Rhizopus arrhizus lamp specific detection primer set, rapid detection method and application

CN122382254BActive Publication Date: 2026-08-21BEIJING FORESTRY UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610877826.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-06-17
Publication Date
2026-08-21
Estimated Expiration
2046-06-17

AI Technical Summary

Technical Problem

然而,目前无针对少根根霉的LAMP特异性检测体系,现有检测技术均存在特异性不足、灵敏度偏低、依赖高成本专用设备、检测耗时长、现场适用性差的问题,难以满足农业生产中少根根霉简便、快速、精准检测的实际需求

Benefits of technology

[0014]The beneficial effects of this invention are as follows: The LAMP-specific detection primer set for Rhizopus oligospermia of this invention can specifically detect Rhizopus oligospermia and shows no cross-reactivity with common plant pathogens such as Aspergillus flavus, Aspergillus lanceolata, Trichoderma echinosporum, Penicillium augerii, Mucor truncatula, and Alternaria alternata; the method of this invention does not require complex and expensive instruments, only a simple isothermal device is needed to complete the amplification, and the results can be directly interpreted by visually observing the color change using a specific dye after amplification, without the need for complex subsequent operations such as gel electrophoresis, and has low requirements for the operator's technical level, making it suitable for rapid detection under simple on-site conditions; the entire isothermal amplification process of this invention only takes 50 minutes, and with result interpretation, the total time is only 1 hour, which is much faster than the traditional morphological identification combined with conventional PCR detection method, meeting the needs of rapid and specific on-site detection; during the operation, DNA can be directly extracted from pure bacteria, mixed samples, or plant pathogen tissue samples for detection, which can accurately detect plant samples infected with Rhizopus oligospermia in production practice, and is suitable for the detection of specific bacteria in pathogenic fungal infections in production sites, with strong practicality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122382254B_ABST
    Figure CN122382254B_ABST
Patent Text Reader

Abstract

A Rhizopus arrhizus LAMP specific detection primer group, a rapid detection method and application are disclosed.The Rhizopus arrhizus LAMP specific detection primer group is composed of one pair of outer primers F3 / B3 and one pair of inner primers FIP / BIP, the nucleotide sequence of the outer primer F3 is shown as SEQ ID NO.1, the nucleotide sequence of the outer primer B3 is shown as SEQ ID NO.2, the nucleotide sequence of the inner primer FIP is shown as SEQ ID NO.3, and the nucleotide sequence of the inner primer BIP is shown as SEQ ID NO.4.The rapid detection method for detecting Rhizopus arrhizus by using the Rhizopus arrhizus LAMP specific detection primer group comprises the following steps: a, extracting DNA of a sample to be detected; b, configuring a LAMP reaction system; c, LAMP reaction; and d, determining the result by using a fluorescent dye visual observation method.The Rhizopus arrhizus can be detected simply, rapidly and accurately.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial detection technology, specifically relating to a primer set for LAMP-specific detection of Rhizopus oligosporus, a rapid detection method, and its application. Background Technology

[0002] Rhizopus septemlobus ( Rhizopus arrhizus *Ichthyophthirius multifiliis* is a pathogenic fungus widely distributed in soil, air, various crops, stored agricultural products, fermentation substrates, and the production of sprouts in plant factories. It possesses both pathogenicity and mold hazard. This fungus easily infects crops such as fruits, vegetables, wheat, and corn, causing fruit and vegetable rot, seedling mold, and grain mold. This results in plant diseases, reduced yields, and lower quality of agricultural products, leading to serious agricultural economic losses. It also threatens food processing and consumption safety, making it one of the key pathogenic fungi requiring prevention and control in agricultural planting, agricultural product storage, and especially in the production of sprouts in plant factories.

[0003] Currently, Rhizopus septemlobus detection technologies are mainly divided into two categories: traditional morphological identification and molecular biological detection. Routine identification of Rhizopus septemlobus relies on morphological observation combined with ITS rDNA sequence analysis. This technique requires multiple steps, including strain isolation, purification culture, and microscopic morphological observation. It is cumbersome, with a detection cycle of 3-7 days, and demands a high level of expertise in fungal taxonomy from the testing personnel. ITS sequence analysis requires a PCR instrument, and the sequencing analysis process has high technical requirements and a long timeframe. Furthermore, it is prone to false positives or false negatives due to differences in strain culture conditions and morphological variations, making it difficult to meet the timeliness and convenience requirements for rapid on-site testing of agricultural products and in plant factories.

[0004] In molecular biology detection techniques, besides conventional PCR, the emerging real-time recombinase polymerase amplification (RPA) technology is used for the detection of Rhizopus oligorhizoides, with a sensitivity of up to 18.58 copies and specificity and sensitivity both exceeding 95%. Multiplex quantitative PCR (qPCR) can detect Rhizopus oligorhizoides in clinical samples with high specificity, reaching 100%. However, these technologies still rely on specialized equipment and complex operating procedures, making rapid on-site detection impossible. MALDI-TOF MS proteomic analysis technology can achieve rapid identification of Rhizopus oligorhizoides by establishing a protein fingerprint database of strains, but its equipment cost is extremely high (in the millions), limiting its application to large central laboratories and hindering its widespread adoption at the grassroots level.

[0005] Loop-mediated isothermal amplification (LAMP) is a novel nucleic acid isothermal amplification technique that utilizes 4 to 6 specific primers to precisely identify 6 to 8 specific regions of a target gene. Under the action of Bst DNA polymerase with strand displacement activity, nucleic acid amplification is performed at a constant temperature of 60-65℃. During the reaction, DNA synthesis is first initiated by the inner primer (FIP / BIP), followed by the formation of single-stranded DNA with a stem-loop structure through a strand displacement reaction using the outer primer (F3 / B3). This product continues to serve as the amplification template, undergoing self-guided extension under the action of primers and strand displacement reactions, gradually generating dumbbell-shaped and multi-circular amplification products. The entire process relies on cyclic strand displacement reactions to achieve exponential amplification, typically completed in 30-60 minutes. Results can be directly interpreted by observing reaction turbidity, SYBR Green I fluorescence, and visual color changes. Since its introduction in 2000, LAMP has been widely used in the field of pathogen detection due to its advantages such as isothermal amplification, no need for sophisticated thermal cycling equipment, high amplification efficiency, and visualized results. However, there is currently no LAMP-specific detection system for Rhizopus septemlobus. Existing detection technologies all suffer from insufficient specificity, low sensitivity, reliance on high-cost specialized equipment, long detection time, and poor field applicability, making it difficult to meet the actual needs of simple, rapid, and accurate detection of Rhizopus septemlobus in agricultural production. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the existing technology and provide a LAMP-specific detection primer set, rapid detection method and application for Rhizopus oligospermiae, so as to meet the needs of simple, rapid and accurate detection of Rhizopus oligospermiae in agricultural production and provide rapid diagnostic technology for pathogen prediction, forecasting and control.

[0007] The objective of this invention is achieved through the following technical solution: a primer set for LAMP-specific detection of Rhizopus oligosporus, the primer set consisting of one pair of outer primers F3 / B3 and one pair of inner primers FIP / BIP, wherein the nucleotide sequence of the outer primer F3 is shown in SEQ ID NO.1, the nucleotide sequence of the outer primer B3 is shown in SEQ ID NO.2, the nucleotide sequence of the inner primer FIP is shown in SEQ ID NO.3, and the nucleotide sequence of the inner primer BIP is shown in SEQ ID NO.4.

[0008] This invention also provides a rapid detection method for Rhizopus oligosporus using the aforementioned Rhizopus oligosporus LAMP-specific detection primer set, comprising the following steps: a. Extract DNA from the sample to be tested; b. Configure a LAMP reaction system containing the aforementioned Rhizopus spp. LAMP-specific detection primer set, wherein the amounts of outer primer F3 and outer primer B3 are added, and the amounts of inner primer FIP and inner primer BIP are added, and the ratio of the total amount of outer primer F3 / B3 to the total amount of inner primer FIP / BIP is 1:8. c. LAMP reaction; d. Results were determined using the visual observation method with fluorescent dyes.

[0009] Furthermore, the mass concentration of the DNA in the sample to be tested is 100 fg / μL-1 ng / μL.

[0010] Furthermore, the LAMP reaction system includes 2.5 μL of 10×Bst reaction buffer containing 2 mmol / L MgSO4, 3.5 μL of 10 mmol / L dNTP Mix, 1 μL of Bst DNA polymerase, 1 μL of DNA template, 0.5 μL each of 10 μmol / L outer primer F3 / B3 solution, 4 μL each of 10 μmol / L inner primer FIP / BIP solution, and sterile water. The sterile water is added to make the total volume of the LAMP reaction system 25 μL.

[0011] Furthermore, the LAMP reaction includes the following steps: after thoroughly mixing the LAMP reaction system in the reaction tube, the reaction tube is placed in a constant temperature device and reacted at 65°C for 50 min, followed by a reaction at 80°C for 10 min to terminate the amplification.

[0012] Furthermore, the visual observation method for fluorescent dyes includes the following steps: 2 μL of 1000×SYBR GreenⅠ fluorescent dye solution is added to the inner wall of the PCR reaction tube cap. After terminating the amplification, the SYBR GreenⅠ fluorescent dye solution on the tube cap is shaken into the reaction solution and thoroughly mixed. The color change of the reaction solution is observed, and the results are interpreted: green indicates a positive result, indicating the detection of Rhizopus oryzae; orange-yellow indicates a negative result, indicating the absence of Rhizopus oryzae.

[0013] This invention also provides the application of the aforementioned Rhizopus oligospermia LAMP-specific detection primer set in the detection of Rhizopus oligospermia. The extracted DNA from the test sample is used as a template, and a LAMP reaction is performed in the LAMP reaction system. The results are then determined by visual observation using a fluorescent dye. The LAMP reaction system contains the aforementioned Rhizopus oligospermia LAMP-specific detection primer set, wherein outer primers F3 and B3 are added in equal amounts, and inner primers FIP and BIP are added in equal amounts. The ratio of the total amount of outer primer F3 / B3 to the total amount of inner primer FIP / BIP is 1:8.

[0014] The beneficial effects of this invention are as follows: The LAMP-specific detection primer set for Rhizopus oligospermia of this invention can specifically detect Rhizopus oligospermia and shows no cross-reactivity with common plant pathogens such as Aspergillus flavus, Aspergillus lanceolata, Trichoderma echinosporum, Penicillium augerii, Mucor truncatula, and Alternaria alternata; the method of this invention does not require complex and expensive instruments, only a simple isothermal device is needed to complete the amplification, and the results can be directly interpreted by visually observing the color change using a specific dye after amplification, without the need for complex subsequent operations such as gel electrophoresis, and has low requirements for the operator's technical level, making it suitable for rapid detection under simple on-site conditions; the entire isothermal amplification process of this invention only takes 50 minutes, and with result interpretation, the total time is only 1 hour, which is much faster than the traditional morphological identification combined with conventional PCR detection method, meeting the needs of rapid and specific on-site detection; during the operation, DNA can be directly extracted from pure bacteria, mixed samples, or plant pathogen tissue samples for detection, which can accurately detect plant samples infected with Rhizopus oligospermia in production practice, and is suitable for the detection of specific bacteria in pathogenic fungal infections in production sites, with strong practicality. Attached Figure Description

[0015] Figure 1 It is a ML phylogenetic tree of the genus Rhizopus based on ITS sequences; Figure 2 These are the results of the primer matching and screening experiment of Rhizopus oligospermia LAMP system; in each group of two tubes, the left side is a sterile ddH2O negative control, and the right side is added with Rhizopus oligospermia genomic DNA template. Figure 3 These are the specific detection results between species and genera in the Rhizopus oligosporus LAMP system; among them, Aspergillus flavus was found in reaction tube 1, Rhizopus oligosporus in reaction tube 2, Aspergillus lanceolata in reaction tube 3, Trichoderma acicularis in reaction tube 4, Penicillium aubergine in reaction tube 5, Mucor truncatula in reaction tube 6, and Alternaria alternata in reaction tube 7. Figure 4 These are the specific detection results of similar species and different strains of Rhizopus oligosporus in the LAMP system; among them, reaction tube 1 contains ddH2O negative control, reaction tube 2 contains Rhizopus oligosporus YC-3, reaction tube 3 contains Rhizopus oligosporus G-1, reaction tube 4 contains Rhizopus oligosporus Ra, and reaction tube 5 contains Rhizopus microsporus (Rm). Figure 5 This presents the LAMP detection sensitivity results of the *Rhizopus oligosporus* LAMP system for different concentrations of *Rhizopus oligosporus* template DNA; wherein, reaction tube 1 contains 1 ng / μL DNA dilution, reaction tube 2 contains 100 pg / μL DNA dilution, reaction tube 3 contains 10 pg / μL DNA dilution, reaction tube 4 contains 1 pg / μL DNA dilution, reaction tube 5 contains 100 fg / μL DNA dilution, reaction tube 6 contains 10 fg / μL DNA dilution, and reaction tube 7 contains 1 fg / μL DNA dilution. Figure 6 These are the results of the LAMP system reaction stability of Rhizopus oligosporus; among them, reaction tube 1 contains ddH2O as a negative control, and reaction tubes 2-7 contain Rhizopus oligosporus YC-3; Figure 7 These are the results of the specificity and sensitivity verification of the Rhizopus oligosporus LAMP system in mixed samples; among them, reaction tube 1 contains mixed DNA of Rhizopus oligosporus, Aspergillus lanceolata, Mucor truncatula, and Alternaria alternata; reaction tube 2 contains mixed DNA of Aspergillus lanceolata, Mucor truncatula, and Alternaria alternata; and reaction tube 3 contains ddH2O negative control. Figure 8 Images of wheat sprouts infected with Rhizopus oligosporus; where A shows the morphology of the pathogen in the original wheat sprout production; and B shows the disease state of wheat sprouts inoculated with Rhizopus oligosporus to verify the pathogen's disease status. Figure 9 This is a practical example of the LAMP system reaction of Rhizopus septemlobus; reaction tube 1 contains a mixed sample of plants infected with Rhizopus septemlobus, reaction tube 2 contains a sample of plants without pathogen contamination, and reaction tube 3 contains a ddH2O negative control. Detailed Implementation

[0016] The present invention will now be described in detail with reference to the accompanying drawings.

[0017] All pathogenic fungi involved in this invention are publicly shared in the catalog of the China General Microbiological Culture Collection Center (see Table 1), and can be obtained by those skilled in the art through formal application.

[0018] Table 1 Information on pathogenic fungi YC-3 Rhizopus septum CGMCC 3.5849 China General Microbiological Culture Collection Center G-1 Rhizopus septum CGMCC 3.6969 China General Microbiological Culture Collection Center Ra Rhizopus septum CGMCC 3.9497 China General Microbiological Culture Collection Center Rm Microsporum CGMCC 3.934 China General Microbiological Culture Collection Center YC-1 Aspergillus flavus CGMCC 3.11842 China General Microbiological Culture Collection Center YC-4 Aspergillus lanceolata CGMCC 3.6890 China General Microbiological Culture Collection Center YC-7 Golden Penicillium CGMCC 3.11263 China General Microbiological Culture Collection Center YC-6 Trichoderma acicularis CGMCC 3.17461 China General Microbiological Culture Collection Center YC-24 Mucor CGMCC 3.7107 China General Microbiological Culture Collection Center LG Alternaria CGMCC 3.13752 China General Microbiological Culture Collection Center Example 1: Primer screening, reaction system establishment, and reaction condition optimization for LAMP detection of Rhizopus septemlobus. 1. Obtaining Rhizopus spp. and template DNA: Three Rhizopus oligosporus strains, YC-3, G-1, and Ra, were selected. DNA was extracted using the omega fungal DNA extraction kit. PCR amplification of the pathogen DNA was performed using ITS universal primers ITS1 and ITS4. The PCR products were sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing. The sequencing sequences were compared with the NCBI database, and a phylogenetic tree was constructed. After verification, it was confirmed that all three strains were Rhizopus oligosporus (see [link to relevant documentation]). Figure 1 ), to obtain a DNA template.

[0019] 2. LAMP detection primer design: Based on the ITS gene sequence of *Rhizopus oligosporus*, sequence alignment was performed using DNAMAN to screen for gene fragments with low homology to other pathogenic fungi as LAMP target sequences. LAMP primers were designed using Primer Explorer V5 online software. After screening and comparing multiple sets of primers, the following two pairs of primers were finally selected, with the specific sequences as follows: Outer primer F3 (forward): AATTTGGCTGAGAGACTCA(SEQ ID NO.1); Outer primer B3 (reverse): CTAGCAAGCCAGACAGAA(SEQ ID NO.2); Internal primer FIP (forward): GGTACTCCTGAAACCAGGAGTGGACTGGTCATGGGTAGAC (SEQ ID NO. 3); Inner primer BIP (reverse): AAATTTGTTTATGTGGTGATGGGTCACACATTTTAGGTGCTCAC (SEQ ID NO. 4).

[0020] 3. Establishment of the reaction system: The LAMP reaction system for *Rhizopus oligosporus* was established by first preparing an initial LAMP reaction system (25 μL) containing 2.5 μL of 10×Bst reaction buffer (containing 2 mmol / L MgSO4), 3.5 μL of 10 mmol / L dNTP Mix, 1 μL of Bst DNA polymerase, and 1 μL of DNA template. Gradient optimization was then performed using ratios of 1:2, 1:4, and 1:8 between the total amount of outer primer F3 / B3 and the total amount of inner primer FIP / BIP. In these cases, equal amounts of outer primer F3 and B3, and equal amounts of inner primer FIP and BIP, were added. The system was then brought to a final volume of 25 μL with sterile water. Sterile ddH2O was used as a blank (negative control). The results showed that *Rhizopus oligosporus* only reacted when the ratio of the total amount of outer primer F3 / B3 to the total amount of inner primer FIP / BIP was 1:8 (see [link to relevant documentation]). Figure 2 The reaction solution in the tube on the right turns green. The reaction process and conditions are described in "4. LAMP Reaction Conditions". The optimal components and amounts of the LAMP reaction system are shown in Table 2.

[0021] Table 2 LAMP reaction system

[0022] 4. LAMP reaction conditions: After thoroughly mixing the LAMP reaction system in the reaction tube, add 2 μL of 1000×SYBR Green I fluorescent dye to the inner wall of the PCR reaction tube cap to avoid premature contact between the dye and the reaction system, which could affect amplification. Place the reaction tube in a metal bath of a constant temperature device and react at 65℃ for 50 min. After the reaction is complete, stop the amplification by reacting at 80℃ for 10 min, and then shake the SYBR Green I fluorescent dye on the tube cap into the reaction solution and mix thoroughly. Observe the color change of the reaction solution and interpret the results: green indicates a positive result (Rhizopus spp. was detected), and orange-yellow indicates a negative result (Rhizopus spp. was not detected).

[0023] The LAMP reaction system and the LAMP reaction conditions described in Table 2 were used to conduct the verification experiment in Example 2.

[0024] Example 2 Verification Experiment 1. Specificity verification: The specificity of the LAMP reaction system for *Rhizopus oligosporus* was validated both between species and genera. Using DNA from seven pathogenic fungi (*Aspergillus flavus*, *Rhizopus oligosporus*, *Aspergillus lanceolata*, *Penicillium aureum*, *Trichoderma echinosporum*, *Mucor*, and *Alternaria* as templates, LAMP amplification was performed in reaction tubes 1-7 to determine the specificity of the designed *Rhizopus oligosporus* LAMP specificity detection primer set between genera. The results showed that only *Rhizopus oligosporus* samples showed green positive results (see Table 1). Figure 3 The results in reaction tube 2 were all orange negative, indicating that the primer set for the LAMP-specific detection of Rhizopus septemlobus has good specificity.

[0025] Using DNA from different strains of *Rhizopus oligorhizoides* YC-3, G-1, Ra, and *Microsporum* (see Table 1) as templates, LAMP reactions were performed on reaction tubes 2-5, with ddH2O added to reaction tube 1 as a negative control. This was to determine the specificity of the designed *Rhizopus oligorhizoides* LAMP-specific detection primer set within the genus and among different strains. Results showed that only *Rhizopus oligorhizoides* samples showed green positive results (see Table 1). Figure 4 The results in reaction tubes 2-4 were all orange negative, indicating that the primer set for the LAMP-specific detection of Rhizopus septemlobus has good specificity.

[0026] 2. Sensitivity verification: DNA from *Rhizopus oligosporus* was diluted to concentrations of 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, and 1 fg / μL. These different concentrations of DNA were used as templates for LAMP reactions in reaction tubes 1-7 to determine the sensitivity of LAMP. Results showed that at DNA concentrations below 10 fg / μL (see... Figure 5 When the DNA concentration is above 100 fg / μL (in reaction tube #6), the reaction solution remains orange and does not change color, indicating a negative result. When the DNA concentration is above 100 fg / μL, the reaction solution turns green, indicating that the minimum DNA concentration in this LAMP reaction system is 100 fg / μL, demonstrating high sensitivity.

[0027] 3. Repeatability and stability verification: To verify the reaction stability of the *Rhizopus oligospermum* LAMP system, *Rhizopus oligospermum* YC-3 DNA was subjected to LAMP reactions in reaction tubes 2-7, while ddH2O was added to reaction tube 1 for LAMP reactions (negative control). The results showed that all *Rhizopus oligospermum* samples reacted normally, indicating that the designed *Rhizopus oligospermum* LAMP system has high reproducibility and stability (see [link to relevant documentation]). Figure 6 (Reaction tubes 2-7 in the middle).

[0028] 4. Validation of the specificity and sensitivity of Rhizopus spp. in mixed samples: DNA from *Rhizopus septemlobus* was mixed with that of three pathogens: *Aspergillus lanceolata*, *Mucor spp.*, and *Alternaria alternata* (details in Table 1) and used as a template. This mixed DNA template was used for LAMP reaction in reaction tube 1. DNA from the same three pathogens was also mixed and used as a template in reaction tube 2. ddH₂O was added to reaction tube 3 as a negative control for LAMP reaction. Results showed that the *Rhizopus septemlobus* LAMP system was effective in mixed samples containing *Rhizopus septemlobus* (see Table 1). Figure 7 It showed a green positive result in the No. 1 reaction tube and an orange negative result in the mixed sample that did not contain Rhizopus spp. (see [link to reaction tube]). Figure 7 The specificity and sensitivity of the sample were further verified in reaction tubes 2 and 3.

[0029] 5. Verification through production practice: In wheatgrass sprout production in plant factories, Rhizopus oligosporus is one of the dominant pathogens causing mold and mildew diseases. Once infected (naturally or artificially), the fungus spreads very rapidly, typically covering the base of the sprouts within 2-4 days, severely impacting sprout growth and yield (see [link]). Figure 8 To quickly and easily detect this bacterium, the following testing and verification were performed.

[0030] Sterile toothpicks were used to collect rhizosphere tissue samples from wheatgrass seeds infected with Rhizopus spp. spp. spp. root samples without mold contamination. DNA was extracted from each sample using a fungal DNA extraction kit (EZNA® Fungal DNA Kit, D3390-01, Omega Bio-Tek) as templates. The DNA template from the rhizosphere tissue of the wheatgrass seeds infected with Rhizopus spp. spp. spp. spp. spp. spp. root samples without mold contamination were placed in reaction tube 1, and the DNA template from the root samples without mold contamination was placed in reaction tube 2. Sterile water was placed in reaction tube 3 as a control. LAMP amplification was then performed. The results showed that only wheatgrass seeds and root samples infected with Rhizopus spp. spp. (see...) Figure 9 The reaction solution in reaction tube 1 was green and positive, while the uncontaminated wheat sprout root sample and the blank control were orange and negative (see reaction tube 1). Figure 9 The results of reaction tubes 2 and 3 in this invention demonstrate that the LAMP detection method for Rhizopus septemlobus established in this invention can be directly applied to agricultural production practices and has good feasibility and accuracy in detecting actual plant disease pathogen samples.

[0031] The above experimental results show that the method of the present invention has high specificity, sensitivity and stability, is easy to operate, and is fast in detection. It does not require expensive equipment and does not require a high level of professional expertise from operators. General technicians can complete the detection operation process. It is suitable for rapid on-site detection and identification of suspected Rhizopus spp. contaminated samples in simple production processes.

[0032] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A primer set for LAMP-specific detection of Rhizopus septemlobus, characterized in that: The primer set consists of one pair of outer primers F3 / B3 and one pair of inner primers FIP / BIP. The nucleotide sequence of the outer primer F3 is shown in SEQ ID NO.1, the nucleotide sequence of the outer primer B3 is shown in SEQ ID NO.2, the nucleotide sequence of the inner primer FIP is shown in SEQ ID NO.3, and the nucleotide sequence of the inner primer BIP is shown in SEQ ID NO.

4.

2. A rapid detection method for Rhizopus oligospermia using the LAMP-specific detection primer set of claim 1, characterized in that... Includes the following steps: a. Extract DNA from the sample to be tested; b. Configure a LAMP reaction system containing the aforementioned Rhizopus spp. LAMP-specific detection primer set, wherein the amounts of outer primer F3 and outer primer B3 are added, and the amounts of inner primer FIP and inner primer BIP are added, and the ratio of the total amount of outer primer F3 / B3 to the total amount of inner primer FIP / BIP is 1:

8. c. LAMP reaction; d. Results determined by visual observation using fluorescent dyes; The mass concentration of the DNA in the sample to be tested was 100 fg / μL-1 ng / μL.

3. The rapid detection method according to claim 2, characterized in that: The LAMP reaction system comprises 2.5 μL of 10×Bst reaction buffer containing 2 mmol / L MgSO4, 3.5 μL of 10 mmol / L dNTP Mix, 1 μL of Bst DNA polymerase, 1 μL of DNA template, 0.5 μL each of 10 μmol / L outer primer F3 / B3 solution, 4 μL each of 10 μmol / L inner primer FIP / BIP solution, and sterile water. The sterile water is added to make the total volume of the LAMP reaction system 25 μL.

4. The rapid detection method according to claim 2, characterized in that: The LAMP reaction includes the following steps: after thoroughly mixing the LAMP reaction system in the reaction tube, the reaction tube is placed in a constant temperature device and reacted at 65°C for 50 min, followed by a reaction at 80°C for 10 min to terminate the amplification.

5. The rapid detection method according to claim 2, characterized in that: The visual observation method for fluorescent dyes includes the following steps: 2 μL of 1000×SYBR GreenⅠ fluorescent dye solution is dropped onto the inner wall of the PCR reaction tube cap. After terminating the amplification, the SYBR GreenⅠ fluorescent dye solution on the tube cap is shaken into the reaction solution and thoroughly mixed. The color change of the reaction solution is observed, and the results are interpreted: green indicates a positive result, indicating the detection of Rhizopus oryzae; orange-yellow indicates a negative result, indicating the absence of Rhizopus oryzae.

6. The application of the LAMP-specific detection primer set for Rhizopus oligospermia as described in claim 1 in the detection of Rhizopus oligospermia, characterized in that: The extracted DNA from the test sample was used as a template to perform a LAMP reaction in the LAMP reaction system, and the results were then determined by visual observation using a fluorescent dye method. The LAMP reaction system contained the Rhizopus spp. LAMP-specific detection primer set, in which the amounts of outer primer F3 and outer primer B3, and the amounts of inner primer FIP and inner primer BIP, were added. The ratio of the total amount of outer primer F3 / B3 to the total amount of inner primer FIP / BIP was 1:8.

Citation Information

Patent Citations

  • LAMP primers for detecting Lasiodiplodia gonubiensis and kit

    CN111020055A

  • LAMP (loop-mediated isothermal amplification) primer group, kit and detection method for detecting pathogenic bacteria of oat smut

    CN121137253A