Aspergillus clavatus lamp specific detection primer set, rapid detection method and application
By designing a LAMP-specific detection primer set for Aspergillus lanceolata and a simple constant temperature device, combined with the visual inspection method using fluorescent dyes, the problem of rapid and convenient detection of Aspergillus lanceolata at the species level was solved, realizing efficient and accurate detection of Aspergillus lanceolata in agricultural production.
Patent Information
- Application Number
- CN202610878787.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-17
- Publication Date
- 2026-07-14
AI Technical Summary
Existing technologies cannot achieve species-specific detection of Aspergillus oryzae, and traditional methods are cumbersome, time-consuming, and costly, failing to meet the needs for rapid and convenient detection in agricultural production.
A primer set for the LAMP-specific detection of Aspergillus lanceolata was designed, including one pair of outer primers F3/B3, one pair of inner primers FIP/BIP, and one pair of loop primers LB/LF. Combined with a simple isothermal device and visual inspection with fluorescent dyes, rapid and specific detection can be achieved.
It enables rapid and accurate detection of Aspergillus oryzae with high specificity and simple operation, making it suitable for agricultural production sites. The detection time is only 50 minutes, reducing the requirements for equipment and professional knowledge.
Smart Images

Figure CN122382255A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial detection technology, specifically relating to a primer set for the LAMP-specific detection of Aspergillus niger, a rapid detection method, and its application. Background Technology
[0002] Aspergillus lanceolata ( Aspergillus clavatus Aspergillus is a typical plant pathogenic fungus of the genus Aspergillus, which widely parasitizes crops such as wheat and corn as well as stored grains. Its infection and the production of its metabolites not only cause agricultural products to become moldy and rotten, reducing the quality of grains, but also cause serious economic losses to agricultural production. At the same time, it threatens food processing and food safety, and is one of the key pathogenic fungi to be controlled in the agricultural field.
[0003] Currently, detection techniques for Aspergillus fungi are mainly divided into two categories: traditional morphological identification and molecular biological detection. Among them, the identification of Aspergillus lanceolata still mainly relies on morphological observation combined with ITS rDNA sequence analysis. This identification method requires steps such as strain isolation, culture, and microscopic morphological observation, which is cumbersome, has a detection cycle of 3-7 days, and requires a high level of expertise in fungal taxonomy from the operators. Furthermore, it is prone to false positive or false negative results due to morphological variations in strains, making it difficult to meet the timeliness and convenience requirements of rapid on-site detection in agricultural products and plant factories.
[0004] In molecular biology detection technologies, PCR detection techniques have been applied to the detection of Aspergillus fungi. Conventional PCR can achieve a detection limit of pg-level nucleic acid, but it requires PCR amplification and gel electrophoresis for subsequent verification, which takes a long time. Although qPCR can improve the detection limit to the fg level, it relies on expensive real-time PCR instruments and matching reagents, resulting in high equipment costs and complex operation procedures. It is only suitable for professional laboratory testing and cannot be promoted in grassroots fields such as plant factories and warehouses.
[0005] Loop-mediated isothermal amplification (LAMP), a novel nucleic acid isothermal amplification technique, has been widely used in the field of pathogen detection since its introduction in 2000 due to its advantages such as requiring only isothermal amplification, eliminating the need for sophisticated thermal cycling equipment, high amplification efficiency, and visualized results. Existing technologies include universal LAMP primers for toxin-producing fungi of the genus *Aspergillus* (e.g., Chinese invention patent application "A universal LAMP primer for detecting toxin-producing fungi of the genus *Aspergillus* and a kit containing the primer," application publication number CN105648038A; Chinese invention patent "Rapid detection method for loop-mediated isothermal amplification of patulin-producing fungi," authorization announcement number CN101381773B), which can achieve the prevention and detection of contamination by toxin-producing fungi of the genus *Aspergillus* such as *Aspergillus flavus* and *Aspergillus fumigatus*, as well as the universal detection of related patulin-producing fungi. However, these methods can only perform genus-level identification of *Aspergillus* and detection of patulin-producing fungi, and cannot achieve species-level specific detection and identification of *Aspergillus patulinus*.
[0006] In recent years, LAMP detection technology has made significant progress in primer design optimization, reaction system improvement, and on-site detection adaptability. By targeting species-specific conserved genes, adding loop primers, and optimizing primer ratios, the specificity and sensitivity of LAMP detection can be effectively improved. Furthermore, combined with simple temperature control equipment such as metal baths and constant-temperature water baths, the detection process can be made on-site and portable. While LAMP kits for Aspergillus ochraceus and Aspergillus fumigatus are available, there are currently no LAMP-specific primers or rapid detection methods for Aspergillus lanceolata. There is an urgent need for a LAMP-specific primer set and rapid detection method for Aspergillus lanceolata to meet the practical needs of rapid, accurate, and convenient detection of Aspergillus lanceolata in agricultural production. Summary of the Invention
[0007] The purpose of this invention is to overcome the shortcomings of the existing technology and provide a primer set for the LAMP-specific detection of Aspergillus lanceolata, a rapid detection method and its application, so as to meet the actual needs of rapid, accurate and simple detection of Aspergillus lanceolata in agricultural production.
[0008] The objective of this invention is achieved through the following technical solution: a primer set for the specific detection of Aspergillus oryzae LAMP, comprising one pair of outer primers F3 / B3, one pair of inner primers FIP / BIP, and one pair of circular primers LB / LF. The nucleotide sequence of the outer primer F3 is shown in SEQ ID NO.1, the nucleotide sequence of the outer primer B3 is shown in SEQ ID NO.2, the nucleotide sequence of the inner primer FIP is shown in SEQ ID NO.3, the nucleotide sequence of the inner primer BIP is shown in SEQ ID NO.4, the nucleotide sequence of the circular primer LB is shown in SEQ ID NO.5, and the nucleotide sequence of the circular primer LF is shown in SEQ ID NO.6.
[0009] This invention also provides a rapid detection method for Aspergillus lanceolata using the aforementioned Aspergillus lanceolata LAMP-specific detection primer set, comprising the following steps: a. Extract DNA from the sample to be tested; b. Configure a LAMP reaction system containing the Aspergillus oryzae LAMP-specific detection primer set, wherein the amounts of outer primer F3 and outer primer B3, the amounts of inner primer FIP and inner primer BIP, and the amounts of circular primer LF and circular primer LB are added, and the ratio of the total amount of outer primer F3 / B3, the total amount of inner primer FIP / BIP, and the total amount of circular primer LF / LB is 1:4:2; c. LAMP reaction; d. Results were determined using the visual observation method with fluorescent dyes.
[0010] Furthermore, the mass concentration of the DNA in the sample to be tested is 1 pg / μL-1 ng / μL.
[0011] Furthermore, the LAMP reaction system includes 2.5 μL of 10×Bst reaction buffer containing 2 mmol / L MgSO4, 3.5 μL of 10 mmol / L dNTP Mix, 1 μL of Bst DNA polymerase, 1 μL of DNA template, 0.5 μL each of 10 μmol / L outer primer F3 / B3 solution, 2 μL each of 10 μmol / L inner primer FIP / BIP solution, 1 μL each of 10 μmol / L loop primer LB / LF solution, and sterile water. The sterile water is added to make the total volume of the LAMP reaction system 25 μL.
[0012] Furthermore, the LAMP reaction includes the following steps: after thoroughly mixing the LAMP reaction system in the reaction tube, the reaction tube is placed in a constant temperature device and reacted at 65°C for 50 min, followed by a reaction at 80°C for 10 min to terminate the amplification.
[0013] Furthermore, the visual observation method for fluorescent dyes includes the following steps: 2 μL of 1000×SYBR GreenⅠ fluorescent dye solution is dropped onto the inner wall of the PCR reaction tube cap. After terminating the amplification, the SYBR GreenⅠ fluorescent dye solution on the tube cap is shaken into the reaction solution and thoroughly mixed. The color change of the reaction solution is observed, and the results are interpreted: green indicates a positive result, indicating the detection of Aspergillus oryzae; orange-yellow indicates a negative result, indicating the absence of Aspergillus oryzae.
[0014] This invention also provides the application of the aforementioned Aspergillus lanceolata LAMP-specific detection primer set in the detection of Aspergillus lanceolata. The extracted DNA of the sample to be tested is used as a template, and a LAMP reaction is performed in the LAMP reaction system. The results are then determined by visual observation using a fluorescent dye method. The LAMP reaction system contains the aforementioned Aspergillus lanceolata LAMP-specific detection primer set, wherein the amounts of outer primer F3 and outer primer B3, inner primer FIP and inner primer BIP, and circular primer LF and circular primer LB are added. The ratio of the total amount of outer primer F3 / B3, the total amount of inner primer FIP / BIP, and the total amount of circular primer LF / LB is 1:4:2.
[0015] The beneficial effects of this invention are: the primer set for the specific detection of Aspergillus lanceolata LAMP of this invention can specifically recognize Aspergillus lanceolata calmodulin (… CaMThe gene showed no cross-reactivity with six common plant pathogenic fungi: *Aspergillus flavus*, *Rhizopus oligosporus*, *Trichoderma echinococcus*, *Penicillium aureum*, *Mucor*, and *Alternaria*. The addition of a loop primer improved amplification specificity and avoided false-positive amplification of non-target fungi. This method eliminates the need for expensive and sophisticated equipment such as PCR instruments and quantitative fluorescence analyzers; amplification can be completed with only a simple isothermal device. Results are interpreted directly by visually observing color changes after amplification, eliminating the need for subsequent gel electrophoresis and requiring minimal operator expertise. This method is rapid, requiring only 50 minutes for the entire isothermal amplification process, and a total time of only one hour including result interpretation, significantly faster than traditional morphological identification and conventional PCR methods, meeting the needs of rapid on-site detection. This invention is highly practical, allowing direct detection of DNA from extracted plant tissue samples, accurately identifying plant samples infected with *Aspergillus*, and is suitable for detecting specific fungi in fungal infections at production sites. Attached Figure Description
[0016] Figure 1 Based on ITS and CaM ML phylogenetic trees constructed from sequences; where A is the ITS sequence phylogenetic tree, and B is... CaM Sequence phylogenetic tree; Figure 2 These are the results of the screening experiment for the ratio of inner and outer primers in the Aspergillus LAMP system; in each group of two tubes, the left side is a negative control with sterile ddH2O DNA template, and the right side has Aspergillus DNA added; Figure 3 These are specific detection results of the Aspergillus lanceolata LAMP system; among them, reaction tube 1 contains Aspergillus flavus, reaction tube 2 contains Rhizopus oligosporus, reaction tube 3 contains Aspergillus lanceolata, reaction tube 4 contains Trichoderma echinosporum, reaction tube 5 contains Penicillium aubergine, reaction tube 6 contains Mucor spp., and reaction tube 7 contains Alternaria spp. Figure 4 This presents the LAMP detection sensitivity results of the Aspergillus niger LAMP system for different concentrations of Aspergillus niger template DNA; wherein, reaction tube 1 contains 1 ng / μL DNA dilution, reaction tube 2 contains 100 pg / μL DNA dilution, reaction tube 3 contains 10 pg / μL DNA dilution, reaction tube 4 contains 1 pg / μL DNA dilution, reaction tube 5 contains 100 fg / μL DNA dilution, reaction tube 6 contains 10 fg / μL DNA dilution, and reaction tube 7 contains 1 fg / μL DNA dilution; Figure 5 These are the results of the reaction stability of the Aspergillus lanceolata LAMP system; among them, reaction tube 1 contains ddH2O as a negative control, and reaction tubes 2-7 contain Aspergillus lanceolata YC-4; Figure 6This is the result of the specificity and sensitivity verification of the Aspergillus LAMP system in mixed samples; among them, reaction tube 1 contains mixed DNA of Aspergillus, Rhizopus oryzae, Mucor, and Alternaria, reaction tube 2 contains mixed DNA of Rhizopus oryzae, Mucor, and Alternaria, and tube 3 is a ddH2O negative control. Figure 7 These are images of wheat sprouts infected with Aspergillus lanceolata; where A shows the morphology of the pathogenic fungus in the original wheat sprout production; and B shows the disease state of wheat sprouts inoculated with Rhizopus spp. to verify the pathogenic fungus. Figure 8 This is the reaction of the Aspergillus lanceolata LAMP system in wheat sprout production practice; among them, reaction tube 1 contains a mixed sample of plant DNA infected with Aspergillus lanceolata, reaction tube 2 contains a sample of plant DNA without pathogen contamination, and reaction tube 3 contains a ddH2O negative control. Detailed Implementation
[0017] The present invention will now be described in detail with reference to the accompanying drawings.
[0018] All pathogenic fungi involved in this invention are publicly shared in the catalog of the China General Microbiological Culture Collection Center (see Table 1), and can be obtained by those skilled in the art through formal application.
[0019] Table 1 Information on pathogenic fungi YC-4 Aspergillus lanceolata CGMCC 3.6890 China General Microbiological Culture Collection Center YC-3 Rhizopus septum CGMCC 3.5849 China General Microbiological Culture Collection Center YC-1 Aspergillus flavus CGMCC 3.11842 China General Microbiological Culture Collection Center YC-7 Golden Penicillium CGMCC 3.11263 China General Microbiological Culture Collection Center YC-6 Trichoderma acicularis CGMCC 3.17461 China General Microbiological Culture Collection Center YC-24 Mucor CGMCC 3.7107 China General Microbiological Culture Collection Center LG Alternaria CGMCC 3.13752 China General Microbiological Culture Collection Center Example 1: Primer screening, reaction system establishment, and reaction condition optimization for LAMP detection of Rhizopus septemlobus. 1. Obtaining Aspergillus strain and template DNA: Aspergillus strain YC-4 was selected (details in Table 1). DNA was extracted using an omega fungal DNA extraction kit, with ITS universal primers ITS1, ITS4, and... CaM Primers for the calmodulin gene were used to amplify the DNA of the above-mentioned pathogen by PCR. The PCR amplification products were sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing. The sequencing sequences were compared with the NCBI database and a phylogenetic tree was constructed. After verification, the strain was confirmed to be Aspergillus lanceolata (see...). Figure 1 A, Figure 1 B), to obtain the DNA template.
[0020] 2. LAMP detection primer design: Calmodulin based on Aspergillus niger ( CaM LAMP primers were designed using Primer Explorer V5 online software for the conserved gene region. After screening and comparing multiple primer sets, the following three primer pairs were selected. All primers were synthesized by Beijing Ruiboxingke Biotechnology Co., Ltd., and their specific sequences are as follows: Outer primer F3 (forward): GACCTGCAGGCCAGATCA (SEQ ID NO.1); Outer primer B3 (reverse): ACTCTGAACGCGGGTCAA (SEQ ID NO.2); Inner primer FIP (forward): TGGAGCTCCGACTCGGAAGGCCACCAAGGAGTTGGGTAC (SEQ ID NO. 3); Inner primer BIP (reverse): AGGTTGATGCCGACAACAACGGGAGTGATTCGGGTGGGAAG (SEQ ID NO. 4); Loop primer LB: TTCCCGGTATGCGATA (SEQ ID NO.5); Loop primer LF: TTCTGGCCCAGAGAG (SEQ ID NO. 6).
[0021] 3. Establishment of the reaction system: The *Aspergillus niger* LAMP reaction system was established by optimizing the initial LAMP reaction system (25 μL): 2.5 μL of 10×Bst reaction buffer (containing 2 mmol / L MgSO4), 3.5 μL of 10 mmol / L dNTP Mix, 1 μL of Bst DNA polymerase, and 1 μL of DNA template. The conditions were further optimized by adjusting the ratio of the total amount of outer primer F3 / B3 to the total amount of inner primer FIP / BIP to 1:2, 1:4, and 1:8. Specifically, the amounts of outer primer F3 and outer primer B3 were adjusted accordingly, as were the amounts of inner primer FIP and inner primer BIP (see [link to relevant documentation]). Figure 2 Each group consisted of two reaction tubes: the left tube contained a sterile ddH2O negative control, and the right tube contained Aspergillus lanceolata DNA. Sterile water was added to a final volume of 25 μL, with sterile ddH2O serving as a blank (negative) control. The results showed that Aspergillus lanceolata only reacted when the ratio of the total amount of outer primer F3 / B3 to the total amount of inner primer FIP / BIP was 1:4 (see [link to reaction tube]). Figure 2The reaction solution in the tube on the right turns green. (See "4. LAMP Reaction Conditions" for the reaction process and conditions). To enhance the specificity of the LAMP reaction system, loop primers were added to the basic primers. The amounts of loop primers LF and LB were increased, and the ratio of the total amount of outer primer F3 / B3, the total amount of inner primer FIP / BIP, and the total amount of loop primer LF / LB was 1:4:2. The optimal components and amounts of the LAMP reaction system were determined and are shown in Table 2.
[0022] Table 2 LAMP reaction system
[0023] 4. Reaction conditions: After thoroughly mixing the above LAMP reaction system in the reaction tube, add 2 μL of 1000×SYBR GreenⅠ fluorescent dye solution to the inner wall of the reaction tube cap to avoid premature contact between the dye solution and the reaction system, which would affect the amplification. Place the reaction tube in a metal bath of a constant temperature device and react at 65℃ for 50 min. After the reaction is complete, stop the amplification by reacting at 80℃ for 10 min, and then shake the SYBR Green I fluorescent dye on the tube cap into the reaction solution and mix thoroughly. Observe the color change of the reaction solution and interpret the results: green indicates a positive result (Aspergillus lanceolata was detected), and orange indicates a negative result (Aspergillus lanceolata was not detected).
[0024] The LAMP reaction system and the LAMP reaction conditions described in Table 2 were used to conduct the verification experiment in Example 2.
[0025] Example 2 Verification Experiment 1. Specificity verification: The circular primers LF and LB designed using Primer Explorer V5 can effectively enhance the specificity of the LAMP reaction system. Using DNA from seven pathogenic fungi (Aspergillus flavus, Rhizopus oligosporus, Aspergillus lanceolata, Trichoderma echinococcus, Penicillium augerii, Mucor truncatula, and Alternaria alternata) as templates, LAMP amplification was performed in reaction tubes 1-7. Results showed that only the Aspergillus lanceolata sample (see Table 1) showed specificity. Figure 3 The green positive result (in reaction tube #3) and the orange negative results (in all other tubes) indicate that the primer set for the specific detection of Aspergillus lanceolata LAMP in this invention has good specificity.
[0026] 2. Sensitivity verification: Aspergillus DNA was diluted to concentrations of 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, and 1 fg / μL. These different concentrations of DNA were used as templates for LAMP reactions in reaction tubes 1-7 to determine LAMP sensitivity. Results showed that at DNA concentrations below 100 fg / μL (see... Figure 4 The color remains orange when the DNA concentration is above 1 pg / μL in reaction tubes 5, 6, and 7. The reaction solution turns green when the DNA concentration is above 1 pg / μL, indicating that the minimum DNA concentration for this LAMP system is 1 pg / μL, demonstrating high sensitivity.
[0027] 3. Repeatability and stability verification: To verify the stability of the *Aspergillus lanceolata* LAMP reaction system, *Aspergillus lanceolata* YC-4 DNA was subjected to LAMP reactions in reaction tubes 2-7, while ddH2O was added to reaction tube 1 for LAMP reactions (negative control). The results showed that all *Aspergillus lanceolata* samples reacted normally, indicating that the designed *Aspergillus lanceolata* LAMP system has good reproducibility and high stability (see...). Figure 5 ).
[0028] 4. Validation of the specificity and sensitivity of Aspergillus oryzae in mixed samples: DNA from *Aspergillus lanceolata* mixed with *Rhizopus oryzae*, *Mucor*, and *Alternaria* was used as a template and placed in reaction tube 1 for LAMP amplification. DNA from *Rhizopus oryzae*, *Mucor*, and *Alternaria* was also mixed as a template and placed in reaction tube 2 for LAMP amplification. ddH2O was added to reaction tube 3 as a negative control for the LAMP reaction. Results showed that the *Aspergillus lanceolata* LAMP reaction system was effective in mixed samples containing *Aspergillus lanceolata* (see...). Figure 6 The sample showed a green positive result in reaction tube #1, but remained green and turned orange negative in a mixed sample without Aspergillus oryzae (see [link to reaction tube]). Figure 6 The specificity and sensitivity of the sample were further verified in reaction tubes 2 and 3.
[0029] 5. Verification through production practice: In wheat sprout production in plant factories, *Aspergillus lanceolata* is one of the common and dominant pathogens causing mold and mildew diseases. Once infected (naturally or through artificial inoculation), the fungus spreads very rapidly, typically causing extensive mold growth at the base of the sprouts within 4-7 days, severely impacting sprout growth and yield (see...). Figure 7 A). After isolating, purifying, and identifying the mycelium from the surface of infected grass shoots, it was determined to be Aspergillus lanceolata. The pure strain was then inoculated back onto the surface of disease-free grass shoots using Koch's postulate to verify its morphological characteristics (see...). Figure 7B). To quickly and easily detect this bacterium, the following verification was performed. Sterile toothpicks were used to collect wheatgrass seed root samples infected with Aspergillus lanceolata and uncontaminated wheatgrass root samples. DNA was extracted from each sample using a fungal DNA extraction kit (EZNA® Fungal DNA Kit, D3390-01, Omega Bio-Tek). The DNA template from the rhizosphere tissue of the Aspergillus lanceolata-infected wheatgrass seed samples was placed in reaction tube 1, and the DNA template from the uncontaminated wheatgrass root samples was placed in reaction tube 2. Sterile water was placed in reaction tube 3 as a control for LAMP amplification detection. The results showed that only the reaction solution from the wheatgrass seed root samples infected with Aspergillus lanceolata (see...)... Figure 8 The reaction tube (No. 1) was green and positive, while the uncontaminated wheat sprout root sample and the blank control were orange and negative (see reaction tube No. 1). Figure 8 The results of reaction tubes 2 and 3 in this invention demonstrate that the LAMP detection method for Aspergillus oryzae established in this invention can be directly applied to agricultural production practices and has good feasibility and accuracy for detecting actual plant samples.
[0030] The above experimental results show that the method of the present invention has high specificity, sensitivity and stability, is simple to operate and fast to detect, does not require expensive equipment, does not require high professional level of operators, and can be completed by general technicians. It is suitable for rapid on-site detection and identification of Aspergillus niger.
[0031] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.
Claims
1. A primer set for the LAMP-specific detection of Aspergillus lanceolata, characterized in that: The primer set consists of one pair of outer primers F3 / B3, one pair of inner primers FIP / BIP, and one pair of circular primers LB / LF. The nucleotide sequence of the outer primer F3 is shown in SEQ ID NO.1, the nucleotide sequence of the outer primer B3 is shown in SEQ ID NO.2, the nucleotide sequence of the inner primer FIP is shown in SEQ ID NO.3, the nucleotide sequence of the inner primer BIP is shown in SEQ ID NO.4, the nucleotide sequence of the circular primer LB is shown in SEQ ID NO.5, and the nucleotide sequence of the circular primer LF is shown in SEQ ID NO.
6.
2. A rapid detection method for Aspergillus lanceolata using the Aspergillus lanceolata LAMP-specific detection primer set described in claim 1, characterized in that... Includes the following steps: a. Extract DNA from the sample to be tested; b. Configure a LAMP reaction system containing the Aspergillus oryzae LAMP-specific detection primer set, wherein the amounts of outer primer F3 and outer primer B3, the amounts of inner primer FIP and inner primer BIP, and the amounts of circular primer LF and circular primer LB are added, and the ratio of the total amount of outer primer F3 / B3, the total amount of inner primer FIP / BIP, and the total amount of circular primer LF / LB is 1:4:2; c. LAMP reaction; d. Results were determined using the visual observation method with fluorescent dyes.
3. The rapid detection method according to claim 2, characterized in that: The mass concentration of the DNA in the sample to be tested is 1 pg / μL-1 ng / μL.
4. The rapid detection method according to claim 3, characterized in that: The LAMP reaction system includes 2.5 μL of 10×Bst reaction buffer containing 2 mmol / L MgSO4, 3.5 μL of 10 mmol / L dNTP Mix, 1 μL of Bst DNA polymerase, 1 μL of DNA template, 0.5 μL each of 10 μmol / L outer primer F3 / B3 solution, 2 μL each of 10 μmol / L inner primer FIP / BIP solution, 1 μL each of 10 μmol / L loop primer LB / LF solution, and sterile water. The sterile water is added to make the total volume of the LAMP reaction system 25 μL.
5. The rapid detection method according to claim 2, characterized in that: The LAMP reaction includes the following steps: after thoroughly mixing the LAMP reaction system in the reaction tube, the reaction tube is placed in a constant temperature device and reacted at 65°C for 50 min, followed by a reaction at 80°C for 10 min to terminate the amplification.
6. The rapid detection method according to claim 2, characterized in that: The visual observation method for fluorescent dyes includes the following steps: 2 μL of 1000×SYBR GreenⅠ fluorescent dye solution is dropped onto the inner wall of the PCR reaction tube cap. After terminating the amplification, the SYBR GreenⅠ fluorescent dye solution on the tube cap is shaken into the reaction solution and thoroughly mixed. The color change of the reaction solution is observed, and the results are interpreted: green indicates a positive result, indicating the detection of Aspergillus oryzae; orange-yellow indicates a negative result, indicating that Aspergillus oryzae was not detected.
7. The application of the Aspergillus lanceolata LAMP-specific detection primer set as described in claim 1 in the detection of Aspergillus lanceolata, characterized in that: The extracted DNA from the test sample was used as a template to perform a LAMP reaction in the LAMP reaction system, and the results were then determined by visual observation using a fluorescent dye method. The LAMP reaction system contained the Aspergillus oryzae LAMP-specific detection primer set, wherein the amounts of outer primer F3 and outer primer B3, the amounts of inner primer FIP and inner primer BIP, and the amounts of circular primer LF and circular primer LB were added. The ratio of the total amount of outer primer F3 / B3, the total amount of inner primer FIP / BIP, and the total amount of circular primer LF / LB was 1:4:2.
Citation Information
Patent Citations
Loop-mediated isothermal amplification fast detection method of producing potulin fungi
CN101381773B
LAMP (loop-mediated isothermal amplification) universal primer for detecting aspergillus toxin-producing fungi and kit containing primer
CN105648038A