A specific molecular marker, primer pair, reagent kit, method, and application for identifying the sex of crucian carp.

By designing specific molecular marker primer pairs and using the β-actin internal reference gene for quality control, rapid and accurate identification of the genetic sex of crucian carp was achieved, solving the problems of complexity and destructiveness of traditional methods, and making it suitable for large-scale detection and breeding applications.

CN122405810APending Publication Date: 2026-07-17HUNAN NORMAL UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HUNAN NORMAL UNIVERSITY
Filing Date
2026-06-17
Publication Date
2026-07-17

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly, accurately, and reliably identify the genetic sex of crucian carp. Traditional methods are complex to operate and destructive to the fish, making them difficult to apply to early screening of live individuals and large-scale sample testing. Furthermore, the sex chromosomes of crucian carp are not highly differentiated, making it difficult to distinguish between male and female individuals based on chromosome morphology.

Method used

We designed specific molecular marker primer pairs, identified the sex of crucian carp by PCR amplification and agarose gel electrophoresis, and used β-actin internal reference gene for quality control. We developed a specific molecular marker kit to achieve rapid and accurate genetic sex identification.

Benefits of technology

It enables rapid and accurate identification of the genetic sex of crucian carp, reduces operational complexity and testing costs, is suitable for large-scale sample testing, and is applicable to professional laboratories and aquaculture enterprises, thereby improving breeding technology and economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122405810A_ABST
    Figure CN122405810A_ABST
Patent Text Reader

Abstract

This application relates to the fields of aquatic genetics and breeding and molecular biology, and provides a specific molecular marker, primers, kit, method, and application for identifying the sex of crucian carp. The molecular marker for identifying the sex of crucian carp is obtained by amplification using primers shown in SEQ ID NO:3 and SEQ ID NO:4; or by amplification using primers shown in SEQ ID NO:5 and SEQ ID NO:6. The kit includes primer pairs from any of the above-mentioned methods, and further includes a method for amplifying the sex of crucian carp. β‑actin A universal internal reference primer pair for the gene is provided. A method for identifying the genetic sex of white crucian carp is also provided. The above-mentioned molecular markers, primer pairs, kits, methods, and applications can rapidly, accurately, and reliably identify the genetic sex of white crucian carp.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the fields of aquatic genetics and breeding and molecular biology, specifically to a specific molecular marker, primer pair, reagent kit, method and application for identifying the sex of crucian carp. Background Technology

[0002] As lower vertebrates, fish exhibit significant diversity in speciation and sex determination mechanisms, with their sex determination methods jointly regulated by genetic and environmental factors. Sex determination, as a crucial biological process controlling the developmental direction of gonadal primordia and ultimately forming the sex of mature individuals, is not only an important biological characteristic of aquatic animals but also a core scientific issue in fish developmental biology, evolutionary biology, and genetic breeding research. Furthermore, in many economically important fish species, sex is often closely related to important economic traits such as growth rate, body size, and reproductive performance. Therefore, from both scientific research and industrial application perspectives, fish sex identification and sex control technologies have always received widespread attention.

[0003] Crucian carp is an important aquaculture species in the genus *Carassius*. Due to its strong adaptability, high reproductive capacity, and wide aquaculture base, it occupies an important position in aquaculture and genetic breeding, and is now widely used in freshwater aquaculture in my country. However, similar to most fish, in the juvenile and gonadal-immature stages, male and female crucian carp do not show significant differences in external morphology and general physiological characteristics, making it difficult to accurately distinguish their sex through visual observation or conventional morphological methods. Even in the stage when the gonads of some individuals are gradually developing, there is still a lack of stable and reliable criteria for external sexual characteristics, which seriously restricts the early sex identification and precision breeding of crucian carp.

[0004] Currently, sex determination in crucian carp mainly relies on anatomical observation of gonadal morphology or histological analysis of tissue sections. While these methods can determine sex to some extent, they suffer from drawbacks such as complexity, time-consuming procedures, and destructive effects on the fish, making them unsuitable for early screening of live individuals and large-scale sample testing, as well as for practical production needs such as parent stock preservation and the establishment of single-sex populations. Furthermore, similar to most fish species, crucian carp exhibit low differentiation of sex chromosomes, making it difficult to directly distinguish between males and females based on chromosome morphology, further complicating genetic sex determination.

[0005] With the development of molecular biology techniques, DNA molecular marker-based sex identification methods have been successfully applied in various fish species due to their advantages such as high accuracy, good stability, and independence from individual growth stages. However, to date, stable, reliable, and easy-to-use molecular markers for genetic sex identification in crucian carp are still relatively scarce, and a technical solution that can be widely promoted in breeding and production practices has not yet been formed. Summary of the Invention

[0006] This invention aims to solve the problem of the difficulty in identifying the genetic sex of white crucian carp in the prior art, and provides a specific molecular marker, primer pair, reagent kit, method and application for identifying the genetic sex of white crucian carp that can quickly, accurately and reliably identify the genetic sex of white crucian carp.

[0007] To achieve the above objectives, the first aspect of this application provides a specific molecular marker for identifying the sex of crucian carp, said molecular marker being obtained by amplification using primers as shown in SEQ ID NO: 3 and SEQ ID NO: 4; or by amplification using primers as shown in SEQ ID NO: 5 and SEQ ID NO: 6.

[0008] In one embodiment, the nucleotide sequence of the specific DNA fragment of the molecular marker is as shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0009] A second aspect of this application provides a primer pair for amplifying a specific molecular marker as described above, comprising DNA molecules as shown in SEQ ID NO: 3 and SEQ ID NO: 4, for amplifying SEQ ID NO: 1.

[0010] A third aspect of this application provides a primer pair for amplifying a specific molecular marker as described above, comprising DNA molecules as shown in SEQ ID NO: 5 and SEQ ID NO: 6, for amplifying SEQ ID NO: 2.

[0011] A fourth aspect of this application provides a kit for identifying the genetic sex of white crucian carp, the kit comprising primer pairs as described in any of the preceding claims, and a method for amplifying the genetic sex of white crucian carp. β-actin Universal internal reference primer pairs for genes.

[0012] In one embodiment, the kit further includes one or more of Taq DNA Polymerase, extension promoting factor, dNTPs, PCR reaction buffer system, and ddH2O.

[0013] The fifth aspect of this application provides a method for identifying the genetic sex of white crucian carp, including:

[0014] Genomic DNA samples were extracted from individual white crucian carp to be tested; Using the extracted genomic DNA sample as a template, primer pairs with any of the specific molecular markers mentioned above, as well as a general internal reference for white crucian carp, were employed. β-actin Gene primers were used for parallel PCR amplification, and the PCR amplification products were detected by agarose gel electrophoresis. If the electrophoresis results of specific primer amplification show a single specific DNA band, and the universal internal control... β-actin If the electrophoresis results of gene primer amplification show normal amplification of bands, then the tested white crucian carp individual is determined to be male; If general internal parameters β-actin If the electrophoresis results of gene primer amplification show normal amplification bands, and the electrophoresis results of specific primer amplification do not show specific amplification bands, then the tested white crucian carp individual is determined to be female; if the general internal control... β-actin If the electrophoresis results of gene primer amplification show no internal control band, it indicates that the DNA template quality is substandard or the PCR reaction system is ineffective, and the detection is invalid.

[0015] In one embodiment, the PCR amplification conditions are as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 56°C annealing for 15 s, 72°C extension for 15-30 s, for a total of 35 cycles; then 72°C final extension for 5 min, and finally stored at 4°C. The agarose gel electrophoresis was performed using 1.5% - 2.0% agarose gel, at a voltage of 100-220 V, for a running time of 15-20 min.

[0016] The method is applied to the early identification of parental genetic sex, screening of male and female parents, or construction of single-sex populations in the artificial breeding of crucian carp.

[0017] The sixth aspect of this application provides the application of the specific molecular markers, primer pairs, or kits described above in the sex identification, one-sex population construction, or sex-controlled breeding of crucian carp.

[0018] Compared with the prior art, the technical solution of this application has the following beneficial effects: This application discloses a specific molecular marker, primer pairs, kit, method, and application for sex identification of crucian carp. The specific molecular marker is a specific DNA fragment present only in the genome of male crucian carp. Amplification using specially designed primers yields accurate and reliable results, avoiding the subjectivity and instability of traditional morphological identification. It is particularly advantageous in early seedling identification, accurately guiding parent selection in artificial breeding. This provides a key technical means for efficiently constructing monosex aquaculture populations and conducting sex-controlled breeding, significantly improving the economic benefits and breeding technology level of the crucian carp aquaculture industry. Based on a conventional PCR platform, the invention features a standardized detection process and optimized amplification and electrophoresis procedures, enabling sex identification of large batches of samples in a short time. It boasts high detection efficiency and a low operational threshold. By introducing… β-actinThe internal reference gene, reagent kit, and identification method constitute a comprehensive internal quality control system, which can effectively monitor the effectiveness of the testing process, eliminate false negative interference, and ensure the authority and reliability of every identification result. This invention has low requirements for instruments and equipment, and controllable testing costs. It is not only suitable for professional research laboratories but also easier to popularize and apply in aquaculture enterprises and grassroots extension units, showing broad application prospects. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 The figure shows the alignment of primer pair A for white crucian carp to the reference genome based on whole-genome resequencing. The upper half of the track (gray area) represents the sequencing depth coverage of the female white crucian carp population, and the lower half of the track (blue area) represents the sequencing depth coverage of the male white crucian carp population.

[0021] Figure 2 The figure shows the alignment of the white crucian carp primer pair B to the reference genome based on the whole-genome resequencing sequence in Example 1. In the figure, the upper half of the track (gray area) represents the sequencing depth coverage of the female white crucian carp population, and the lower half of the track (blue area) represents the sequencing depth coverage of the male white crucian carp population.

[0022] Figure 3 This is an electrophoresis pattern diagram for genetic sex identification of a representative white crucian carp population using primer pair A of the present invention.

[0023] Figure 4 This is an electrophoresis pattern diagram for genetic sex identification of a representative white crucian carp population using primer pair B of the present invention. Detailed Implementation

[0024] To facilitate understanding of this application, the following description will be more comprehensive and detailed in conjunction with the accompanying drawings and preferred embodiments, but the scope of protection of this application is not limited to the following specific embodiments.

[0025] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of this application.

[0026] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0027] Example 1: Screening and primer design of specific molecular markers for identifying the sex of crucian carp This embodiment details the process of obtaining specific molecular markers and designing primers for identifying the sex of crucian carp. The specific steps are as follows: 1. Sample Collection: Sixty sexually mature and healthy adult white crucian carp were selected. Through live dissection and observation of the gonads (testes milky white, ovaries pale yellow and granular), 30 males and 30 females were accurately identified. Dorsal muscle tissue was collected and stored at -20℃.

[0028] 2. Genome resequencing: Genomic DNA was extracted from the above 60 samples, sequencing libraries were constructed, and whole-genome resequencing was performed using a high-throughput sequencing platform (Illumina NovaSeq) to ensure that the sequencing depth of each sample was not less than 10×.

[0029] 3. Bioinformatics Analysis and Marker Screening: Following the company's standard operating procedure for genome resequencing, tail fin tissues were collected from 30 male and 30 female crucian carp. Genomic DNA was extracted using a kit. After passing quality inspection, the DNA was sonicated to a main peak of approximately 350 bp. End repair, A-linking, and indexed Y-linkers were ligated using a universal library construction kit. Sequencing libraries with insert fragments of approximately 350–450 bp were obtained after magnetic bead sorting and PCR amplification. After the libraries passed quality control, sequencing was performed on the Illumina NovaSeq 6000 platform in PE150 mode, with a target sequencing depth of no less than 10× for each sample. After filtering low-quality sequences and adapter contamination using FASTP software, clean reads were obtained. Using the crucian carp reference genome (GCA_049309305.1) as a reference, sequence alignment was performed using the BWA-MEM algorithm. After deduplication, single-sample variant detection was performed using GATKHaplotypeCaller. All samples were then subjected to joint genotyping. After strict site quality control, a high-quality SNP set was obtained for subsequent male-female association analysis and sex-related site screening.

[0030] Given the extremely low degree of sex chromosome differentiation in crucian carp, this invention employs population segregation analysis (BSA) to deeply mine genome-wide variation sites in order to accurately pinpoint the sex-determining region. Specifically, based on the SNP datasets of the aforementioned male and female populations, three algorithms are jointly applied for cross-validation and core region localization: (1) calculating the fixation index (Fst) between male and female populations; (2) calculating the genetic distance between groups based on the Euclidean distance (ED) algorithm; and (3) statistically analyzing the differences in SNP allele frequencies and the number of differential variants between groups. Through the combined analysis of the above three methods, a large number of highly differentiated sites with extremely unbalanced genotype frequencies between male and female populations were found on chromosome 22B. Accordingly, this invention accurately locates the sex-determining core region (SDR) of crucian carp in a specific interval of approximately 1 Mb on chromosome Chr22B (37.0 Mb - 38.0 Mb region). After identifying this core associated region, to develop a dominant molecular marker with 100% accuracy, this invention further incorporates genome window coverage depth (SDR) analysis to search for male-specific structural variant sequences (present / deleted variants, PAVs) within this SDR region. See results below. Figure 1 and Figure 2 The upper half of the track (gray area) in the figure represents the sequencing depth coverage of the female white crucian carp population; the lower half of the track (blue area) represents the sequencing depth coverage of the male white crucian carp population.

[0031] By setting strict sequencing depth screening thresholds and excluding interference from highly repetitive sequences, the focus was on screening for specific sequence fragments with a coverage depth greater than 5× in all male samples (30 tails) and a coverage depth of 0 or close to background noise in all female samples (30 tails). Subsequently, the selected candidate regions were imported into IGV (Integrative GenomicsViewer) software for visualization verification. False positive fragments caused by sequencing errors and alignment anomalies were manually removed. Finally, a male-specific variant sequence was precisely located within the sex-determining core region of chromosome 22B, with its nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2. Based on this, the core target sequence fragment for subsequent primer design was extracted.

[0032] SEQ ID NO: 1: ATCCAGTCCTGTGCAAAGCATGATGGGAAGTGTAAAACTCAGTTTGAGGTACTTAACTGAAACATGTCCTTTCAAAATGAAACCTTTATGTTAAACCAACGAGTGACAGTTTTAAGTCAGTTTAACATGACACAATCATGTTGAAATGAAAAATAGTCAAAATGGCATTAATTCAACATGAATTGTTCAGGTAAAGTGAACAAAACTGAAAAATCATTTTTTTGAGTGTACCCAGCCTTAATTTAACCACGGTTGA SEQ ID NO: 2: TCTGCTATTCCACTTCTGACCCATTTTGAGCAAGCCCAACTTTACAGCAACCTTTCTAAAAGCTGTACACAAGATGGACAGATCATAAAGCCAGCGGTCCTC 4. Primer design: Based on the above sequence SEQ ID NO: 1 or SEQ ID NO: 2, design and synthesize primer sets. The sequences of primer pair A for amplifying SEQ ID NO: 1 are shown in SEQ ID NO: 3 and SEQ ID NO: 4; the sequences of primer pair B for amplifying SEQ ID NO: 2 are shown in SEQ ID NO: 5 and SEQ ID NO: 6.

[0033] The upstream forward primer F1 of primer pair A is 5′-ATCCAGTCCTGTGCAAAGCA-3′ (SEQ ID NO:3); Downstream reverse primer R1: 5′-TCAACCGTGGTTAAATTAAGGCT-3′ (SEQ ID NO: 4); The upstream forward primer F2 of primer pair B: 5′-TCTGCTATTCCACTTCTGACCC-3′ (SEQ ID NO: 5); Downstream reverse primer R2: 5′-GAGGACCGCTGGCTTTATG-3′ (SEQ ID NO: 6).

[0034] Example 2: Genetic sex molecular identification and method validation in a large population of white crucian carp This embodiment describes a double-blind assay on a large population sample of 60 white crucian carp of known sex. It details the complete process from DNA extraction and PCR amplification to electrophoresis detection and result interpretation. The accuracy and specificity of the primer set of this invention are fully verified through parallel detection of two target sites. The specific steps are as follows: 1. Sample collection and genomic DNA extraction Sixty adult white crucian carp of known anatomical sex (30 females and 30 males) were selected as a double-blind test sample. Approximately 20-30 mg of fin tissue was excised from each of the selected individuals and fixed in anhydrous ethanol. Total DNA was extracted from the samples using an animal genomic DNA extraction kit. DNA concentration and purity were measured using a micro-ultraviolet spectrophotometer. The extracted DNA was uniformly diluted to approximately 50 ng / μL and used as a template for subsequent PCR amplification.

[0035] 2. PCR amplification (parallel control method) To ensure the rigor of the test results and prevent false negatives due to DNA extraction failure or template degradation, and to comprehensively verify the effectiveness of the two pairs of specific primers, this embodiment employs a parallel testing strategy for all 60 samples. For each sample to be tested, a specific detection tube and a quality control tube are set up independently. Specifically, specific detection tube 1 (containing primer pair A of the present invention, hereinafter referred to as tube 1), specific detection tube 2 (containing primer pair B of the present invention, hereinafter referred to as tube 2), and quality control tube 3 (containing universal primers for crucian carp) are set up. β-actin Internal reference primer (hereinafter referred to as tube 3).

[0036] in,( β-actin -F): 5′- GCGTGGACATCAAGGAGAAG -3′ (SEQ ID NO: 7) ( β-actin -R): 5′-CTGGGGCAATGATCTTGATC -3′ (SEQ ID NO: 8) The total volume of the PCR system in each reaction tube was 10 μL. The specific preparation method was as follows: add 5 μL of 2× Rapid TaqMaster Mix, 0.4 μL each of 10 μM forward and reverse primers, 1 μL of DNA template, and finally add 3.2 μL of ddH2O to make up the total volume. After the system was prepared, PCR amplification was performed according to the following procedure: first, pre-denaturation at 95℃ for 5 min; then, 35 cycles of amplification were performed, each cycle including denaturation at 95℃ for 15 s, annealing at 56℃ for 30 s, and extension at 72℃ for 30 s; after the cycles, a final extension at 72℃ for 5 min was performed; finally, the tubes were stored at 4℃. After amplification, the PCR products from each tube were analyzed by agarose gel electrophoresis. Agarose gel electrophoresis was performed on a 2.0% agarose gel at 200 V for 15 min.

[0037] 3. Result Judgment Criteria Primer pair A and primer pair B can both be used independently as the basis for determining the genetic sex of white crucian carp. The specific criteria are as follows: (1) Male results: If the specific detection tube (tube 1 alone or tube 2 alone) amplifies the corresponding single specific band (the band corresponding to primer pair A is about 256 bp in size, and the band corresponding to primer pair B is about 102 bp in size), and the quality control tube (tube 3) amplifies the internal reference band normally, then the individual to be tested is determined to be male.

[0038] (2) Female result: If the internal control tube (tube 3) amplifies the internal reference band normally, and the specific detection tube (tube 1 or tube 2) does not amplify the band, then the individual to be tested is determined to be female.

[0039] (3) Invalid results: If there is no internal control band in the quality control tube (tube 3), it indicates that the DNA template quality is unqualified or the PCR reaction system is invalid. The test is invalid and the DNA of the sample needs to be extracted again and retested.

[0040] The sex of 60 white crucian carp was analyzed and determined using the above method.

[0041] 4. Analysis of Large-Scale Validation Results and Accuracy The comprehensive verification results of this embodiment are as follows: (1) Independent detection results of primer pair A: All 30 male individuals showed a single bright specific band at 256 bp in tube 1; no band was amplified in tube 1 of all 30 female individuals (electrophoresis results of some representative samples are shown in [reference]). Figure 3 ).

[0042] (2) Independent detection results of primer pair B: All 30 male individuals showed a single bright specific band at 102 bp in tube 2; no band was amplified in tube 2 of all 30 female individuals (electrophoresis results of some representative samples are shown in [reference]). Figure 4 ).

[0043] (3) Internal control verification results: using β-actin The primers were used to perform parallel tests on the 60 samples, and the results showed that the expected bright internal control band was successfully amplified in the quality control tube (tube 3) of all samples. This result fully confirms that the absence of the specific band in the female samples is indeed due to the absence of the male-specific marker in their genome, rather than due to experimental manipulation or sample degradation.

[0044] (4) Accuracy analysis: After double-blind comparison, the independent identification results of primer pair A and primer pair B of the present invention were completely consistent with the true anatomical sex of 60 white crucian carp individuals, and the identification accuracy rate reached 100%.

[0045] The above are merely preferred embodiments of this application. It should be noted that this application is not limited to the above embodiments. For those skilled in the art, several improvements and modifications can be made without departing from the principles of this application. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should also be considered within the scope of protection of this application.

Claims

1. A specific molecular marker for identifying the sex of white crucian carp, characterized in that, The molecular marker was obtained by amplification using primers as shown in SEQ ID NO: 3 and SEQ ID NO: 4; or by amplification using primers as shown in SEQ ID NO: 5 and SEQ ID NO:

6.

2. The specific molecular marker according to claim 1, characterized in that, The nucleotide sequence of the specific DNA fragment of the molecular marker is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

3. A primer pair for amplifying the specific molecular marker as described in claim 1, characterized in that, Includes DNA molecules as shown in SEQ ID NO: 3 and SEQ ID NO: 4, used to amplify SEQ ID NO:

1.

4. A primer pair for amplifying the specific molecular marker as described in claim 1, characterized in that, Includes DNA molecules as shown in SEQ ID NO: 5 and SEQ ID NO: 6, used to amplify SEQ ID NO:

2.

5. A kit for identifying the genetic sex of white crucian carp, characterized in that, The kit includes the primer pair as described in claim 3 or 4, and a method for amplifying white crucian carp. β-actin Universal internal reference primer pairs for genes.

6. The reagent kit according to claim 5, characterized in that, The kit also includes one or more of the following: Taq DNA Polymerase, elongation promoting factor, dNTPs, PCR reaction buffer system, and ddH2O.

7. A method for identifying the genetic sex of white crucian carp, characterized in that, include: Genomic DNA samples were extracted from individual white crucian carp to be tested; Using the extracted genomic DNA sample as a template, primer pairs with specific molecular markers as described in claim 3 or 4, and a universal internal reference for white crucian carp were employed. -Actin gene primers were used for parallel PCR amplification, and the PCR amplification products were detected by agarose gel electrophoresis; If the electrophoresis results of specific primer amplification show a single specific DNA band, and the universal internal control... If the electrophoresis results of the amplification of the -actin gene primers show normal amplification of bands, then the white crucian carp individual to be tested is determined to be male; If general internal parameters Electrophoresis results of amplification using -actin gene primers showed normal band amplification, while electrophoresis results of amplification using specific primers did not show specific amplification bands; therefore, the tested white crucian carp individual was determined to be female; if the general internal control... If the electrophoresis results of the amplification of the -actin gene primers show no internal control band, it indicates that the DNA template quality is unqualified or the PCR reaction system is ineffective, and the detection is invalid.

8. The method for identifying the genetic sex of white crucian carp according to claim 7, characterized in that, The PCR amplification conditions were as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 15-30 s, for a total of 35 cycles; then 72℃ final extension for 5 min, and finally stored at 4℃. The agarose gel electrophoresis was performed using 1.5% - 2.0% agarose gel, at a voltage of 100-220 V, for a running time of 15-20 min.

9. The method for identifying the genetic sex of white crucian carp according to claim 7, characterized in that, The method is applied to the early identification of parental genetic sex, screening of male and female parents, or construction of single-sex populations in the artificial breeding of crucian carp.

10. The application of a specific molecular marker as described in claim 1 or 2, a primer pair as described in claim 3 or 4, or a kit as described in claim 5 or 6 in the sex identification of crucian carp, the construction of a single-sex population of crucian carp, or sex-controlled breeding.