SNP markers associated with wheat thousand kernel weight and uses thereof

Abstract

The application discloses a SNP marker related to the thousand-grain weight of wheat and an application thereof, and belongs to the technical field of genetic engineering. The SNP site identified by the application is located at the 90949397bp of the 7B chromosome of wheat and has A / T polymorphism. It is confirmed that the SNP site is closely related to the thousand-grain weight through phenotype difference analysis combined with exon capture technology. On this basis, the application develops a specific KASP primer combination for quickly and accurately identifying the thousand-grain weight of wheat. The technology has important application value in the high-yield breeding of wheat. On the one hand, the technology can improve the selection efficiency of excellent genotypes and shorten the breeding period; on the other hand, the technology is helpful for quickly identifying and cultivating high-thousand-grain-weight varieties. The developed KASP primer combination provides a reliable tool for molecular marker-assisted selection, can effectively improve the performance of yield-related traits, and further improve the overall yield and quality of wheat.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to SNP markers related to the thousand-grain weight of wheat and their applications. Background Technology

[0002] wheat( Triticum aestivum Wheat (L.) is one of the most widely planted food crops globally, and its high and stable yields play a crucial role in food security. Thousand-grain weight (the weight of 1000 wheat grains in grams) is an important indicator for measuring wheat yield and processing quality, directly reflecting the fullness of the grains and the accumulation of grain-filling substances. A higher thousand-grain weight generally means a greater yield potential per unit area. In breeding practice, thousand-grain weight, along with grains per spike and effective spikes, constitutes the three key factors of yield and is a crucial selection indicator for breeding superior varieties. Therefore, identifying functional genes or molecular markers related to thousand-grain weight and conducting marker-assisted breeding has become an important direction in modern high-yield wheat breeding.

[0003] Currently, exome sequencing, through sequence capture technology to enrich exon regions throughout the genome, combined with high-throughput sequencing, can efficiently detect genetic variations such as SNPs and InDels associated with protein function variations. Compared to whole-genome sequencing, exome sequencing is lower in cost and higher in efficiency, and has been widely used to elucidate the genetic basis of complex traits. On the other hand, KASP (Kompetitive Allele Specific PCR), as a high-throughput genotyping technique based on SNP sites, has high stability, accuracy, and cost-effectiveness, and is particularly suitable for detecting a small number of sites in large batches of samples. The application of KASP has significantly accelerated genotyping speed and reduced experimental costs, and has shown broad prospects in fields such as agricultural breeding, genetic mapping, and molecular diagnostics.

[0004] However, existing technologies still have the following shortcomings: First, most reported wheat thousand-grain weight-related SNP markers are concentrated in a few chromosomal segments, and their universality and stability in major Chinese varieties need to be improved; second, although exome sequencing can obtain a large number of SNPs, there is still a lack of efficient strategies to screen out sites that are closely related to thousand-grain weight and suitable for conversion into KASP markers; third, there is currently a lack of KASP primer combinations located at specific sites on wheat chromosome 7B that can significantly distinguish between thousand-grain weight and grain length phenotypes, as well as simple and accurate detection methods.

[0005] In view of this, the present invention provides a wheat thousand-grain weight-related SNP marker to enrich the early prediction methods of wheat thousand-grain weight and grain length traits, and to be used for molecular marker-assisted breeding. Summary of the Invention

[0006] Therefore, this invention provides SNP markers related to the thousand-grain weight of wheat and their applications to address the shortcomings of the prior art.

[0007] To achieve the above objectives, the present invention provides the following technical solution: According to a first aspect of the invention, a wheat thousand-grain weight-related SNP marker is provided, the SNP marker being located at 90949397 bp on wheat chromosome 7B and having a polymorphism of A / T; The physical location of the SNP markers is based on the IWGSC 2.1 wheat reference genome.

[0008] Furthermore, wheat varieties with the genotype TT at 90949397bp on chromosome 7B have higher thousand-grain weight and grain length than wheat varieties with the genotype AA.

[0009] According to a second aspect of the invention, a KASP primer combination for amplifying the SNP marker is provided, comprising forward primer 1 (CCCTTCGCAGCCGCGCTGCTGGA) as shown in SEQ ID NO.1, forward primer 2 (CCCTTCGCAGCCGCGCTGCTGGT) as shown in SEQ ID NO.2, and reverse primer (GCCGCCGAGCGGGGAGGGCGAGG) as shown in SEQ ID NO.3.

[0010] Furthermore, the 5' ends of forward primers 1 and 2 in the KASP primer set are connected to fluorescent tag sequences, which are used to hybridize with universal probes connected to fluorescent groups; the fluorescent groups include, but are not limited to, FAM or HEX.

[0011] In one specific embodiment of the present invention, the KASP primer combination is as follows: 90949397-F1: 5'- GAAGGTGACCAAGTTCATGCT CCCTTCGCAGCCGCGCTGCTGGA-3' (SEQ ID NO.4); Note: The underlined portion of the 5' end is the FAM fluorescent tag sequence; 90949397-F2: 5'- GAAGGTCGGAGTCAACGGATT CCCTTCGCAGCCGCGCTGCTGGT-3' (SEQ ID NO.5); Note: The underlined portion of the 5' end is the HEX fluorescent tag sequence; 90949397-R: 5'-GCCGCCGAGCGGGGAGGGCGAGG-3' (SEQ ID NO. 3).

[0012] According to a third aspect of the present invention, a detection reagent or kit containing the said KASP primer combination is provided.

[0013] Furthermore, based on a total system volume of 10 μL, the KASP amplification system comprises: 4-6 μL of KASP Master Mix (2×), 0.12-0.16 μL of primer mixture, 25-35 ng of DNA template, and the remainder being water; The primer mixture, in 100 μL, comprises: 10-14 μL of 100 μM forward primer 1, 10-14 μL of 100 μM forward primer 2, 28-32 μL of 100 μM reverse primer, with the remainder being water.

[0014] In one specific embodiment of the present invention, the KASP Master Mix (2×) is HiGeno 2× Probe Mix (2×).

[0015] Furthermore, the reaction procedure for KASP amplification is as follows: pre-denaturation at 95℃ for 8-12 min; then 8-12 falling cycles, each cycle including denaturation at 95℃ for 15-25 s and annealing at 61℃ for 60 s, with the annealing temperature decreasing by 0.5-0.7℃ in each cycle; then 32-36 cycles, each cycle including denaturation at 95℃ for 15-25 s and annealing at 55℃ for 35-45 s; finally, holding at 25℃ for 10-20 min.

[0016] According to a fourth aspect of the present invention, a method for identifying the thousand-grain weight of a plant is provided, comprising: using the DNA of a plant sample to be tested as a template, performing KASP amplification using the KASP primer combination or the detection reagent or kit, and determining the thousand-grain weight of the plant sample to be tested based on the amplification results.

[0017] Furthermore, the genotype at position 90949397bp on chromosome 7B of the plant genome is detected. If the genotype at position 90949397bp on chromosome 7B of the plant genome is TT, then the plant will have high thousand-grain weight and grain length. If the genotype at position 90949397bp on chromosome 7B of the plant genome is AA, then the plant will have low thousand-grain weight and grain length.

[0018] Furthermore, the method for detecting the genotype at 90949397 bp on chromosome 7B of the plant genome to be tested includes the following (1) or (2): (1) Direct sequencing; (2) Design primers for amplifying the SNP marker at the 90949397bp site of chromosome 7B, use the primers to amplify the genomic DNA of the plant to be tested, and perform genotyping detection on the amplified products.

[0019] Furthermore, the genotype detection at 90949397bp on chromosome 7B of the plant genome is performed using KASP technology. The KASP reaction system contains control samples with known AA, TT, and AT heterozygous genotypes. Genotype is determined by the color of the fluorescence signal: if a fluorescent signal corresponding to forward primer 1 is detected, it is determined to be the AA genotype; if a fluorescent signal corresponding to forward primer 2 is detected, it is determined to be the TT genotype; if both fluorescence signals are detected simultaneously, it is determined to be the AT heterozygous genotype; if neither fluorescence signal reaches a preset threshold, the detection is deemed invalid.

[0020] Furthermore, the plant in question is wheat.

[0021] According to a fifth aspect of the invention, any of the following applications of the SNP marker, the KASP primer combination, or the detection reagent or kit are provided: (1) Used for the identification, selection and improvement of wheat thousand-grain weight; (2) Used for early prediction of the thousand-grain weight trait of wheat; (3) Used for molecular marker-assisted breeding of wheat.

[0022] The present invention has the following advantages: This invention successfully identified a SNP locus closely related to thousand-grain weight in wheat using phenotypic differential analysis and exon capture sequencing. This SNP locus is located at 90,949,397 bp on wheat chromosome 7B, and its polymorphism is significantly associated with thousand-grain weight and grain length traits. By detecting the genotype of this locus, the thousand-grain weight and grain length characteristics of wheat can be accurately and rapidly assessed.

[0023] Based on this SNP site, this invention further provides a specific KASP primer combination. Genotyping using KASP technology offers advantages such as good genetic stability, high resolution, ease of operation, and suitability for high-throughput detection. This method can significantly improve the selection efficiency of superior genotypes, shorten the breeding cycle, and accelerate the development of high-yielding wheat varieties, thus possessing significant application value in the field of plant breeding. Attached Figure Description

[0024] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other embodiments based on the provided drawings without creative effort.

[0025] The structures, proportions, sizes, etc. illustrated in this specification are only for the purpose of assisting those skilled in the art in understanding and reading the content disclosed herein, and are not intended to limit the conditions under which the present invention can be implemented. Therefore, they have no substantial technical significance. Any modifications to the structure, changes in the proportions, or adjustments to the size, without affecting the effects and objectives that the present invention can produce, should still fall within the scope of the technical content disclosed in the present invention.

[0026] Figure 1 The exon capture sequencing technology provided in Embodiment 1 of this invention was used to analyze the results. TraesCS7B03G0211600 Exon SNP site map; Figure 2 This is a statistical chart of the thousand-grain weight trait of different genotypes at the 90949397 locus on chromosome 7B provided in Example 2 of the present invention; Figure 3 The genotyping results of wheat at the 90949397 locus on chromosome 7B provided in Example 2 of the present invention; wherein, AA represents 90949397-A, TT represents 90949397-T, and CK represents a template-free control, i.e., ultrapure water was used to replace the sample DNA; Figure 4 This is a sequencing peak diagram of different genotypes at the 90949397 locus on chromosome 7B provided in Example 2 of the present invention. Detailed Implementation

[0027] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0028] According to a first aspect of the invention, a wheat thousand-grain weight-related SNP marker is provided, the SNP marker being located at 90949397bp on wheat chromosome 7B, with a polymorphism of A / T; The physical location of the SNP markers is based on the IWGSC 2.1 wheat reference genome.

[0029] Furthermore, wheat varieties with the TT genotype at 90949397bp on chromosome 7B have higher thousand-grain weight and grain length than wheat varieties with the AA genotype.

[0030] According to a second aspect of the invention, a KASP primer combination for amplifying SNP markers is provided, comprising forward primer 1 (CCCTTCGCAGCCGCGCTGCTGGA) as shown in SEQ ID NO.1, forward primer 2 (CCCTTCGCAGCCGCGCTGCTGGT) as shown in SEQ ID NO.2, and reverse primer (GCCGCCGAGCGGGGAGGGCGAGG) as shown in SEQ ID NO.3.

[0031] Furthermore, the 5' ends of forward primers 1 and 2 in the KASP primer set are connected to fluorescent tag sequences, which are used to hybridize with universal probes connected to fluorescent groups; the fluorescent groups include, but are not limited to, FAM or HEX.

[0032] In one specific embodiment of the present invention, the KASP primer combination is as follows: 90949397-F1: 5'- GAAGGTGACCAAGTTCATGCT CCCTTCGCAGCCGCGCTGCTGGA-3' (SEQ ID NO.4); Note: The underlined portion of the 5' end is the FAM fluorescent tag sequence; 90949397-F2: 5'- GAAGGTCGGAGTCAACGGATT CCCTTCGCAGCCGCGCTGCTGGT-3' (SEQ ID NO.5); Note: The underlined portion of the 5' end is the HEX fluorescent tag sequence; Reverse primer (90949397-R): 5'-GCCGCCGAGCGGGGAGGGCGAGG-3' (SEQ ID NO. 3).

[0033] According to a third aspect of the present invention, a detection reagent or kit containing a KASP primer combination is provided.

[0034] Furthermore, based on a total system volume of 10 μL, the KASP amplification system includes: 4-6 μL of KASP Master Mix (2×), 0.12-0.16 μL of primer mixture, 25-35 ng of DNA template, and the remainder being water; The primer mixture, in 100 μL, includes: 10-14 μL of 100 μM forward primer 1, 10-14 μL of 100 μM forward primer 2, 28-32 μL of 100 μM reverse primer 2, and the remainder is water.

[0035] In one specific embodiment of the present invention, the KASP Master Mix (2×) is HiGeno2× Probe Mix (2×).

[0036] Furthermore, the reaction program used for KASP amplification is as follows: pre-denaturation at 95℃ for 8-12 min; then 8-12 falling cycles, each cycle including denaturation at 95℃ for 15-25 s and annealing at 61℃ for 60 s, with the annealing temperature decreasing by 0.5-0.7℃ in each cycle; then 32-36 cycles, each cycle including denaturation at 95℃ for 15-25 s and annealing at 55℃ for 35-45 s; finally, holding at 25℃ for 10-20 min.

[0037] According to a fourth aspect of the present invention, a method for identifying the thousand-grain weight of a plant is provided, comprising: using the DNA of a plant sample to be tested as a template, performing KASP amplification using a KASP primer combination or detection reagent or kit, and determining the thousand-grain weight of the plant sample to be tested based on the amplification results.

[0038] Furthermore, the genotype at position 90949397bp on chromosome 7B of the plant genome is detected. If the genotype at position 90949397bp on chromosome 7B of the plant genome is TT, then the plant will have high thousand-grain weight and grain length. If the genotype at position 90949397bp on chromosome 7B of the plant genome is AA, then the plant will have low thousand-grain weight and grain length.

[0039] Furthermore, methods for detecting the genotype at 90949397 bp on chromosome 7B of the plant genome to be tested include the following (1) or (2): (1) Direct sequencing; (2) Design primers for amplifying the SNP marker at 90949397bp on chromosome 7B, use the primers to amplify the genomic DNA of the plant to be tested, and perform genotyping detection on the amplified products.

[0040] Furthermore, the genotype at 90949397 bp on chromosome 7B of the plant genome was detected using the KASP technique. The KASP reaction system included control samples with known AA, TT, and AT heterozygous genotypes. Genotype was determined by the color of the fluorescence signal: if a fluorescent signal corresponding to forward primer 1 was detected, the genotype was identified as AA; if a fluorescent signal corresponding to forward primer 2 was detected, the genotype as TT was identified; if both fluorescence signals were detected simultaneously, the genotype as AT heterozygous was identified; if neither fluorescence signal reached the preset threshold, the detection was deemed invalid.

[0041] Furthermore, the plant is wheat.

[0042] According to a fifth aspect of the invention, any of the following applications of SNP markers, KASP primer combinations, or detection reagents or kits are provided: (1) Used for the identification, selection and improvement of wheat thousand-grain weight; (2) Used for early prediction of the thousand-grain weight trait of wheat; (3) Used for molecular marker-assisted breeding of wheat.

[0043] Example 1 Obtaining SNP markers associated with wheat thousand-grain weight and designing KASP primers 1. Exon capture sequencing Exon capture sequencing was performed on 171 wheat varieties (lines). The whole-exome sequencing workflow mainly includes the following four steps: (1) Sample testing: Before DNA sequencing, the quality and quantity of sample DNA are ensured by agarose gel electrophoresis and Nanodrop detection. The DNA concentration is required to be no less than 20 ng / μL and the total amount is no less than 800 ng to ensure the accuracy and repeatability of sequencing.

[0044] (2) Library construction: Genomic DNA was randomly fragmented into 180-280 bp fragments using a Covaris fragmenter. End repair, phosphorylation, and polyA tailing of the DNA were performed using an Agilent SureSelect kit. Exon regions were enriched by liquid hybridization, and biotin-labeled probes were hybridized with libraries containing specific indexes, followed by PCR amplification. The amplified libraries were quality-tested to ensure they met sequencing requirements.

[0045] (3) Library testing: After library construction, preliminary quantification was performed using Qubit 2.0, followed by insertion fragment size detection using an Agilent 2100 bioanalyzer to ensure appropriate size. After passing the test, the effective concentration of the library was accurately quantified to 3 nmol / L using Q-PCR to ensure the quality and accuracy of the sequencing library.

[0046] (4) Sequencing: After the library passes the inspection, PE150 paired-end sequencing (150bp read from each end) is performed using the Illumina HiSeq platform, based on the effective concentration of the library and the required amount of data. High-throughput sequencing is performed using the insert fragments from the small fragment library, which facilitates subsequent sequence alignment and analysis and improves the accuracy and reliability of the data.

[0047] 2. Determination of wheat thousand-grain weight phenotype and development of SNP markers To screen key genetic loci affecting thousand-grain weight in wheat, the thousand-grain weight and grain length traits of the aforementioned 171 wheat varieties were first measured to assess their phenotypic variation. This basic data collection is the first step in understanding the genetic background of thousand-grain weight. The results are shown in Table 5, laying the foundation for further gene analysis and breeding research.

[0048] Based on the thousand-grain weight phenotypic data and exon capture sequencing results of the aforementioned 171 wheat accessions, association analysis was used to identify important SNP sites affecting thousand-grain weight. SNP sites located on chromosome 7B of the wheat genome were screened. TraesCS7B03G0211600 A SNP locus in the exon region (physical location: chromosome 7B, 90949397 bp). The base variation (A / T) at this locus was significantly associated with thousand-grain weight and grain length traits: materials carrying the TT genotype exhibited higher thousand-grain weight and grain length (partial results are shown in...). Figure 1 The site was named 90949397.

[0049] 3. KASP Primer Design Based on the aforementioned SNP site sequence differences and the KASP (competitive allele-specific PCR) principle, a KASP primer combination for detecting SNP markers was designed and developed, with the specific sequences as follows: 90949397-F1: 5'- GAAGGTGACCAAGTTCATGCT CCCTTCGCAGCCGCGCTGCTGGA-3' (SEQ ID NO.4); Note: The underlined portion of the 5' end is the FAM fluorescent tag sequence; 90949397-F2: 5'- GAAGGTCGGAGTCAACGGATT CCCTTCGCAGCCGCGCTGCTGGT-3' (SEQ ID NO.5); Note: The underlined portion of the 5' end is the HEX fluorescent tag sequence; 90949397-R: 5'-GCCGCCGAGCGGGGAGGGCGAGG-3' (SEQ ID NO. 3).

[0050] Functional description of the above primer pairs: The primer pair consisting of 90949397-F1 and 90949397-R was used to specifically amplify the A allele at 90949397bp on wheat chromosome 7B. The primer pair consisting of 90949397-F2 and 90949397-R was used to specifically amplify the T allele at 90949397bp on wheat chromosome 7B.

[0051] Example 2

[0052] Application of SNP markers in determining the thousand-grain weight of wheat 1. KASP genotyping test Based on the primer combinations designed in Example 1, 171 wheat materials were subjected to KASP genotyping (154 with AA genotype and 17 with TT genotype), and the association between genotype and thousand-grain weight and grain length phenotypes was analyzed. The specific process is as follows: 1.1 Genomic DNA Extraction Genomic DNA was extracted from each wheat variety (line).

[0053] 1.2 KASP Amplification System Using the extracted DNA as a template, KASP was detected using the KASP primer combination described in Example 1 and a Quant Studio 1 real-time PCR instrument. The KASP amplification system (total volume 10 μL) is shown in Table 1 below: Table 1 KASP amplification system

[0054] Note: (1) HiGeno 2× Probe Mix (2×) contains Taq DNA polymerase, universal fluorescent reporter probe, dNTPs, buffer, MgCl2 and reference dye ROX.

[0055] (2) Primer Mix (per 100 μL) contains: 90949397-F1 (100μM) 12μL; 90949397-F2 (100μM) 12μL; 90949397-R (100μM) 30μL.

[0056] 1.3 KASP Reaction Procedure The KASP reaction procedure is shown in Table 2 below: Table 2 KASP Reaction Procedure

[0057] Note: Steps 2-3 are the KASP landing stage, where the annealing temperature is gradually reduced from 61℃ to 55℃ (61℃ - 10 × 0.6℃ = 55℃) to improve amplification specificity. Steps 4-5 are the subsequent amplification stage, where the annealing extension temperature is fixed at 55℃. After step 6, a fluorescence reader is used to read the fluorescence signal at the corresponding excitation / emission wavelengths of FAM and HEX, and the genotype is determined based on the signal color.

[0058] 2. Sequencing to validate the accuracy of KASP genotyping To verify the accuracy of the KASP genotyping results, a PCR amplification followed by sequencing method was used for comparison and verification.

[0059] 2.1 Specific primer design Specific amplification primers were designed targeting the 90949397bp position on wheat chromosome 7B (reference sequence: Chinese spring wheat), and the sequences are as follows: Primer CF (forward primer): 5'-GGACGAGCTCTTCGAGAAGGGTA-3' (SEQ ID NO.6); Primer CR (reverse primer): 5'-TTGGGGAGCGGCTCCTTGTT-3' (SEQ ID NO.7).

[0060] 2.2 Validation Sample Selection Six wheat varieties identified as having the AA genotype and six wheat varieties identified as having the TT genotype by KASP genotyping were randomly selected and subjected to PCR amplification. The PCR amplification products were then analyzed by electrophoresis and sequencing to verify the accuracy of the KASP genotyping results.

[0061] 2.3 PCR amplification system The PCR amplification system (total volume 25 μL) is shown in Table 3 below: Table 3 PCR amplification system

[0062] Note: 2×EasyTaq ® PCR Super Mix for PAGE (+dye) was purchased from TransGen Biotech.

[0063] 2.4 PCR reaction procedure The PCR reaction procedure is shown in Table 4 below: Table 4 PCR reaction procedure

[0064] 2.5 Electrophoresis detection and sequencing After electrophoresis, the PCR products were sequenced. The sequencing results were compared with the KASP genotyping results to verify the reliability of the genotyping.

[0065] The sequencing results were completely consistent with the KASP typing results, confirming the accuracy of the typing.

[0066] 3. Results Statistics The genotyping results and statistical results of wheat thousand-grain weight and grain length traits are shown in Table 5 below: Table 5. Correspondence between genotypes of different wheat varieties and their thousand-grain weight traits

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073] Note: Compared with the AA genotype, the TT genotype wheat has significantly higher thousand-grain weight and grain length. p <0.01).

[0074] From Table 5 above and Figures 2 to 4 It can be seen that there are significant differences in the thousand-grain weight and grain length among different wheat genotypes. Specifically: 1000-grain weight: The average 1000-grain weight of AA genotype wheat was 40.86g, and that of TT genotype wheat was 46.12g. Compared with the AA genotype, the TT genotype wheat had a significantly higher 1000-grain weight, with an increase of 12.87%.

[0075] Grain length: The average grain length of AA genotype wheat is 6.71 mm, and the average grain length of TT genotype wheat is 8.54 mm. Compared with AA genotype, TT genotype wheat has a significantly increased grain length, with an increase of 27.27%.

[0076] This invention utilizes carefully designed KASP primers to detect the SNP locus at 90949397 bp on wheat chromosome 7B, enabling accurate and efficient determination of thousand-grain weight and grain length traits in wheat. This technology not only provides reliable genotypic information for marker-assisted breeding but can also be used for rapid screening of wheat varieties with superior thousand-grain weight traits. Furthermore, this invention provides crucial theoretical support and technical tools for breeding high-yielding wheat varieties, and has significant application value in promoting crop genetic improvement and increasing wheat yield.

[0077] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. The application of SNP markers in the identification of thousand-grain weight of wheat, characterized in that, The SNP marker is located at 90949397 bp on wheat chromosome 7B, and the polymorphism is A / T; The physical locations of the SNP markers are based on the IWGSC 2.1 wheat reference genome; Using the DNA of the wheat sample to be tested as a template, KASP amplification was performed using a combination of KASP primers or a detection reagent or kit containing the KASP primers, and the thousand-grain weight of the wheat sample to be tested was determined based on the amplification results. The wheat varieties with the genotype TT at 90949397bp on chromosome 7B had higher thousand-grain weight and grain length than the wheat varieties with the genotype AA. The KASP primer combination used to amplify the SNP marker includes forward primer 1 as shown in SEQ ID NO.1, forward primer 2 as shown in SEQ ID NO.2, and reverse primer as shown in SEQ ID NO.

3.

2. A reagent kit for identifying the thousand-grain weight trait of wheat, characterized in that, It includes the KASP primer combination described in the use of claim 1.

3. A method for determining the thousand-grain weight of wheat, characterized in that, Using the wheat thousand-grain weight trait identification kit as described in claim 2: using the DNA of the wheat sample to be tested as a template, the identification kit is used to detect the genotype at position 90949397bp on chromosome 7B of the wheat genome. If the genotype at position 90949397bp on chromosome 7B of the wheat genome is TT, then it is high in thousand-grain weight and grain length; if the genotype at position 90949397bp on chromosome 7B of the wheat genome is AA, then it is low in thousand-grain weight and grain length.

4. The method according to claim 3, characterized in that, Methods for detecting the genotype at 90949397 bp on chromosome 7B in the wheat genome include the following (1) or (2): (1) Direct sequencing; (2) Design primers for amplifying the SNP marker at the 90949397bp site of chromosome 7B, use the primers to amplify the wheat genomic DNA to be tested, and perform genotyping detection on the amplified products.

5. The method according to claim 4, characterized in that, The genotype at 90949397bp on chromosome 7B of the wheat genome was detected using the KASP technique. The KASP reaction system contained control samples with known AA, TT, and AT heterozygous genotypes. Genotype was determined by the color of the fluorescence signal: if a fluorescent signal corresponding to forward primer 1 was detected, the genotype was identified as AA; if a fluorescent signal corresponding to forward primer 2 was detected, the genotype was identified as TT; if both fluorescence signals were detected simultaneously, the genotype was identified as AT heterozygous; if neither fluorescence signal reached a preset threshold, the detection was deemed invalid.

6. The application of the KASP primer combination as described in claim 1, or an identification kit containing the KASP primer combination, characterized in that, The KASP primer combination was used to detect the genotype at 90949397bp on wheat chromosome 7B. Wheat varieties with the genotype TT at 90949397bp on wheat chromosome 7B had higher thousand-grain weight and grain length than wheat varieties with the genotype AA. The application is selected from any of the following: (1) Used for the identification, selection and improvement of wheat thousand-grain weight; (2) Used for early prediction of the thousand-grain weight trait of wheat; (3) Used for molecular marker-assisted breeding of wheat.

Images