detection sensitivity of the application reaches 10 copies / reaction, and the application has high specificity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological detection and relates to a reagent kit, specifically a rapid detection kit and detection method for beef tapeworm using CRISPR-Cas12a. Background Technology

[0002] The beef tapeworm (Taenia saginata), also known as the fat tapeworm, is a zoonotic parasite belonging to the genus Taenia in the family Taeniidae of the class Cestoda in the phylum Platyhelminths. It is one of the most important foodborne tapeworms in public health.

[0003] The beef tapeworm uses humans as its definitive host, causing beef tapeworm disease. The tapeworm larvae parasitize intermediate hosts in bovine animals (cattle, sheep, deer, etc.), leading to cysticercosis (T. saginata cysticercosis). Humans are generally infected by consuming raw or undercooked beef containing cysticercosis larvae. Long-term infestation by the beef tapeworm in humans can cause malnutrition symptoms such as endogenous vitamin deficiencies and anemia.

[0004] Traditional tapeworm identification relies primarily on the morphological characteristics of the worm, but identification based solely on morphological features is challenging. With advancements in molecular techniques, PCR technology has been applied to the detection of beef tapeworms; however, its specificity and sensitivity need improvement, and the diagnostic process is cumbersome, time-consuming, costly, and requires expensive instruments and reagents, failing to meet the demand for rapid detection. Recombinase polymerase amplification (RPA), a nucleic acid isothermal amplification technique performed within the 37℃-42℃ range, mimics DNA replication in vivo. Its reaction conditions are mild, amplification efficiency is high, and equipment is simple, leading to its widespread development and application in pathogen detection in recent years.

[0005] CRISPR-Cas12a, as an emerging molecular biology tool, can be used for rapid detection of pathogens due to its good specificity and sensitivity. This invention combines RPA technology with CRISPR-Cas12a technology for the rapid detection of beef tapeworm. Summary of the Invention

[0006] To address the aforementioned technical problems in the prior art, this invention provides a kit and method for rapid detection of beef tapeworm using CRISPR-Cas12a. This kit and method for rapid detection of beef tapeworm using CRISPR-Cas12a aims to solve the technical problems of cumbersome, time-consuming, and costly methods for detecting beef tapeworm in the prior art.

[0007] This invention provides a kit for rapid detection of beef tapeworm using CRISPR-Cas12a, comprising the following components: upstream primer, downstream primer, crRNA, CRISPR-Cas12a protein, and single-stranded DNA reporter molecule;

[0008] The upstream primer sequence is shown in SEQ ID NO:1, the downstream primer sequence is shown in SEQ ID NO:2, and the crRNA sequence is shown in SEQ ID NO:3.

[0009] Furthermore, the CRISPR-Cas12a protein is the LbCas12a protein.

[0010] Furthermore, the single-stranded DNA reporter molecule is: a fluorescent reporter group - TTATT-fluorescent quencher group.

[0011] Furthermore, the fluorescent reporter group is FAM, HEX, TET, JOE or VIC, and the fluorescent quencher group is BHQ1, BHQ2 or BHQ3.

[0012] Furthermore, the final concentration of the upstream and downstream primers is 300-500 nM.

[0013] This invention also provides a method for rapid detection of beef tapeworm using the above-mentioned kit for non-diagnostic purposes, comprising the following steps:

[0014] 1) The steps for extracting DNA from a sample;

[0015] 2) A step in amplifying sample DNA,

[0016] Mix 25 μL of RPA buffer, 2 μL of the upstream primer shown in SEQ ID No:1, 2 μL of the downstream primer shown in SEQ ID No:2, 17.5 μL of double-distilled water, and 2.5 μL of magnesium acetate solution in a 1.5 mL EP tube until homogeneous. Add this mixture to the RPA reaction unit to dissolve the lyophilized powder. Add 1 µL of the sample DNA to the prepared reaction reagent tube. After adding the sample, thoroughly mix each reaction tube. The total volume of each reaction tube is 50 µL. Incubate the mixed reaction tubes at 37 °C for 10–30 min.

[0017] 3) The detection procedure using CRISPR-Cas12a.

[0018] Place 2 μL of 10×LbCas12a Buffer, 0.5 μL of crRNA, 0.5 μL of single-stranded DNA reporter molecule, 0.5 μL of CRISPR-Cas12a protein, 2 μL of sample DNA amplified in step 2), and 14.5 μL of double-distilled water into a detector for detecting FAM fluorescence. Set the reaction temperature to 37℃ and the reaction time to 10-30 min to obtain the detection results.

[0019] CRISPR-Cas12a is a nucleic acid detection technology based on the CRISPR system. It relies on the trans-cleavage activity of the Cas12a protein. When the Cas12a protein binds to a specific guide RNA (crRNA) to form a complex, it can recognize and cleave double-stranded DNA target sequences complementary to the crRNA. Simultaneously with cleaving the target DNA, the Cas12a protein also non-specifically cleaves surrounding single-stranded DNA; this characteristic is known as trans-cleavage activity. Utilizing this activity, specific fluorescent probes can be designed. When the probe is trans-cleaved by Cas12a, a fluorescent signal is released, thereby enabling the detection of the target DNA. This invention designs crRNA targeting the cox1 gene of *Taenia solium*, combines it with the Cas12a protein and a fluorescent probe, and can rapidly and accurately detect *Taenia solium* in samples.

[0020] Compared with existing technologies, the technical effects of this invention are positive and significant. This invention provides a convenient, rapid, accurate, and sensitive method for detecting *Taenia solium*. The primers provided in this invention are suitable for RPA isothermal amplification. By introducing Cas12a and crRNA, *Taenia solium* DNA can be accurately detected. The detection sensitivity can reach 10 copies / reaction, and it has high specificity. This method can conveniently, rapidly, and accurately identify *Taenia solium* DNA. It is simple to operate and does not require temperature-controlled amplification instruments like PCR; detection can be completed simply by isothermal amplification at 37°C. Attached Figure Description

[0021] Figure 1 The results of sensitivity detection of different concentrations of beef tapeworm plasmid DNA (real-time fluorescence detection).

[0022] Figure 2 Sensitivity detection results of different concentrations of beef tapeworm plasmid DNA (visual detection);

[0023] Figure 3 This is a specific detection result for Beef Tapeworm DNA (real-time fluorescence method).

[0024] Figure 4 Specific detection results of beef tapeworm DNA (visualized detection);

[0025] Figure 5 The results of detecting the DNA of bovine tapeworm in a sample using the method of this invention (real-time fluorescence method);

[0026] Figure 6 This is the detection result (visualized detection) of bovine tapeworm DNA in a sample using the method of this invention. Detailed Implementation

[0027] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0028] Example 1: Design of amplification primers, crRNA, and construction of positive plasmids for Beef Tapeworm.

[0029] The cox1 gene sequence of beef tapeworm was obtained from the NCBI (National Center for Biotechnology Information) website. The sequence was analyzed using DNAman9.0 to identify the specific sequence of beef tapeworm, which is shown in SEQ ID NO:4. This sequence was cloned into the pUC57 plasmid (Sangon Biotech (Shanghai) Co., Ltd.) to construct a positive recombinant plasmid containing the target detection gene.

[0030] Primers and crRNA were designed using Amplifx software based on the sequence shown in SEQ ID NO:4. The upstream primer sequence is shown in SEQ ID NO:1, the downstream primer sequence is shown in SEQ ID NO:2, and the crRNA sequence is shown in SEQ ID NO:3. The reporter molecule sequence is FAM-TTATT-BHQ1.

[0031] SEQ ID NO: 1: caccctatac cagcacccaa acacatacta ac.

[0032] SEQ ID NO: 2: caaatattta attcctttgg ttggtgggtt.

[0033] SEQ ID NO:3: uaauuucuac uaaguguaga uaacggggua aauucaaauc a.

[0034] SEQ ID NO:4:

[0035] ctacttgaaa ataatgatga cgacaaaggc ggataaaaag tccaccctat accagcacccaaacacatac taaccaaaag aaaagccatc gaaggaatca ataaccatgc acttaaagca tttaaacggggtaaattcaa atcagataac ccaccaacca aaggaattaa atatttgccg aaaccaccta ttaaaataggcattaaaaaa aagaaaatca ttatattcc atgattagta atca.

[0036] The following are the preparations of working standards for recombinant plasmids:

[0037] Working standard sample 1 contains 1.0 × 10 5 Plasmids containing copies / µL of beef tapeworm DNA fragments.

[0038] Working standard sample 2 contains 1.0 × 10 4 Plasmids containing copies / µL of beef tapeworm DNA fragments.

[0039] Working standard sample 3 contains 1.0 × 10 3 Plasmids containing copies / µL of beef tapeworm DNA fragments.

[0040] Working standard sample 4 contains 1.0 × 10 2 Plasmids containing copies / µL of beef tapeworm DNA fragments.

[0041] Working standard sample 5 contains 1.0 × 10⁵ 1 Plasmids containing copies / µL of beef tapeworm DNA fragments.

[0042] Example 2 Sensitivity Experiment

[0043] (1) Preparation of RPA reaction system

[0044] The RPA reaction system was prepared according to the basic nucleic acid amplification kit (catalog number DNA-LS01) of Lesun Biotechnology (Wuxi) Co., Ltd. The kit includes RPA reaction unit (lyophilized reaction tube containing amplification-related enzyme components such as recombinase and polymerase), RPA buffer (Tirs buffer containing potassium acetate), magnesium acetate and double-distilled water.

[0045] Prepare the components according to Table 1, 50 μL system.

[0046] Table 1 RPA amplification system (50 μL reaction system)

[0047] Components Dosage (μL) per unit RPA buffer 25 Upstream primer (SEQ ID No:1) (10 μM) 2 Downstream primer (SEQ ID No:2) (10 μM) 2 Double distilled water 17.5 Template DNA 1 Magnesium acetate (280 mM) 2.5

[0048] Prepare according to Table 1 above. Mix all components (except template DNA) thoroughly in a 1.5 mL EP tube and add to the RPA reaction unit.

[0049] Dissolve the lyophilized powder. Add 1 μL of negative control (double-distilled water), 1 μL of working standard 5, 1 μL of working standard 4, 1 μL of working standard 3, 1 μL of working standard 2, and 1 μL of working standard 1 (as templates) to the prepared reaction reagent test tubes. After adding the samples, mix thoroughly in each reaction tube. The total volume of each reaction tube is 50 μL. Incubate the reaction tubes at 37°C for 30 min.

[0050] (2) Preparation of Cas12a reaction system

[0051] Table 2 CRISPR-Cas12a detection system (20 μL reaction system)

[0052] Components Dosage (μL) per unit NEBuffer™ r2.1 (NEB) 2 crRNA (10 µM) 0.5 Reporter molecule (10 µM) 0.5 LbCas12a protein (NEB) 0.5 water 14.5 RPA products 2

[0053] Prepare the solution according to the above formula, place it in a FAM fluorescence detector, set the reaction temperature to 37℃, and the reaction time to 30 min. The detection results are attached. Figure 1 As shown. For visual detection, the system was prepared according to the above formula, reacted at 37°C for 30 minutes, and photographed using a blue light gel cutting instrument. The detection results are attached. Figure 2 As shown.

[0054] Detection of 6 concentration gradients (10 5 copies, 10 4 copies, 10 3 copies, 10 2 copies, 10 1 (copies, 0 copies), attached Figure 1 These are the results of real-time fluorescence detection, attached. Figure 2 The results are visualized, showing that both detection methods achieve a sensitivity of 1.0 × 10⁻⁶. 1 The "copies / reaction" method means that if there are 10 copies in each reaction tube, it can be detected, achieving rapid and sensitive detection results.

[0055] Example 3 Specificity Experiment

[0056] Sample information: Genomic DNA samples of beef tapeworm (T. saginata), pork tapeworm (T. solium), and Asian tapeworm (T. asiatica) were provided by the National Institute for Parasitic Diseases Control and Prevention (National Center for Tropical Diseases Research), Chinese Center for Disease Control and Prevention.

[0057] (1) Preparation of RPA reaction system

[0058] Prepare the reaction solution according to Table 1. Mix all components (except template DNA) thoroughly in a 1.5 mL EP tube, add them to the RPA reaction powder, and dissolve the lyophilized powder. Add 1 µL of the sample DNA to each of the prepared reaction reagent tubes, and mix thoroughly after adding the samples. The total volume of each reaction tube is 50 µL. Incubate the mixed reaction tubes at 37°C for 30 min.

[0059] (2) Preparation of Cas12a reaction system

[0060] Prepare the solution according to the system in Table 2, place it in the FAM fluorescence detector, set the reaction temperature to 37℃, and the reaction time to 30 min. The detection results are attached. Figure 3 As shown. For visual detection, the system was prepared according to the above formula, reacted at 37°C for 30 minutes, and photographed using a blue light gel cutting instrument. The detection results are attached. Figure 4 As shown.

[0061] Genetic testing was performed on *Taenia solium*, *Taenia porgy*, and *Taenia asiatica*. Figure 3 These are the results of real-time fluorescence detection, attached. Figure 4 The results are visualized and show that both detection methods detected *Taenia solium*, with no cross-reaction with other similar species (*Taenia solium*, *Taenia asiatica*), demonstrating good detection specificity.

[0062] Example 4 Sample Detection

[0063] Sample information: After DNA extraction, 20 tapeworm segment samples provided by Dali University were used for species identification by PCR amplification based on the cytochrome c oxidase subunit 1 (cox1) gene and Sanger sequencing analysis. The results showed that 16 samples were Asian tapeworms and 4 samples were beef tapeworms.

[0064] DNA extraction: DNA extraction from the worm samples was performed using the DNeasy Blood & Tissue Kit (69504, QIAGEN, Germany). The extraction steps were as follows:

[0065] 1) Take 20 mg of the worms and cut them into small pieces, then place them in a 1.5 mL centrifuge tube. Add 180 μL of Buffer ATL (QIAGEN, Germany) and 20 μL of Proteinase K (QIAGEN, Germany), then vortex to mix and incubate at 56 °C until complete lysis. Vortex occasionally during incubation, and vortex for 15 seconds before proceeding to step 2.

[0066] 2) Add 200 μL of Buffer AL, then vortex to mix, and incubate at 56°C for 10 min.

[0067] 3) Add 200 μL of anhydrous ethanol and then vortex to mix.

[0068] 4) Place the mixture into a mini centrifuge column containing a 2 mL collection tube, centrifuge at 8000 rpm for 1 min, and discard the collection tube.

[0069] 5) Place the mini centrifuge column into a new 2 mL collection tube, add 500 μL of Buffer AW1 (QIAGEN, Germany), centrifuge at 8000 rpm for 1 min, and discard the collection tube.

[0070] 6) Place the mini centrifuge column into a new 2 mL collection tube, add 500 μL of Buffer AW2 (QIAGEN, Germany), centrifuge at 14000 rpm for 3 min, and discard the collection tube.

[0071] 7) Place the mini centrifuge column into a new 1.5 mL microcentrifuge tube.

[0072] 8) Elute DNA by adding 50 μL of Buffer AE (QIAGEN, Germany) to the center of the mini centrifuge column membrane, incubate at room temperature for 1 min, and centrifuge at 8000 rpm for 1 min.

[0073] 9) Measure the concentration of the extracted DNA using a spectrophotometer and store it in a refrigerator at -20°C for later use.

[0074] (1) Preparation of RPA reaction system

[0075] Prepare the reaction solution according to Table 1. Mix all components (except template DNA) thoroughly in a 1.5 mL EP tube, add them to the RPA reaction powder, and dissolve the lyophilized powder. Add 1 µL of the sample DNA to each of the prepared reaction reagent tubes, and mix thoroughly after adding the samples. The total volume of each reaction tube is 50 µL. Incubate the mixed reaction tubes at 37°C for 30 min.

[0076] (2) Preparation of Cas12a reaction system

[0077] Prepare the solution according to the system in Table 2, place it in the FAM fluorescence detector, set the reaction temperature to 37℃, and the reaction time to 20 min. The detection results are attached. Figure 5 As shown. For visual detection, the system was prepared according to the above method, reacted at 37°C for 20 minutes, and photographed using a blue light gel cutting instrument. The detection results are attached. Figure 6 As shown.

[0078] Appendix Figure 5 These are the results of real-time fluorescence detection, attached. Figure 6 The results are visualized. The results show that beef tapeworm was detected in 4 out of 20 actual samples, while Asian tapeworm was not detected in the remaining 16 samples. Both detection methods performed well on the actual samples.

[0079] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A kit for rapid detection of beef tapeworm using CRISPR-Cas12a, characterized in that, It includes the following components: upstream primer, downstream primer, crRNA, CRISPR-Cas12a protein, and single-stranded DNA reporter molecule; The upstream primer sequence is shown in SEQ ID NO:1, the downstream primer sequence is shown in SEQ ID NO:2, and the crRNA sequence is shown in SEQ ID NO:

3.

2. The kit for rapid detection of beef tapeworm using CRISPR-Cas12a according to claim 1, characterized in that, The CRISPR-Cas12a protein is the LbCas12a protein.

3. The kit for rapid detection of beef tapeworm using CRISPR-Cas12a according to claim 1, characterized in that, The single-stranded DNA reporter molecule is: a fluorescent reporter group - TTATT-fluorescence quencher group.

4. The kit for rapid detection of beef tapeworm using CRISPR-Cas12a according to claim 1, characterized in that, The fluorescent reporter group is FAM, HEX, TET, JOE or VIC, and the fluorescent quencher group is BHQ1, BHQ2 or BHQ3.

5. The kit for rapid detection of beef tapeworm using CRISPR-Cas12a according to claim 1, characterized in that, The final concentrations of the upstream and downstream primers are 300-500 nM.

6. A method for rapid detection of beef tapeworm using the kit described in claim 1 for non-diagnostic purposes, comprising the following steps: 1) The steps for extracting DNA from a sample; 2) A step in amplifying sample DNA, Mix 25 μL of RPA buffer, 2 μL of the upstream primer shown in SEQ ID No:1, 2 μL of the downstream primer shown in SEQ ID No:2, 17.5 μL of double-distilled water, and 2.5 μL of magnesium acetate solution in a 1.5 mL EP tube. Add the mixture to the RPA reaction unit to dissolve the lyophilized powder. Add 1 µL of the sample DNA to the prepared reaction reagent tube. After adding the sample, mix each reaction tube thoroughly. The total volume of each reaction tube is 50 µL. Incubate the mixed reaction tubes at 37 °C for 10–30 min. 3) The detection procedure using CRISPR-Cas12a. Place 2 μL of 10×LbCas12a Buffer, 0.5 μL of crRNA, 0.5 μL of single-stranded DNA reporter molecule, 0.5 μL of CRISPR-Cas12a protein, 2 μL of sample DNA amplified in step 2), and 14.5 μL of double-distilled water into a detector for detecting FAM fluorescence. Set the reaction temperature to 37℃ and the reaction time to 10-30 min to obtain the detection results.