Application of gene expression inhibitor in improving soybean quality and creation method

Abstract

This invention belongs to the field of soybean genetic breeding technology, specifically relating to the application and creation method of gene expression inhibitors in improving soybean quality. The genes are GmFATB1a, GmSFAR4a, and GmSFAR4b. The nucleotide sequence of GmFATB1a is shown in SEQ ID NO.1, the nucleotide sequence of GmSFAR4a is shown in SEQ ID NO.2, and the nucleotide sequence of GmSFAR4b is shown in SEQ ID NO.3. This invention integrates multiple desirable traits into the same genetic background through hybridization polymerization of gene-edited materials, obtaining materials with both enhanced oil and protein content and high oleic acid and low saturated fatty acid content. This overcomes the technical bottleneck of traditional breeding where oil and protein are negatively correlated and quality traits are difficult to optimize simultaneously.

Description

Technical Field

[0001] This invention belongs to the field of soybean genetic breeding technology, specifically involving the application and creation method of gene expression inhibitors in improving soybean quality. Background Technology

[0002] Soybean, Latin name Glycine max (L.) Merr., as a globally important oilseed crop and protein source, is a core supplier of edible vegetable oil and livestock feed protein, and also has wide applications in industrial sectors such as biofuels and food processing. With population growth and dietary upgrades, global demand for high-quality soybeans continues to rise, making soybean quality improvement a key task for ensuring food security and high-quality industrial development.

[0003] One of the core goals of current soybean breeding is to simultaneously increase oil and protein content, optimize fatty acid composition, and ensure stable yield. However, traditional breeding practices face three major technical bottlenecks: First, there is a significant negative correlation between oil and protein content, and conventional breeding methods cannot achieve simultaneous increases in both. Most high-oil soybean varieties have low protein content, and vice versa. Second, optimizing fatty acid composition is difficult. Ordinary soybeans contain only 15% to 25% oleic acid and as much as 15% to 20% saturated fatty acids. Soybean oil with high oleic acid and low saturated fatty acids has higher nutritional value and oxidative stability, which is more in line with the needs of a healthy diet. However, traditional hybridization breeding cannot accurately regulate key node genes in the fatty acid metabolism pathway. Third, it is difficult to synergistically improve quality traits and yield traits. The introduction of most high-quality traits is accompanied by a decrease in yield-related traits such as 100-seed weight and number of pods per plant, which limits the industrial application of high-quality varieties.

[0004] Gene editing technology provides a precise means of regulating soybean quality improvement. The CRISPR-Cas9 system, as a next-generation gene editing tool, boasts advantages such as high editing efficiency, strong targeting, and ease of operation, and has been successfully applied to the targeted modification of key genes in soybean oil metabolism and protein synthesis. Although single-gene or multi-gene editing technologies can improve single or a few quality traits, soybean oil synthesis, protein accumulation, fatty acid metabolism, and yield formation are complex traits regulated by multiple genes. Single-gene-edited materials are insufficient to meet the industrial demands for comprehensive soybean traits. Hybridization breeding is an effective means of integrating superior traits from different materials into a single genetic background. Marker-assisted selection can significantly improve breeding efficiency and shorten the breeding cycle. In existing technologies, there have been reports of using hybridization to improve multiple resistance traits in soybeans. However, multi-gene editing faces challenges such as the complexity of gene interactions, nonlinear responses of regulatory networks, decreased editing efficiency and specificity, genetic background dependence, and disruption of metabolic balance. Epistatic and dose-response effects between genes are difficult to predict, which may lead to the unexpected results when arbitrarily selecting genes with different desirable traits for multi-gene editing. Therefore, it is impossible to determine whether multiple desirable trait genes play a positive role in improving soybean quality. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides the application and creation method of gene expression inhibitors in improving soybean quality.

[0006] The application of gene expression inhibitors in improving soybean quality, wherein the genes are GmFATB1a, GmSFAR4a and GmSFAR4b, the nucleotide sequence of GmFATB1a is shown in SEQ ID NO.1, the nucleotide sequence of GmSFAR4a is shown in SEQ ID NO.2 and the nucleotide sequence of GmSFAR4b is shown in SEQ ID NO.3.

[0007] Preferably, the expression inhibitor comprises a recombinant plasmid carrying a gRNA expression cassette of the gene target sequence or a recombinant Agrobacterium carrying the gRNA expression cassette.

[0008] Preferably, the nucleotide sequence of the target sequence of GmFATB1a is shown in SEQ ID NO.4; The nucleotide sequence of the target sequence of GmSFAR4a is shown in SEQ ID NO.5; The nucleotide sequence of the target sequence of GmSFAR4b is shown in SEQ ID NO.6.

[0009] Preferably, the gRNA expression cassette is a GmFATB1a expression cassette obtained by inserting the target sequence of GmFATB1a into the pBlu-gRNA vector, and a GmSFAR4a / GmSFAR4b expression cassette obtained by inserting the target sequences of GmSFAR4a and GmSFAR4b into the pBlu-gRNA vector.

[0010] Preferably, the recombinant plasmid is the GmFATB1a recombinant plasmid obtained by cloning the GmFATB1a expression cassette into the Cas9 vector, and the GmSFAR4a / GmSFAR4b recombinant plasmid obtained by cloning the GmSFAR4a / GmSFAR4b expression cassette into the Cas9 vector.

[0011] Preferably, the recombinant Agrobacterium is either GmFATB1a recombinant Agrobacterium obtained by introducing the GmFATB1a recombinant plasmid into Agrobacterium, or GmSFAR4a / GmSFAR4b recombinant Agrobacterium obtained by introducing the GmSFAR4a / GmSFAR4b recombinant plasmid into Agrobacterium.

[0012] Preferably, the improved soybean quality includes increased soybean oil content, increased protein content, increased oleic acid content, decreased saturated fatty acid content, and stable yield.

[0013] A method for creating high-quality soybeans through hybridization and polymerization of multi-gene-edited materials includes the following steps: The recombinant bacteria were transfected into soybeans to be treated, and the desired strains were obtained through screening. gmfatb1a Mutant material A and gmsfar4a / 4b Double mutant material B; Material A and material B were crossed to obtain the F1 generation hybrids, and those carrying the same traits were screened. gmfatb1a Mutation sites and gmsfar4a / 4b Positive single plants with two mutation sites can be continuously self-crossed for 3 to 4 generations to obtain high-quality soybeans with increased oil content, increased protein content, increased oleic acid content, decreased saturated fatty acid content, and stable yield.

[0014] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) Achieving synergistic improvement of multiple quality traits: This invention integrates multiple excellent traits into the same genetic background through gene editing material polymerization and hybridization, and obtains materials with double improvement of oil and protein and high oleic acid and low saturated fatty acid, breaking through the technical bottleneck of negative correlation between oil and protein and difficulty in synchronous optimization of quality traits in traditional breeding.

[0015] (2) Ensure stable yield: During the screening process, the present invention identifies agronomic traits to ensure that the yield-related traits of the final soybean material, such as the weight of 100 seeds and the yield per plant, are not significantly different from those of the control variety, thus solving the problem of difficulty in achieving both high quality and high yield.

[0016] (3) High breeding efficiency and short cycle: This invention combines the precision of gene editing with the efficiency of hybridization, and achieves accurate identification of target genotypes through molecular marker-assisted selection, avoiding the blindness of phenotypic screening in traditional breeding. The trait stabilizes quickly, and homozygous, stable, and high-quality germplasm resources can be obtained rapidly.

[0017] (4) Strong technical feasibility and broad application prospects: The CRISPR-Cas9 gene editing technology, Agrobacterium-mediated transformation, and molecular marker-assisted selection technologies used in this invention are all mature soybean genetic improvement technologies. They are easy to operate, have good reproducibility, and are suitable for large-scale promotion and application. The high-quality soybean materials created can be directly used for industrial planting, or used as core parents for subsequent soybean variety improvement, providing dedicated high-quality raw materials for industries such as edible oil processing and soybean product production, with significant economic and social benefits. Attached Figure Description

[0018] Figure 1 for GmFATB1a , GmSFAR4a and GmSFAR4b Gene mutations in the williams82 soybean polygenic polymer mutant Figure 1 The A in the text represents GmFATB1a Gene mutation sequencing results; Figure 1 B in GmSFAR4a and GmSFAR4b Gene mutation sequencing results.

[0019] Figure 2 For creation gmfatb1a×gmsfar4a / b Field agronomic traits of multigenic polymeric mutant materials and controls, and parental materials, among which, Figure 2 In this context, A represents the statistical data on plant height. Figure 2 B in the image represents a photograph of the plant's morphology. Figure 2 In this context, C represents the statistical data on grain weight per plant. Figure 2 In this context, D represents the statistical data for the weight of 100 grains. Figure 2 In the image, E represents a comparison photo of seed sizes. Figure 2 In the A, C, and D symbols, lowercase letters indicate significant differences between different materials. The same letter indicates no significant difference, and different letters indicate significant differences.

[0020] Figure 3 for gmfatb1a×gmsfar4a / b Comparison of dry seed oil content and fatty acid composition in multi-gene polymeric mutant materials and controls, and parental materials. Figure 3 In this context, A represents wild-type williams82 and gmsfar4a / 4b Double mutant gmfatb1a mutants and gmfatb1a×gmsfar4a / b The content of different fatty acid components in the dry seeds of multi-gene mutants. Figure 3 B in the text refers to wild-type williams82 and gmsfar4a / 4b Double mutant gmfatb1a mutants and gmfatb1a× gmsfar4a / b The total fatty acid content in the dry seeds of multi-gene mutants was analyzed using the Duncan test for multiple comparisons. In the figure, lowercase letters indicate significant differences between different materials, the same letters indicate no significant difference, and different letters indicate significant differences.

[0021] Figure 4 for gmfatb1a×gmsfar4a / b Comparison of dry seed protein content in multi-gene polymeric mutant materials and controls, and parental materials, between wild-type williams82 and control. gmsfar4a / 4b Double mutant gmfatb1a mutants and gmfatb1a ×gmsfar4a / b The total protein content of dry seeds of multi-gene mutants was analyzed using the Duncan test for multiple comparisons. In the figure, lowercase letters indicate significant differences between different materials, the same letters indicate no significant difference, and different letters indicate significant differences.

[0022] Figure 5 To create different multi-gene polymeric mutant materials and control and parental materials, the field agronomic traits were studied. Figure 5 In this context, A represents the statistical data on plant height. Figure 5 In this context, B represents the grain weight per plant. Figure 5 In this context, C represents the statistical data for the weight of 100 grains.

[0023] Figure 6 for gmfatb1a× OE-ROD1a multigene polymeric mutant materials and controls, comparison of dry seed protein content in parental materials, wild-type williams82 and gmfatb1a mutants, OE-ROD1a and gmfatb1a× Phenotypic results analysis of OE-ROD1a multigene mutants, including... Figure 6 In this context, A represents the statistical data on plant height. Figure 6 In this context, B represents the statistical data on grain weight per plant. Figure 6 In this context, C represents the statistical data for the weight of 100 grains. Figure 6 In the image, D represents a comparison photo of seed sizes. Figure 6 In this context, E represents the content of different fatty acid components in the dry seeds of the multi-gene mutant. Figure 6In this context, F represents the total fatty acid content in the dry seeds of the polygenic mutant. The data were analyzed using the Duncan test for multiple comparisons. Figure 6 In the A, B, C, E, and F symbols, lowercase letters indicate significant differences between different materials. The same letter indicates no significant difference, and different letters indicate significant differences. Detailed Implementation

[0024] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.

[0025] Example 1: Construction of soybean materials for single-trait gene editing.

[0026] 1. Design of target gene target sequences.

[0027] Based on the GmFATB1a gene sequence shown in SEQ ID NO.1, the GmSFAR4a gene sequence shown in SEQ ID NO.2, and the GmSFAR4b gene sequence shown in SEQ ID NO.3, specific target sequences were designed using CRISPR-P 2.0 software. All target sequences are located in conserved regions of the gene coding region to ensure that the expression of the target gene can be effectively suppressed after editing.

[0028]

[0029]

[0030]

[0031] The designed specific target sequences are as follows: GmFATB1a: GGTGGTGGGCCTGCAAACCT, denoted as SEQ ID NO.4; GmSFAR4a: GGAGACTCTTTCACAGACAC, denoted as SEQ ID NO.5; GmSFAR4b: GGAGACTCTTTCACAGACAC, denoted as SEQ ID NO.6; 2. Construction of gene editing vectors.

[0032] A two-step method was used to construct CRISPR-Cas9 editing vectors, employing the intermediate vector pBlu-gRNA and the final vector Cas9 MDC123 as the backbone vectors. The designed target sequence was inserted into the pBlu-gRNA vector to construct a gRNA expression cassette, which was then cloned into the Cas9 MDC123 vector to obtain the desired expression. GmFATB1a Gene editing vectors, GmSFAR4a / GmSFAR4b The dual gene editing vectors were correctly constructed, as verified by sequencing. The product information for pBlu-gRNA is Addgene #59188, and for Cas9MDC123 it is Addgene #59184.

[0033] 3. Soybean genetic transformation and mutant screening.

[0034] The above-mentioned editing vectors were transformed into cotyledonary nodes of Williams 82 soybean using Agrobacterium-mediated transformation. Regenerated plants were obtained through resistance selection, differentiation culture, and rooting culture. Genomic DNA was extracted from the leaves of the regenerated plants, and PCR detection and sequencing verification were performed using specific primers to screen for and obtain... gmfatb1a Homozygous mutant, denoted as material A, gmsfar4a / gmsfar4b The double homozygous mutant is denoted as material B.

[0035] Stable genetic transformation of soybean was achieved using Agrobacterium soybeani-mediated cotyledonary node transformation, which included steps such as seed surface disinfection and germination, preparation of Agrobacterium, preparation of explants, infection and co-culture, induction of shoot clusters, elongation of shoot clusters, and rooting and cultivation.

[0036] (1) Disinfection and germination of seeds: Use fresh seeds harvested in the current year, select plump, mature, healthy seeds without damage or spots. Disinfect with chlorine for 16 hours, take them out and place them on a sterile operating table to blow off the residual chlorine, generally treat for 30 minutes, and then put the seeds into petri dishes and seal them for storage.

[0037] Chlorine sterilization was carried out in a vacuum desiccator: Selected seeds were placed in sterile glass dishes, which were then placed in the desiccator. The glass dish lid was opened, 120 mL of NaClO was poured into an Erlenmeyer flask, and 4 mL of concentrated hydrochloric acid was added to it using a dropper. The desiccator lid was then closed, and the dish was placed in a fume hood for 18 hours.

[0038] (2) Preparation of Agrobacterium: separately GmFATB1a Gene editing vectors, GmSFAR4a / GmSFAR4b Single colonies of *Agrobacterium tumefaciens* LBA4404 containing the dual gene-editing vector were picked and cultured in YEP liquid medium supplemented with the first concentration of antibiotic at 28°C and 250 rpm for 30 hours with shaking. Then, 0.6 ml of the saturated bacterial culture was transferred to 300 ml of YEP liquid medium supplemented with the second concentration of antibiotic and cultured at 28°C and 250 rpm for 10 hours until OD500 reached. 650 =0.8, collect the bacterial cells and resuspend them in an equal volume of liquid co-culture medium to obtain GmFATB1a bacterial solution and GmSFAR4a / GmSFAR4b The bacterial solution.

[0039] In the YEP liquid culture medium with added first concentration of antibiotics, the first concentration of antibiotics was kanamycin with a final concentration of 50 mg / L and rifamycin with a final concentration of 25 mg / L. In the YEP liquid culture medium with added second concentration of antibiotics, the second concentration of antibiotics was kanamycin with a final concentration of 25 mg / L and rifamycin with a final concentration of 12.5 mg / L.

[0040] The formulation of the liquid co-culture medium was as follows: 0.321 g / L B5 salt powder, 30 g / L sucrose, 3.9 g / L 2(N-morpholine) ethanol sulfonic acid (MES) as the organic buffer, water as the solvent, pH 5.4. The medium was sterilized at 121°C for 20 min. After cooling, sterile gibberellin, 6-benzyladenine, cysteine, dithiothreitol, and acetylsylsyringone were added under aseptic conditions to final concentrations of 0.25 mg / L, 1.67 mg / L, 400 mg / L, 154.2 mg / L, and 200 μmol / L, respectively. 2(N-morpholine) ethanol sulfonic acid is abbreviated as MES.

[0041] (3) Preparation of explants: Select soybean seeds that have been swollen and uncontaminated in step (1) and place them in a sterile culture dish. Cut the seeds longitudinally along the hilum with a scalpel, separate the cotyledons and hypocotyl into two halves, and make three incisions at the cotyledon nodes. After removing the seed coat, use them as explants for later use.

[0042] (4) Infection and co-culture: 50 ml of the solution from step (2) was added to the culture vessel. GmFATB1a bacterial solution and GmSFAR4a / GmSFAR4bPour the bacterial culture into a clean, sterile disposable culture dish, add about 50 explants prepared in step (3), and incubate at room temperature for 30 minutes, stirring the culture frequently to ensure the explants are in full contact with the fresh culture. Add 30 ml of liquid co-culture medium to a sterile stainless steel box lined with two layers of filter paper. Remove the incubated explants and remove the Agrobacterium culture from them, then lay them flat on the filter paper with the adaxial side facing up. Seal the stainless steel box and place it in a plant culture room at 24°C in the dark for 5 days.

[0043] (5) Induction of shoot clusters: After co-culture, the elongated hypocotyl of the explant is cut off, leaving about 0.5 cm. It is inserted at a 30-45° angle on the shoot induction medium, which is called SI medium. It is then transferred to the plant culture room for 4 weeks and fresh SI medium is replaced every two weeks.

[0044] The formulation of SI medium is as follows: 0.321 g / L B5 salt powder, 30 g / L sucrose, 3.9 g / L MES, 8 g / L Agar, with water as the solvent, pH 5.7, sterilized at 121℃ for 20 min; when the temperature drops to about 50℃, add filtered sterile 6-benzyladenine, ticarcillin, cefadroxil, and glufosinate, with final concentrations of 1.67 mg / L, 250 mg / L, 100 mg / L, and 5 mg / L, respectively.

[0045] (6) Bud elongation: After 4 weeks of induction of buds in step (5), the cotyledons are removed and transferred to the bud elongation medium, which is called SE medium. The bud elongation medium is placed in the plant culture room for 2-8 weeks and fresh SE medium is replaced every 2 weeks.

[0046] The SE medium formula is as follows: MS salt powder containing vitamins 4.43 g / L, sucrose 30 g / L, MES 0.59 g / L, Agar 8 g / L, water as solvent, pH 5.7, sterilized at 121℃ for 20 min; when the temperature drops to about 50℃, filter-prepared asparagine, glutamine, indoleacetic acid, zeatin, gibberellin, ticarcillin, and cephalosporin are added, with final concentrations of 50 mg / L, 50 mg / L, 0.1 mg / L, 1 mg / L, 0.5 mg / L, 250 mg / L, and 100 mg / L, respectively.

[0047] (7) Rooting cultivation: Cut off the young stems that have grown to 3 cm in the SE medium, dip them in indolebutyric acid for 30 seconds and then insert them into the rooting medium, which is called RM medium. Place them in the plant culture room. After the roots have grown, take the rooted seedlings out of the medium, wash off the residual medium from the roots, transfer them into the soil and move them to the greenhouse for cultivation. This is the resistant transgenic soybean plant.

[0048] The formula for RM medium is as follows: MS salt powder containing vitamins 4.43 g / L, sucrose 20 g / L, MES 0.59 g / L, plant gel 4 g / L, and water as the solvent.

[0049] (8) Identification of mutant materials: Take 50 mg of the obtained resistant transgenic soybean plant leaves into a 2 ml centrifuge tube, add 200 μl of TPS extraction solution, shake and grind, incubate at 65℃ for 30 min, centrifuge at 12000 rpm for 10 min, transfer the supernatant to a new 1.5 ml centrifuge tube, add an equal volume of isopropanol, invert and mix, centrifuge at 12000 rpm for 5 min, discard the supernatant, add 1 ml of 75% alcohol to wash the precipitate, centrifuge at 12000 rpm for 5 min, discard the supernatant, place at room temperature for 10 min, after all the alcohol has evaporated, add 30 ml of ddH2O to dissolve the precipitate, and obtain the plant genome solution. The pH of the TPS extraction solution is 8.0, and it is composed of Tris-HCl, EDTA, and KCl. The final concentration of Tris-HCl in the TPS extraction solution is 100 mM, the final concentration of EDTA is 10 mM, and the final concentration of KCl is 1 M.

[0050] Using 1 μl of plant genomic DNA solution as a template, PCR amplification was performed with specific primers at both ends of the gene target site. Soybean Williams82 genomic DNA was used as a negative control, and water as a blank control. The PCR products amplified with the gene-specific primers were recovered, sequenced, and then compared with the genomic sequence of the target gene.

[0051] The results of genome sequence alignment are as follows Figure 1 As shown, gRNA represents the insertion site of the target sequence.

[0052] Example 2: Creation of Hybridization and Polymerization gmfatb1a×gmsfar4a / b Multigene mutant.

[0053] Hybridization: Hybridization was carried out under isolated greenhouse conditions during the peak flowering period of soybeans. Using material A as the female parent, the unopened stamens of the flower buds were removed 1 day before flowering, and the pollen from the stamens of the male parent material B was pollinated and then marked. Mature F1 generation seeds were harvested, dried, and stored.

[0054] F1 generation authenticity verification: After sowing F1 generation seeds, when the plants have grown to 3-4 true leaves, genomic DNA is extracted from the leaves and detected using primers shown in SEQ ID No. 7-SEQ ID No. 8. gmfatb1a The mutation site was detected using the primers shown in SEQ ID No. 9~SEQ ID No. 10. gmsfar4a The mutation site was detected using the primers shown in SEQ ID No. 11~SEQ ID No. 12. gmsfar4bMutation sites; through PCR detection and sequencing verification, true F1 hybrids containing all three mutation sites were screened.

[0055] SEQ ID No.7: F-CAGTGTTTGCCTATTTGCATTTC; SEQ ID No. 8: R-ACGATCAGCACCAATCTCATAT.

[0056] SEQ ID No.9: F-CTGTGTCATCCATGGTTTCT; SEQ ID No. 10: R-CACTTTGACTCTTGGCAGTCC.

[0057] SEQ ID No.11: F-AGACTCGTGGGAAACCAAG; SEQ ID No. 12: R-CAAGGGAGAGGTTGTGCTTC.

[0058] Self-pollination homozygosity: Positive plants obtained from F1 generation screening are planted separately and self-pollinated during the full flowering period to harvest F2 generation seeds; F2 generation seeds are sown, molecular marker screening and trait identification are performed, and plants with low genotype heterozygosity and excellent traits are selected for further self-pollination.

[0059] Example 3: gmfatb1a×gmsfar4a / b Agronomic trait identification of multi-gene mutant materials Example 2 used the F3 generation of multi-gene aggregated soybeans that showed homozygosity at the three target gene loci for subsequent experiments. Wild-type williams82 was used as a control, and materials A and B were used as parental controls. The soybeans were planted in the Changxing experimental field and copied after the seeds matured.

[0060] (1) Statistics on agronomic traits After the soybeans mature, at least 10 plants are randomly selected to measure yield-related agronomic traits such as plant height and grain weight per plant, and to observe plant morphology and seed size.

[0061] The results are as follows Figure 2 As shown, gmfatb1a×gmsfar4a / b Compared with the wild-type williams82, the multi-gene mutant material showed significantly increased plant height and 100-seed weight, while the single-seed weight remained unchanged, indicating that... gmfatb1a、gmsfar4a / b Multi-gene editing has a certain promoting effect on plant yield-related traits.

[0062] (2) Determination of oil content Seed samples were dried in a 65 ℃ oven for 3 days until completely dry. The seed samples were then ground using a grinder and sorted using a 100-mesh sieve. Oil, i.e., fatty acids, was extracted from the seed samples by thermal methyl esterification extraction. The main fatty acid components included the following five types: palmitic acid (C16:0), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), and linolenic acid (C18:3). These five components accounted for more than 99.85% of the total fatty acid content. Other fatty acid types were not considered in breeding. Palmitic acid + stearic acid are referred to as saturated fatty acids. The oil content extracted from the seed samples was quantitatively determined by gas chromatography.

[0063] The results are as follows Figure 3 As shown, gmfatb1a×gmsfar4a / b The total fatty acid and oleic acid content of the multi-gene polymeric mutant material was significantly higher than that of the wild type and parents, while the saturated fatty acid content was significantly lower than that of the wild type and parents. In comparison, as... Figure 6 As shown in E and F of 6, gmfatb1a The ×OE-ROD1a polygenic mutant has reduced palmitic acid content but no increase in oil content, failing to achieve the expected superposition effect of the parental single traits.

[0064] (3) Protein content determination: The protein content in the seed powder was determined by the Kjeldahl method; the results are as follows: Figure 4 As shown, gmfatb1a×gmsfar4a / b The protein content of the multi-gene polymer mutant material was significantly higher than that of the wild-type Williams82 and the parent, and it was increased in tandem with the lipid content.

[0065] The above identification results indicate that the invention created... gmfatb1a×gmsfar4a / b The multi-gene polymer mutant material achieves simultaneous improvement in oil and protein content, optimization of fatty acid composition, and stable yield, meeting the industrialization requirements of high-quality soybeans.

[0066] Comparative Example 1 mutant gmtt8a , gmfatb1a , gmfatb1b , gmsweet10a , gmsweet10b , gmsweet10a / b , gmsfar4a / b And 31 hybridization combinations were performed on the overexpression lines OE-ROD1a, OE-SWEET10a, and OE-SWEET10b, from gmfatb1a × gmsfar4a / b , gmfatb1a × gmtt8a , gmfatb1b × gmtt8a , gmfatb1a × gmsweet10a , gmfatb1b × gmsweet10a , gmtt8a × gmsweet10b , gmtt8a × gmsweet10a / b gmsfar4a / b×gmsweet10a gmsfar4a / b × gmsweet10b , gmsfar4a / b × gmtt8a , gmfatb1a ×OE-SWEET10a、 gmsfar4a / b ×OE-SWEET10a、 gmsfar4a / b ×OE-SWEET10b、 gmtt8a ×OE-ROD1a、 gmsfar4a / b ×OE-ROD1a、 gmfatb1a The statistical results of yield-related agronomic traits of 18 different multigene polymeric materials, including ×OE-ROD1a, OE-SWEET10a×OE-ROD1a, and OE-SWEET10b×OE-ROD1a, show that... Figure 5 As shown, different gene editing processes have different effects on yield-related traits after aggregation. gmfatb1a × gmsfar4a / b , gmfatb1a×gmtt8a , gmsfar4a / b×gmsweet10b and gmfatb1a After gene aggregation, the ×OE-ROD1a multi-gene mutant showed increased grain weight per plant, stable plant height, and maintained or slightly increased 100-grain weight. Figure 6 As shown in A~D; and gmfatb1a × gmsweet10a , gmsfar4a / b × gmtt8a , gmsfar4a / b× OE-SWEET10a and similar products show a decrease in single-plant grain weight, sometimes accompanied by dwarfing of plant height or a reduction in 100-grain weight, negatively impacting yield-related traits. For example... Figure 6 As shown in E and F of 6, gmfatb1a The ×OE-ROD1a multigene mutant exhibits decreased palmitic acid content but no increase in total fatty acid content. This combination demonstrates that multigene editing of genes for different desirable traits does not produce the expected results.

[0067] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0068] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of gene expression inhibitors in improving soybean quality, characterized in that, The genes are GmFATB1a, GmSFAR4a and GmSFAR4b, the nucleotide sequence of GmFATB1a is shown in SEQ ID NO.1, the nucleotide sequence of GmSFAR4a is shown in SEQ ID NO.2 and the nucleotide sequence of GmSFAR4b is shown in SEQ ID NO.

3. The expression inhibitor is a recombinant plasmid carrying a gRNA expression cassette containing the target sequence of the gene or a recombinant Agrobacterium carrying the gRNA expression cassette; The improved soybean quality is characterized by increased total fatty acid content, increased protein content, increased oleic acid content, decreased saturated fatty acid content, and stable yield. The saturated fatty acids are palmitic acid and stearic acid.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the target sequence of GmFATB1a is shown in SEQ ID NO.4; The nucleotide sequences of the target sequences of GmSFAR4a and GmSFAR4b are shown in SEQ ID NO.

5.

3. The application according to claim 2, characterized in that, The gRNA expression cassette is a GmFATB1a expression cassette obtained by inserting the target sequence of GmFATB1a into the pBlu-gRNA vector, and a GmSFAR4a / GmSFAR4b expression cassette obtained by inserting the target sequences of GmSFAR4a and GmSFAR4b into the pBlu-gRNA vector.

4. The application according to claim 3, characterized in that, The recombinant plasmids are the GmFATB1a recombinant plasmid obtained by cloning the GmFATB1a expression cassette into the Cas9 vector, and the GmSFAR4a / GmSFAR4b recombinant plasmid obtained by cloning the GmSFAR4a / GmSFAR4b expression cassette into the Cas9 vector.

5. The application according to claim 3, characterized in that, The recombinant Agrobacterium is the GmFATB1a recombinant Agrobacterium obtained by introducing the GmFATB1a recombinant plasmid into Agrobacterium, and the GmSFAR4a / GmSFAR4b recombinant Agrobacterium obtained by introducing the GmSFAR4a / GmSFAR4b recombinant plasmid into Agrobacterium.

6. A method for creating soybeans through hybridization and polymerization of multi-gene editing materials, characterized in that, Includes the following steps: The recombinant Agrobacterium GmFATB1a and the recombinant Agrobacterium GmSFAR4a / GmSFAR4b described in claim 5 were respectively transfected into soybeans to be treated, and the resulting strains were screened to obtain the desired strains. gmfatb1a Mutant material A and gmsfar4a / 4b Double mutant material B; Material A and material B were crossed to obtain the F1 generation hybrids, and those carrying the same traits were screened. gmfatb1a Mutation sites and gmsfar4a / 4b Positive single plants with two mutation sites were continuously self-crossed for 3 to 4 generations to obtain soybeans with increased total fatty acid content, increased protein content, increased oleic acid content, decreased saturated fatty acid content, and stable yield.

Images