Primer-probe combinations and kits for detecting Mycobacterium tuberculosis and its fluoroquinolone resistance-related site variations.

Abstract

This invention relates to the field of molecular biology detection technology, and more particularly to a primer-probe combination product and kit for detecting Mycobacterium tuberculosis and its fluoroquinolone resistance-related site variations. This invention provides a multiplex quantitative PCR detection system based on a specific primer-probe combination, capable of simultaneously detecting Mycobacterium tuberculosis complex targets and fluoroquinolone resistance-related site coverage areas in a single reaction system. By optimizing primer and probe design, mutual interference between different amplification systems can be reduced, improving the stability and reproducibility of the multiplex detection system. This system exhibits good detection sensitivity and specificity, and can be used for rapid detection of Mycobacterium tuberculosis, and can also assist in determining whether fluoroquinolone resistance-related site variations exist in the regions covered by gyrA and gyrB, thereby helping to improve detection efficiency and reduce operational complexity.

Description

Technical Field

[0001] This invention relates to the field of molecular biology detection technology, and in particular to a primer-probe combination product and kit for detecting Mycobacterium tuberculosis and its fluoroquinolone resistance-related site variations. Background Technology

[0002] Tuberculosis (TB) is a chronic respiratory infectious disease caused by Mycobacterium tuberculosis. According to the World Health Organization (WHO) 2025 Global TB Report, there were 10.7 million new TB cases globally in 2024, with an incidence rate of 131 per 100,000, a 1% decrease compared to 2023. TB deaths totaled 1.25 million, a 3% decrease compared to 2023, making it one of the top ten causes of death globally and the leading cause of death from a single source of infection. my country is one of the 30 countries with a high TB ​​burden globally, with an estimated 696,000 new TB cases in 2024. 21% of patients remain undiagnosed, indicating that early and accurate diagnosis remains the weakest link in the entire TB management process. Etiological detection technology is the primary basis for detecting and diagnosing TB. In 2023, the global positivity rate for TB was 62%, while the positivity rate in my country was 67%, slightly higher than the global average.

[0003] To effectively treat tuberculosis and control its spread, anti-tuberculosis drugs (including first-line and second-line drugs) are widely used worldwide. However, in recent years, the emergence and spread of drug-resistant Mycobacterium tuberculosis, especially multidrug-resistant (resistant to two first-line drugs, such as isoniazid and rifampin) and extensively drug-resistant (resistant to any fluoroquinolone and any injectable second-line drug in addition to multidrug resistance) tuberculosis, has further worsened the treatment and control of tuberculosis. The World Health Organization estimates that in 2024, there will be an estimated 28,000 new cases of multidrug-resistant / rifampin-resistant tuberculosis, accounting for 7.1% of the global total.

[0004] The detection of Mycobacterium tuberculosis has expanded from its previous focus on identifying infectious pulmonary tuberculosis patients through sputum smear microscopy to a broader range of services, including bacteriological diagnosis and diagnosis of drug-resistant tuberculosis. Drug susceptibility testing of Mycobacterium tuberculosis is an essential tool in the prevention and control of drug-resistant tuberculosis. Its main functions are to diagnose drug-resistant tuberculosis, select and adjust treatment regimens for drug-resistant tuberculosis, and conduct drug resistance surveillance to understand the drug resistance level of Mycobacterium tuberculosis in a given region. Currently, traditional laboratory diagnostic techniques for drug-resistant tuberculosis mainly rely on Mycobacterium tuberculosis culture and drug susceptibility testing. As the gold standard for tuberculosis diagnosis, Mycobacterium tuberculosis culture requires high biosafety levels in the laboratory, and due to the slow growth of bacteria, the culture time is long (4–8 weeks). This test also has the disadvantages of high laboratory requirements and long time consumption. Therefore, it is particularly important to find methods for rapid diagnosis of active tuberculosis and drug-resistant tuberculosis.

[0005] Tuberculosis treatment requires long-term use of multiple medications; however, Mycobacterium tuberculosis strains can develop resistance to one or more drugs, making a cure difficult. Fluoroquinolones are an important component of second-line anti-tuberculosis drugs. Due to their good early bactericidal effect in vivo, they are recommended as an alternative drug to shorten the chemotherapy time for tuberculosis patients. The site of action of fluoroquinolones in Mycobacterium tuberculosis is a DNA topoisomerase, which includes two subunits, A and B, encoded by the gyrA and gyrB genes, respectively. Furthermore, the main molecular mechanism of resistance to fluoroquinolones in Mycobacterium tuberculosis involves mutations in the quinolone resistance determining region (QRDR) of the gyrA and gyrB genes. Current research suggests that the QRDR of the gyrA gene is codons 74-113, with mutations mainly occurring at single-point mutations at codons 94, 90, and 91. Mutations in the gyrB gene are often accompanied by mutations in the QRDR of the gyrA gene, with the main mutations occurring at codons 538-540.

[0006] In recent years, many rapid molecular diagnostic methods for drug resistance of Mycobacterium tuberculosis have been developed, such as reverse dot blot hybridization, polymerase chain reaction-single strand conformation polymorphism analysis (PCR-SSCP), and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, these methods are often time-consuming, involve complicated steps, and are prone to contamination, which makes them unsuitable for widespread clinical use.

[0007] Multiplex quantitative PCR is a multiplex detection technology developed based on real-time quantitative PCR. It can amplify and specifically detect multiple target genes in the same reaction tube. In the clinical application of pathogen detection, several target genes in the same sample can be detected simultaneously, which is conducive to rapid identification of pathogens and early, rapid and precise treatment of diseases. The successful implementation of multiplex PCR technology requires solving the following key technical problems: (1) Since multiple primer / probe combinations are required, cross-linking between different primers / probes should be avoided during the design. (2) Cross-homology between each primer / probe and other target and non-target nucleic acid sequences should be avoided to prevent false positive results. (3) The optimal amplification conditions for each amplification target are different. It is necessary to optimize the reaction conditions to ensure that each amplification target can be successfully amplified under single amplification conditions. (4) An internal control is needed as a reference to eliminate interference from nucleic acid extraction and other aspects. Summary of the Invention

[0008] This invention covers the following technical solutions: One aspect of the present invention relates to a primer-probe combo product comprising a) to c): a) The primer pairs shown in SEQ ID NO: 1-2 and the probe shown in SEQ ID NO: 3; b) The primer pairs shown in SEQ ID NO: 4-5 and the probe shown in SEQ ID NO: 6; c) The primer pairs shown in SEQ ID NO: 7-8 and the probe shown in SEQ ID NO: 9.

[0009] Another aspect of the invention relates to a kit containing the primer-probe combination product as described above.

[0010] Another aspect of the present invention relates to the use of the primer-probe combination product as described above in the preparation of a kit for detecting Mycobacterium tuberculosis and its fluoroquinolone resistance-related site variations.

[0011] This invention provides a multiplex quantitative PCR detection system based on a specific primer-probe combination, capable of simultaneously detecting Mycobacterium tuberculosis complex targets and gyrA and gyrB-related coverage regions in a single reaction system. Optimized primer and probe design helps reduce mutual interference between different amplification systems, improving the stability and reproducibility of the multiplex detection system. The system can rapidly detect Mycobacterium tuberculosis and, provided the sample meets preset interpretation conditions, assists in determining whether there are fluoroquinolone resistance-related site variations in the gyrA and gyrB-covered regions, thereby improving detection efficiency and simplifying the operation process. Attached Figure Description

[0012] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0013] Figure 1 A. A. gyrA; B. gyrB; C. IS6110; D. Internal control (IC) : Single-pair quantitative PCR (molecular beacon method) to detect amplification curves of different genes;

[0014] Figure 2 The results of the four-fold combination of tests include gyrA, gyrB, IS6110, and IC.

[0015] Figure 3 The results of the validation of the quadruple real-time PCR system's ability to recognize gyrA and gyrB mutant templates.

[0016] Figure 4 The results of validation of the ability of the quadruple real-time PCR system to recognize gyrA mutant templates.

[0017] Figure 5 The results of validation of the ability of the quadruple real-time PCR system to recognize the gyrB mutant template.

[0018] Figure 6 ROC curves for clinical samples constructed based on comprehensive interpretation results.

[0019] Figure 7 : Schematic diagram of the detection result interpretation process. Detailed Implementation

[0020] Reference will now be made to detailed embodiments of the present invention, one or more of which are described below. Each example is provided for explanation and not for limitation of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the invention without departing from its scope or spirit. For example, features described or illustrated as part of one embodiment may be used in another embodiment to produce further embodiments.

[0021] Unless otherwise stated, all terms used to disclose this invention (including technical and scientific terms) should be understood to have the meaning commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein is for the purpose of describing specific embodiments only and is not intended to constitute any limitation on the scope of protection of this invention. Unless the context clearly defines otherwise, the scientific and technical terms used herein, as well as terms and laboratory procedures in related fields such as protein and nucleic acid chemistry, molecular biology, and microbiology, are all conventional terms and standard methods well-known and widely used in the art. To facilitate understanding of the technical solutions of this invention, some related terms are further defined and explained below.

[0022] As used herein, the terms “and / or,” “or / and,” and “and / or” encompass any one of two or more of the relevant listed items, as well as any and all combinations of the relevant listed items, including any two of the relevant listed items, any more of the relevant listed items, or a combination of all the relevant listed items.

[0023] The terms “containing,” “comprising,” and “including” as used in this invention are synonyms and are inclusive or open-ended, not excluding additional, uncited members, elements, or method steps.

[0024] In this invention, the numerical range represented by endpoints includes all numerical values ​​and fractions contained within that range, as well as the endpoints mentioned.

[0025] Furthermore, in describing representative embodiments of the invention, this specification may present the methods and / or processes of the invention as a specific sequence of steps. However, the method or process should not be limited to the specific order of the steps described herein, to the extent that the method or process does not depend on the specific order of the steps presented herein. As will be understood by those skilled in the art, other sequences of steps are also possible. Therefore, the specific order of steps presented in the specification should not be construed as a limitation of the claims. Additionally, the claims relating to the methods and / or processes of the invention should not be limited to the execution of their steps in the order they are written, and those skilled in the art will readily recognize that the sequence can be changed while still remaining within the spirit and scope of the invention.

[0026] This invention relates to concentration values, which include fluctuations within a certain range. For example, fluctuations are allowed within a corresponding precision range. For instance, 2% can fluctuate within ±0.1%. For larger values ​​or values ​​that do not require overly precise control, even greater fluctuations are permitted.

[0027] As used in this invention, unless otherwise stated, the singular forms of the articles “a,” “an,” and “the” include plural referents.

[0028] In this invention, the terms "multiple" or "various" are used unless otherwise specified, referring to a quantity greater than or equal to 2.

[0029] In this invention, the technical features described in an open-ended manner include both closed-ended technical solutions composed of the listed features and open-ended technical solutions that include the listed features.

[0030] In this invention, terms such as "preferred," "better," "more suitable," and "ideal" merely describe implementation methods or embodiments with better effects and should be understood not to limit the scope of protection of this invention. In this invention, terms such as "optionally," "optionally," and "optional" mean that something is optional, that is, selected from either "with" or "without" a parallel solution. If multiple "optional" statements appear in a technical solution, unless otherwise specified and without contradiction or mutual constraint, each "optional" statement is independent.

[0031] In this invention, the term "primer" refers to an oligonucleotide sequence that can specifically bind to a target nucleic acid sequence and guide the extension of nucleic acid under the action of DNA polymerase. It typically includes a pair of forward and reverse primers to achieve specific amplification of the target fragment.

[0032] In this invention, the term "probe" refers to an oligonucleotide molecule that can specifically bind to the amplification product and generate a fluorescent signal during nucleic acid amplification. One end of the probe is labeled with a fluorescent reporter group, and the other end is labeled with a quencher group. When the probe is not cleaved or undergoes a conformational change, its fluorescence is suppressed.

[0033] In this invention, the term "self-quenched probe" refers to a class of single-stranded oligonucleotide molecules with a fluorescent group and a quenching group attached to their 5′ and 3′ ends, respectively. When the probe is in a free or unbound state, the spatial distance between the fluorescent group and the quenching group is close or they are energy-coupled, causing the fluorescence energy to be partially or completely quenched. When the probe binds to a complementary target nucleic acid, is cleaved by a nuclease, or undergoes a conformational change, the energy transfer between the fluorescent group and the quenching group is interrupted or the distance increases, thereby releasing a detectable fluorescent signal. Thus, the probe itself can generate and eliminate the signal without the need for an external colorimetric or second reporter system.

[0034] In some alternative implementations, linearly cleaving probes may also be used. These linearly cleaving probes are oligonucleotide probes labeled with a fluorescent reporter group at the 5' end and a quencher group at the 3' end, which can generate a fluorescent signal during PCR amplification via the 5'→3' exonuclease activity of DNA polymerase. The present invention preferably employs stem-loop molecular beacon (MB) probes.

[0035] In this invention, the term "multiplex fluorescent PCR" refers to a nucleic acid amplification technique that uses multiple sets of primers and probes simultaneously in the same reaction system and performs parallel amplification and detection of multiple target sequences through different fluorescence channels.

[0036] In this invention, the term "kit" refers to any article (e.g., packaging or container) that includes at least one device and comprises the detection reagents as described in this disclosure. The kit may further include instructions for use, supplementary reagents, and / or components or parts used in the methods or steps described in this disclosure.

[0037] In this invention, the term "stabilizer" refers to auxiliary components used to maintain the stability of enzyme activity and overall performance in a PCR reaction system, including but not limited to protein stabilizers, polyols, and surfactants.

[0038] This invention relates to a primer-probe combo product comprising a) to c): a) The primer pairs shown in SEQ ID NO: 1-2 and the probe shown in SEQ ID NO: 3; b) The primer pairs shown in SEQ ID NO: 4-5 and the probe shown in SEQ ID NO: 6; c) The primer pairs shown in SEQ ID NO: 7-8 and the probe shown in SEQ ID NO: 9.

[0039] The primer-probe combination product of this invention can improve the stability and reliability of multiplex detection systems while ensuring detection sensitivity, which is beneficial for the subsequent construction of rapid and accurate nucleic acid detection methods.

[0040] In some embodiments, an internal control primer probe is also included. Introducing an internal control into the detection system facilitates effective monitoring of the nucleic acid extraction and amplification processes, enabling the differentiation between true negative results and false negative results caused by extraction failure, amplification inhibition, or abnormal reactions during result interpretation. The internal control is preferably an exogenous, artificially synthesized nucleic acid fragment, preferably the sequence shown in SEQ ID NO:13. SEQ ID NO:10 and SEQ ID NO:11 are the upstream and downstream primers located at the two ends of SEQ ID NO:13, respectively, and SEQ ID NO:12 is the probe located within the amplification region. The length of the internal control amplification fragment is preferably 140 bp. The internal control sequence preferably does not undergo specific homologous amplification with the Mycobacterium tuberculosis complex nucleic acid sequence, and is used to monitor whether the nucleic acid extraction and amplification processes are proceeding normally, thereby improving the reliability and reproducibility of the detection results.

[0041] In some embodiments, the internal control primer probe includes d): the primer pair shown in SEQ ID NO: 10-11 and the probe shown in SEQ ID NO: 12. By co-configuring the internal control primer probe combination with primer probe combinations of other target genes in the same reaction system, and optimizing its concentration and reaction conditions, it can stably amplify the target gene without significantly affecting its amplification efficiency. This enables real-time monitoring of the reaction process in a multiplex detection system, which is beneficial for further improving the stability of the detection system and the accuracy of result interpretation.

[0042] Additionally, it should be noted that, in one respect, the concept of useful primers and probes should include nucleotide sequences having greater than 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the primers or probes shown in any one or more of SEQ ID NO: 1–12. Modifications of such primers and probes, and their ability to be prepared according to standard techniques, are also considered.

[0043] The term "%identity" in the context of two or more nucleotide or amino acid sequences refers to two or more sequences or subsequences that are identical or have a specific percentage of the same amino acid residues or nucleotides when compared and aligned for maximum correspondence, as measured by one of the following sequence comparison algorithms or by visual inspection. For example, %identity is relative to the entire length of the coding region of the sequences to be compared.

[0044] For sequence comparisons, a sequence is typically used as a reference sequence, and the test sequence is compared to this sequence. When using a sequence comparison algorithm, the test and reference sequences are input into the computer, and subsequence coordinates are specified if necessary, along with the sequence algorithm program parameters. The sequence comparison algorithm then calculates the percentage sequence identity of the test sequence relative to the reference sequence based on the specified program parameters. Percentage identity can be determined using search algorithms such as BLAST and PSI-BLAST (Altschul et al., 1990, J Mol Biol 215:3, 403-410; Altschul et al., 1997, Nucleic Acids Res25:17, 3389-402).

[0045] Primer and probe modifications can be performed using well-known methods. Modified versions of these primer and / or probe sequences may include, by non-limiting examples, adding one or more nucleotides to the 5' end, adding one or more nucleotides to the 3' end, adding one or more nucleotides to both the 5' and 3' ends, adding a tail, shortening the sequence, lengthening the sequence, shifting the sequence upstream or downstream by several bases, or any combination thereof.

[0046] Base modifications, such as 3'P, 5'P, 5-nitroindole, 2-aminopurine, 8-amino-2'-deoxyadenosine, C-5-propynyl-deoxycytidine, C-5-propynyl-deoxyuridine, 2-amino-2'-deoxyadenosine-5'-triphosphate, 2,6-diaminopurine (2-amino-dA), reversed-dT, reversed-dideoxy-T, hydroxymethyl-dC, iso-dC, 5-methyl-dC, aminoethyl-phenoxazine-deoxycytidine, and locked nucleic acids (LNAs), including at least one mismatched base at one of the bases, or replacing at least one of the bases with an RNA base, can achieve, for example, increased nucleic acid interaction at the 3' end of mutant-specific primers to increase Tm. The addition of stable double-stranded base modifications has a positive effect on PCR, enabling it to be performed at higher temperatures, within which Taq polymerase is known to exhibit maximum activity. Modified probes should retain the ability to distinguish between the mutant and wild-type sites to be detected.

[0047] In some embodiments, the probes are all self-quenching probes. Self-quenching probes known in the art can include various conformations or mechanisms of action; as long as they possess the characteristic of achieving fluorescence quenching and de-quenching through intramolecular or intermolecular energy transfer, they can be considered as "self-quenching probes" of this invention. These probes can be used in real-time fluorescence PCR, melting curve analysis, isothermal amplification, or multiplex amplification systems to achieve qualitative or quantitative detection of nucleic acid targets. The specific form of the self-quenching probe is not limited to any particular structure, but preferably includes, but is not limited to, the following subtypes: stem-loop molecular beacon (MB), linear cleavage probes (TaqMan probes), built-in probes (Scorpion, LUX, or Amplifluor, etc.), and FRET-based dual-probe systems. In a preferred embodiment of this invention, the probe used for detecting gyrA and gyrB is preferably a stem-loop molecular beacon (MB) probe.

[0048] In some embodiments, the fluorescent emitting groups of each probe are independently selected from any one of AMCA, Pacific Blue, Atto 425, BODIPY FL, FAM, Alexa Fluor 488, TET, JOE, Yakima Yellow, VIC, HEX, Quasar 570, Cy3, NED, TAMRA, ROX, Aqua Phluor 593, TexRed, Atto 590, Cy5, Quasar 670, and Cy5.5.

[0049] In some embodiments, the quenching groups of each probe are independently selected from any one of BHQ1, BHQ2, BHQ3, Dabcyl, Eclipse, and MGB.

[0050] The present invention also relates to a kit containing the primer-probe combination product as described above.

[0051] In some embodiments, the kit further contains one or more of the following: nucleic acid extraction reagents, PCR amplification reagents, positive controls, negative controls, and internal controls.

[0052] The nucleic acid extraction reagent and PCR amplification reagent can be flexibly configured according to the detection purpose and device structure.

[0053] Furthermore, the nucleic acid extraction reagent may include any one or more of lysis buffer, washing buffer, and elution buffer. The lysis buffer may contain surfactants (such as Triton X-100, Tween-20, SDS), protein denaturants (such as guanidine salts, urea), chelating agents (such as EDTA), and buffer components; the washing buffer may contain appropriate amounts of alcohols or salts to remove impurities; the elution buffer is typically a low-salt buffer or nuclease-free water. The extraction method is not limited to any specific technical route and may include silica-based membrane adsorption, magnetic bead methods, or direct lysis amplification methods, etc. Those skilled in the art can select a suitable extraction scheme based on the detection equipment.

[0054] The positive control is used to verify the detection system's ability to detect the target nucleic acid; the negative control is used to monitor for contamination in the system; and the internal control is used to monitor whether the extraction and amplification processes are proceeding normally. These components can be combined and configured according to actual needs to adapt to different detection scenarios.

[0055] In some preferred embodiments, the components of the kit can be pre-prepared in a certain proportion and provided in single or multiple tubes for direct use in actual testing. By rationally setting positive and negative controls, and using internal controls, it is beneficial to control the quality of the entire testing process, thereby improving the stability and reliability of the test results while ensuring ease of operation.

[0056] In some embodiments, the PCR amplification reagent includes DNA polymerase, a buffer system, dNTPs, and Mg. 2+ One or more of the following: stabilizers.

[0057] The DNA polymerase can be a thermostable DNA polymerase, such as Taq DNA polymerase, hot-start Taq DNA polymerase, Hot Start Taq, Tth DNA polymerase or its modified enzymes; in some embodiments, engineered polymerases with higher amplification efficiency or inhibition resistance can also be selected.

[0058] The buffer system is preferably used to maintain a suitable ionic strength and pH environment, and may include Tris-HCl buffer, KCl, (NH4)2SO4, or a combination thereof. The pH of the buffer system is preferably 7.5–9.0, more preferably about 8.0–8.8, or any intermediate value thereof, to facilitate the maintenance of DNA polymerase activity and the stability of the amplification reaction. The Mg... 2+ It can exist in MgCl2 or its equivalent form, and its concentration can be adjusted according to the primer and probe system, for example, from 1 mM to 6 mM or any intermediate value, to optimize amplification efficiency and specificity.

[0059] The stabilizer can be a component used to improve enzyme stability and the system's resistance to interference, such as protein stabilizers (e.g., bovine serum albumin), polyols (e.g., glycerol, trehalose, sorbitol), nonionic surfactants (e.g., Tween-20, NP-40), and other additives that improve amplification performance (e.g., betaine, DMSO). By introducing these stabilizers, the stability of the reagents during storage, transportation, and repeated freeze-thaw cycles can be improved to a certain extent, and the inhibitory effect of complex sample matrices on the PCR reaction can be reduced, thereby improving the repeatability and reliability of the detection results.

[0060] The components in the kit can be packaged in the form of solutions, solids, or test strips. Premixed or lyophilized forms are preferred to allow for rapid reconstitution and stable storage. In some preferred embodiments, at least one component of the reagent or kit is a solid, including at least one of lyophilized microspheres, lyophilized cakes, lyophilized powders, or spots formed on the surface of a solid carrier. Therefore, components required for nucleic acid amplification (and preferably nucleic acid detection) can be provided in lyophilized form, particularly various enzymes, nucleic acid components, and reaction buffer components. In this way, the nucleic acid amplification (and preferably nucleic acid detection) process can be started directly in a user-friendly manner by adding the sample to be quantified and optionally other required components.

[0061] The present invention also relates to the use of the primer-probe combination product as described above in the preparation of a kit for detecting Mycobacterium tuberculosis and its fluoroquinolone resistance-related site variations.

[0062] By combining the primer-probe combination with PCR amplification reagents and other auxiliary components, a multiplex detection system for Mycobacterium tuberculosis nucleic acid detection can be constructed. This primer-probe combination can simultaneously detect Mycobacterium tuberculosis-specific genes and genes associated with fluoroquinolone resistance, thereby obtaining multiple detection signals in the same reaction system, which improves detection efficiency and simplifies the operation process.

[0063] The present invention also relates to a method for detecting Mycobacterium tuberculosis and its fluoroquinolone resistance-related site variations, comprising the following steps: (1) obtaining nucleic acid samples; (2) performing multiplex fluorescent PCR amplification using primer-probe combination products as described above; and (3) interpreting the results based on the IS6110, gyrA, gyrB and internal control channel signals.

[0064] In some implementations, when a valid amplification signal appears in the IS6110 channel and the sample is in a low load range or close to the detection limit, if no valid amplification signal appears in the gyrA or gyrB channel, the result is determined to be suspicious or unreadable.

[0065] In this invention, the detection method is used to detect Mycobacterium tuberculosis and its fluoroquinolone resistance-related mutations in a test sample. The test sample can be a biological sample derived from a subject, including but not limited to sputum, bronchoalveolar lavage fluid, lung tissue samples, or other respiratory-related samples. Preferably, after obtaining the nucleic acid sample, multiplex quantitative PCR amplification is performed using a primer-probe combination containing targets for IS6110, gyrA, and gyrB to obtain amplification signals from multiple detection channels in the same reaction system. By setting up an internal control system, the nucleic acid extraction and amplification process can be monitored, thereby facilitating the differentiation between true negative results and false negative results caused by extraction failure or amplification inhibition.

[0066] Regarding result interpretation, please refer to Figure 7 The content is shown below. First, the presence of Mycobacterium tuberculosis in the sample is determined based on the IS6110 channel. When no effective amplification signal appears in the IS6110 channel, it can be determined that Mycobacterium tuberculosis is not detected in the sample, and further analysis of drug resistance-related sites is not performed on the gyrA and gyrB channels. When an effective amplification signal appears in the IS6110 channel, it indicates the presence of Mycobacterium tuberculosis in the sample. Based on this, further analysis is performed on whether there are site variations related to fluoroquinolone resistance in the covered area, combining the amplification status of the gyrA and gyrB channels. Furthermore, when the sample is not in a low-load range, if both gyrA and gyrB channels show effective amplification signals, it indicates that no detection results indicating site variations were detected in the area covered by the detection system; if either gyrA or gyrB channel shows no effective amplification signal, the Ct value reaches or exceeds the threshold (e.g., Ct ≥ 29), or the amplification curve is abnormal, it suggests that site variations may exist in the corresponding covered area. However, when samples are in the low load range or close to the detection limit, due to the sensitivity differences between different detection targets, it is possible that the IS6110 channel may be detected while the gyrA or gyrB channel is not. In such cases, it is not advisable to make a drug resistance judgment based solely on the result of a single channel. It is preferable to classify such results as suspicious or uninterpretable, and recommend further confirmation through retesting or combining sequencing and drug sensitivity testing. This interpretation strategy helps reduce the risk of misjudgment caused by low load samples, improving the reliability of test results and their clinical application value.

[0067] In some cases, amplification failure may also be related to factors such as template quality, local sequence differences, or amplification inhibition. Therefore, it is preferable to combine retesting or other methods for comprehensive judgment.

[0068] In this invention, the term "low load range" describes a state in which the content of target nucleic acids in a sample is at a low level, which may affect the stable amplification of some detection targets. Generally, the low load range can be understood as a range above the detection limit of Mycobacterium tuberculosis-specific targets (such as IS6110) but below the detection limit of fluoroquinolone resistance-related site detection targets (such as gyrA and gyrB). In some preferred embodiments, this range may correspond to a range of approximately 10 to 100 bacteria / mL or an equivalent nucleic acid copy number range. However, it should be understood that the numerical range is only an exemplary range obtained based on a specific system and experimental conditions. Under different detection systems, primer-probe combinations, instrument platforms, or sample types, the specific values ​​of the above range may vary. Therefore, the low load range can also be expressed as a range close to the lower detection limit or a range in the overlapping area of ​​different detection target sensitivities, such as including but not limited to approximately 5 to 200 bacteria / mL (e.g., 10, 20, 30, 50, 100, 150, 180) or other equivalent ranges related to the detection limit. Preferably, when the sample is in the aforementioned low loading range or close to the detection limit, the interpretation of drug resistance-related sites should be combined with the amplification curve characteristics, Ct value distribution, and retest results for comprehensive analysis, so as to reduce the risk of misjudgment due to insufficient template amount.

[0069] The embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that these embodiments are only used to illustrate the technical content of the present invention and are not intended to limit the scope of protection of the present invention. Unless otherwise specified, the specific experimental conditions in the following embodiments are given priority reference to the guidelines provided in this specification, or may be carried out according to generally accepted experimental manuals or conventional experimental conditions, or other experimental methods known in the art, or according to the conditions recommended by the relevant reagent or instrument manufacturers. In specific embodiments, unless otherwise specified, minor deviations within the weighing accuracy range are allowed for the measurement parameters involving raw material components; reasonable deviations due to instrument detection accuracy or operational accuracy are also allowed for parameters such as temperature and time.

[0070] Example 1: Singleton quantitative real-time PCR detection of Mycobacterium tuberculosis and two drug resistance genes 1.1 Preparation of primer sets for real-time PCR The nucleic acid sequences of the Mycobacterium tuberculosis-specific gene IS6110 and the gyrA and gyrB genes associated with fluoroquinolone resistance were obtained from GenBank. Homology comparison analysis was performed to determine the conserved sequence regions of each target. Then, three pairs of specific primers and three probes were designed within the corresponding regions using Primer Premier 3.0 software. Simultaneously, one pair of primers and one probe were designed for an exogenous synthetic internal control template. The probe designed for gyrA covers sites 88-94 that induce fluoroquinolone resistance, and the probe designed for gyrB covers sites 538-540 that induce fluoroquinolone resistance.

[0071] The detection principle of this kit is that when a valid amplification signal appears in the IS6110 channel of the test sample, it indicates the detection of Mycobacterium tuberculosis complex. On this basis, if valid amplification signals appear in both the gyrA and gyrB corresponding channels, it indicates that no corresponding site variation was detected in the area covered by the kit. If no valid amplification signal appears in any corresponding channel, the Ct value exceeds the threshold range, or the amplification curve is obviously abnormal, it indicates that there may be a site variation in the corresponding covered area.

[0072] To reduce the risk of misinterpretation due to low sample load, gyrA / gyrB results are only interpreted when the IS6110 channel meets the preset valid detection conditions. If IS6110 is positive but the sample is in a low-load range close to the detection limit, gyrA / gyrB will not be detected and will only be interpreted as "result suspicious or uninterpretable, retesting or confirmation with sequencing / drug susceptibility testing results recommended". Note: When the sample is positive for Mycobacterium tuberculosis, the IC can be positive or negative, but when the sample is negative for Mycobacterium tuberculosis, the IC must be positive. Negative and positive controls must be set up for each experiment, and the internal control needs to be added to the sample for extraction. The internal control is preferably an exogenous synthetic nucleic acid fragment designed with reference to maize-related sequences; the specific sequence is shown in SEQ ID NO:13. SEQ ID NO:10 and SEQ ID NO:11 are the upstream and downstream primers of this internal control, respectively, and SEQ ID NO:12 is the probe located inside the amplification region. The length of the amplified internal control amplicon is 140 bp. The primer pairs and probe sequences for real-time PCR detection of Mycobacterium tuberculosis-specific genes, two fluoroquinolone-resistant genes, and the internal control gene are shown in Table 1.

[0073] Table 1

[0074] SEQ ID NO:13: tgataatcta tcgaggtact ggagttgtaa aactatcctc ttcaactgaccaaacaacac atcccatcaa ttagtcagta actcagtatc agccaagggt gttgtattta cagaaattacatcctctggt aaaactagat gcgtctgtta.

[0075] 1.2 Preparation of DNA Reference Materials Based on the conserved sequence regions of different gene targets, four genes (IS6110, gyrA, gyrB, and the internal control gene IC) were constructed using the PUC57 plasmid as a vector and the multiple cloning site EcoRV as the insertion site. These plasmids were then inserted into three separate plasmids and one internal control plasmid. After each plasmid was calibrated using standards, each gene was serially diluted 10-fold with sterile purified water, starting from 1×10⁻⁶. 4 10 cells / mL serially diluted to 1×10 1 bacteria / mL.

[0076] 1.3 Singleton Real-Time PCR Detection of DNA Pathogens Three DNA genes and one internal control gene were detected by singleton quantitative real-time PCR, using the DNA gene detection primers and probes listed in Table 1.

[0077] Single gene detection reaction system: Take 5 μl of DNA template (final template concentration is 1×10⁻⁶). 4 bacteria / mL, 1×10 3 bacteria / mL, 1×10 2 bacteria / mL and 1×10 1 Add 12.5 μl of 2x amplification buffer, a gene primer and probe set (final primer concentration 0.5 μM, final probe concentration 0.3 μM), and then add sterile purified water to a total volume of 25 μL.

[0078] Three targets and one internal control were detected using the following program on a Shanghai Hongshi SLAN-96S real-time quantitative PCR instrument: 94℃ for 60 seconds; 94℃ for 10 seconds, 71℃ for 15 seconds (decreasing by 1℃ per cycle), 72℃ for 15 seconds, 10 cycles; 94℃ for 10 seconds, 61℃ for 30 seconds, 72℃ for 15 seconds, 40 cycles, with fluorescence signals (FAM, HEX, TexRed, CY5) collected at 60℃.

[0079] Results: The amplification curve is as follows Figure 1As shown. The template concentrations were 10,000 bacteria / mL, 1,000 bacteria / mL, 100 bacteria / mL, and 10 bacteria / mL, respectively.

[0080] Example 2: Optimized multiplex quantitative PCR detection of Mycobacterium tuberculosis and fluoroquinolone resistance genes 2.1 Preparation of DNA Reference Standards 10 reference samples per plasmid 5 The stock solution was prepared using a concentration of 1 bacterial cell / mL as a multiplex (each containing 2 genes and 1 internal control) of control plasmids, with each plasmid having a concentration of 1 × 10⁻⁶. 4 bacteria / mL, 1×10 3 bacteria / mL, 1×10 2 bacteria / mL and 1×10 1 Single bacteria / mL, single gene detection reaction system: Use 5μl of amplicon as template (template concentration is 1×10⁻⁶). 4 bacteria / mL, 1×10 3 bacteria / mL, 1×10 2 bacteria / mL and 1×10 1 (number of bacteria / mL).

[0081] 2.2 Multiplex Quantitative Real-Time PCR Detection of DNA Pathogens Based on different combinations of genes, four probes for four genes were used to perform multiplex (quadruple) quantitative PCR, as shown in Table 1.

[0082] Using the DNA pathogen detection primers and probes in Table 1, configure the following primer pair sets: Primer pairs: gyrA, gyrB, IS6110 genes and internal control IC.

[0083] Template DNA extraction: Take DNA at a concentration of 1×10⁻⁶. 3 300 µL each of the three genes gyrA, gyrB, and IS6110 per 10 cells / mL and 1×10 2 The internal control concentration was set at 100 µL / mL, and the mixture was thoroughly mixed before DNA extraction. The extracted DNA was used for the detection of four genes.

[0084] Add 5 μL of DNA sample, 12.5 μL of 2× amplification buffer, and 7.5 μL of primer-probe mixture to the reaction system, with each primer having a concentration of 0.5 μM and each probe having a concentration of 0.3 μM. Then add sterile purified water to bring the total volume to 25 μL.

[0085] Three genes and one internal control were tested in one reaction system (quadruple quantitative PCR). Ten reaction wells (replicas) were required for the assay. The following program was run on the Shanghai Hongshi SLAN-96S real-time quantitative PCR instrument: 94℃ for 60 seconds; 94℃ for 10 seconds, 71℃ for 15 seconds (decreasing by 1℃ per cycle), 72℃ for 15 seconds, 10 cycles; 94℃ for 10 seconds, 61℃ for 30 seconds, 72℃ for 15 seconds, 40 cycles, and fluorescence signals (FAM, HEX, TexRed, Cy5) were collected at 61℃.

[0086] Results: The amplified linear spectrum is as follows Figure 2 As shown, the gene amplification results are all good. This embodiment demonstrates that the reaction conditions constructed in this invention can efficiently amplify four genes simultaneously.

[0087] Example 3: Sensitivity test of optimized multiplex quantitative PCR for detecting Mycobacterium tuberculosis To evaluate the detection sensitivity of quadruple quantitative PCR (molecular beacon method), a concentration of 1×10⁻⁶ was used. 5 Using pathogen plasmids at a concentration of 1 × 10⁶ bacteria / mL as the stock solution, prepare the mixed reference standard according to Table 1, wherein the concentration of each gene plasmid is 1 × 10⁶. 4 CFU / mL, diluted with sterile purified water to the following concentration gradients, serve as sensitivity references: 10 4 CFU / mL Sensitivity Reference; 10 3 Sensitivity reference standard for bacteria / mL; 10 2 Sensitivity reference standard for bacteria / mL; 10 1 Sensitivity reference standard for bacteria / mL; The mixing principle for the four pathogens is to take 300 µL each of gyrA, gyrB and IS6110, and 100 µL of IC.

[0088] Results: The detected Ct values ​​are shown in Table 2.

[0089] Table 2. Target pathogen sensitivity detection results

[0090] The test results show that the primers and probes of this invention can simultaneously detect three target genes and an internal control in a quadruple fluorescent PCR reaction. Specifically, the limit of detection (LOD) for IS6110 is 10 CFU / mL, and the LOD for the wild-type regions of gyrA and gyrB is 100 CFU / mL. This indicates that when the sample load is in the range of 10-100 CFU / mL, it is possible for IS6110 to be detected while gyrA / gyrB is not. Therefore, this situation cannot be solely explained as a lack of drug resistance and should be confirmed by combining sample load, retest results, and other methods. Therefore, in this load range, this invention preferably reports the result as "suspicious / uninterpretable site variation" rather than directly reporting drug resistance.

[0091] This embodiment demonstrates that the primer pairs and probe detection reagents of the present invention are highly sensitive to pathogens.

[0092] Example 4: Optimized Multiplex Quantitative Real-Time PCR Detection of Clinical Pathogen-Specific Species Preparation of specific reference materials To evaluate the detection specificity of the method, 10 NTMs were validated. The specific procedure was as follows: 900 µL of NTM was taken, and 100 µL of internal control was added to each NTM. After mixing, DNA was extracted. The 10 validated DNA extracts were: Mycobacterium kansasii, Mycobacterium marineum, Mycobacterium terrestrialum, minor mycobacteria, Mycobacterium avium, Mycobacterium ulcerans, Mycobacterium guilloché, Mycobacterium abscessum, Mycobacterium chrysogenum, and Mycobacterium spp.

[0093] Results: The specific detection results are shown in Table 4. All 10 pathogens tested negative.

[0094] Table 4 Results of Target Pathogen Specific Detection

[0095] The test results show that the primer pairs and probe detection reagents corresponding to the target using the molecular beacon method of the present invention did not produce specific amplification signals of gyrA, gyrB and IS6110 for 10 NTM samples without the detection target, while the internal controls could be detected. This indicates that the system is not prone to false positives for non-target samples.

[0096] Three hundred clinical sputum samples were collected and tested, and the results of culture-based drug susceptibility testing were used as a reference for statistical analysis. Among them, 98 samples were determined to be drug-resistant and 202 samples were sensitive based on culture-based drug susceptibility testing.

[0097] Under the detection conditions of this embodiment, Ct=29 can be used as the reference threshold for determining the effective amplification signal for each detection channel. That is, when Ct < 29 for a corresponding channel, it is determined that the channel has an effective amplification signal; when Ct ≥ 29 or there is no Ct value, it is determined that the channel has no effective amplification signal. It should be noted that the above Ct threshold is mainly used to determine the amplification effectiveness of each detection channel, and does not mean that biological or drug resistance phenotype conclusions can be directly drawn from all detection results based solely on a single Ct threshold.

[0098] The IS6110 channel is used to determine whether Mycobacterium tuberculosis complex is detected in the sample. Provided the IS6110 channel meets the preset effective detection conditions, the kit analyzes the fluoroquinolone resistance-related site regions covered by the kit by combining the presence of effective amplification signals in the gyrA and gyrB channels, whether the Ct value reaches the preset threshold, and the amplification curve morphology. When both gyrA and gyrB channels show effective amplification signals, it indicates that no detectable mutations were found in the corresponding covered area. When either channel shows no effective amplification signal, the Ct value reaches or exceeds the threshold, or the amplification curve morphology is abnormal, it indicates that there may be site mutations in the corresponding covered area.

[0099] Because the detection sensitivity varies for different targets, especially since the limit of detection (LOD) for IS6110 is 10 CFU / mL, while the LOD for the wild-type regions of gyrA and gyrB is 100 CFU / mL, it is not advisable to make a drug resistance determination based solely on a single Ct threshold for samples that are IS6110 positive but have low viral loads close to the LOD, or whose gyrA / gyrB channel Ct values ​​are close to the threshold and whose amplification curves are abnormal. For such samples, it is preferable to classify them as "suspicious" or "uninterpretable," and further confirmation is recommended through retesting, sequencing, or drug susceptibility testing.

[0100] In this embodiment, to evaluate the discriminative performance of the detection system of the present invention in clinical samples, ROC curve analysis was performed on the detection results. Specifically, the input variable based on the ROC analysis is not the original Ct value of a single detection channel, but the final interpretation result formed according to the established interpretation process of the present invention. The interpretation process includes: firstly, determining whether Mycobacterium tuberculosis complex is detected in the sample based on whether an effective amplification signal appears in the IS6110 channel; under the premise that the IS6110 channel meets the preset effective detection conditions, and then combining whether effective amplification signals appear in the gyrA and gyrB channels, whether the Ct value reaches the preset threshold, and whether the amplification curve morphology is abnormal, to comprehensively interpret whether there are site variations related to fluoroquinolone resistance in the covered area of ​​the sample, and form the final interpretation result.

[0101] In statistical analysis, the final interpretation results are categorized into binary variables: "indicating the presence of drug resistance-related site variants" and "not indicating the presence of drug resistance-related site variants," which serve as the input basis for ROC analysis. Simultaneously, the results of the culture drug susceptibility test are used as a reference standard, where a drug-resistant result is defined as positive, and a drug-sensitive result is defined as negative. The final interpretation results of this invention are compared with the reference standard to calculate sensitivity and specificity and plot the ROC curve.

[0102] Furthermore, in some implementations, different combinations of sensitivity and specificity can be obtained by adjusting the parameter settings in the comprehensive interpretation rules, thereby constructing ROC curves. These parameter settings include, but are not limited to: the Ct threshold range of the effective amplified signal for each detection channel, the criteria for determining amplification curve anomalies, and the inclusion or exclusion criteria for samples in the low-load region.

[0103] For samples with initial test results of "suspicious" or "uninterpretable", since their results cannot be directly classified into the above binary variables, it is preferable not to include them directly in the first ROC statistical analysis; for samples that have obtained clear interpretation results after retesting, they can be included in the statistical analysis after a clear classification is formed.

[0104] ROC curve analysis results show that the kit of the present invention has good clinical detection performance; under the conditions of this embodiment, its detection sensitivity is 87.94% and its specificity is 98.3%. The ROC curves of clinical samples constructed based on comprehensive interpretation results are shown below. Figure 6 As shown.

[0105] Example 5: Validation of the recognition of gyrA and gyrB variant templates by a multiplex fluorescent PCR system To verify the ability of the multiplex fluorescent PCR system established in this invention to recognize the variant templates of fluoroquinolone resistance-related sites, gyrA and gyrB templates carrying common variant sites were prepared and detected using the quadruple fluorescent PCR system of this invention.

[0106] Add 5 μL of DNA sample, 12.5 μL of 2× amplification buffer, and 7.5 μL of primer-probe mixture to the reaction system, with each primer having a concentration of 0.5 μM and each probe having a concentration of 0.3 μM. Then add sterile purified water to bring the total volume to 25 μL.

[0107] Three genes and one internal control were tested in one reaction system (quadruple quantitative PCR). Ten reaction wells (replicas) were required for the assay. The following program was run on the Shanghai Hongshi SLAN-96S real-time quantitative PCR instrument: 94℃ for 60 seconds; 94℃ for 10 seconds, 71℃ for 15 seconds (decreasing by 1℃ per cycle), 72℃ for 15 seconds, 10 cycles; 94℃ for 10 seconds, 61℃ for 30 seconds, 72℃ for 15 seconds, 40 cycles, and fluorescence signals (FAM, HEX, TexRed, Cy5) were collected at 61℃.

[0108] The results are as follows Figure 3 As shown, both the IS6110 channel and the internal control channel obtained stable amplification signals, indicating the presence of Mycobacterium tuberculosis-related targets in the sample and the effectiveness of the extraction and amplification process. Furthermore, the detection channels corresponding to gyrA and gyrB showed distinguishable differences compared to the expected results of the wild-type template, suggesting that the detection system of this invention can identify variant templates within its coverage area and provide indicative results regarding the presence of variations at gyrA and gyrB-related sites. These results demonstrate that the multiplex fluorescent PCR system constructed in this invention can simultaneously detect multiple targets in the same reaction system and produce distinguishable detection results for wild-type / variant templates at the covered sites, thereby assisting in determining whether there are site variations related to fluoroquinolone resistance in the corresponding regions.

[0109] Example 6: Verification of gyrA variant template recognition using a multiplex fluorescent PCR system To verify the ability of the multiplex fluorescent PCR system established in this invention to recognize the gyrA variant template, a gyrA template carrying common variant sites was prepared and a gyrB wild-type template was used as a control for detection in a quadruple fluorescent PCR system.

[0110] Take concentrations of 10 3 300 μL each of the three genes gyrA, wild-type gyrB, and IS6110 per bacterial cell / mL mutant (common three mutations) and 10 μL of [unclear text - likely a typo, should be 10]. 2 100 μL of internal control (1 bacterial cell / mL) was mixed thoroughly before DNA extraction. The extracted DNA was used for the detection of multiple genes.

[0111] Add 5 μL of DNA sample, 12.5 μL of 2× amplification buffer, and 7.5 μL of primer-probe mixture to the reaction system, with each primer having a concentration of 0.5 μM and each probe having a concentration of 0.3 μM. Then add sterile purified water to bring the total volume to 25 μL.

[0112] Three genes and one internal control were tested in one reaction system (quadruple quantitative PCR). Ten reaction wells (replicas) were required for the assay. The following program was run on the Shanghai Hongshi SLAN-96S real-time quantitative PCR instrument: 94℃ for 60 seconds; 94℃ for 10 seconds, 71℃ for 15 seconds (decreasing by 1℃ per cycle), 72℃ for 15 seconds, 10 cycles; 94℃ for 10 seconds, 61℃ for 30 seconds, 72℃ for 15 seconds, 40 cycles, and fluorescence signals (FAM, HEX, TexRed, Cy5) were collected at 61℃.

[0113] Results: The results are as follows Figure 4 As shown, both the IS6110 channel and the internal control channel showed normal amplification, indicating that the sample extraction and amplification process was effective. The channel corresponding to the gyrB wild-type template obtained the expected effective amplification signal, while the detection channel corresponding to the gyrA variant template showed a distinguishable detection difference compared to the expected result of the wild-type template, suggesting that the system can distinguish between wild-type and variant templates within the gyrA-covered region. The above results demonstrate that the multiplex fluorescent PCR system of the present invention can identify template differences related to gyrA-covered sites in the same reaction system and stably achieve suggestive detection of corresponding variant regions against a gyrB wild-type background.

[0114] Example 7: Validation of gyrB variant template recognition by multiplex fluorescent PCR system To verify the ability of the multiplex fluorescent PCR system established in this invention to recognize the gyrB variant template, a gyrB template carrying common variant sites was prepared and detected in a quadruple fluorescent PCR system using a gyrA wild-type template as a control.

[0115] Take concentrations of 10 3 300 μL each of the three genes gyrB, wild-type gyrA, and IS6110 per bacterial cell / mL mutant (common three mutations) and 10 μL of [unclear text - likely a typo, should be 10]. 2 100 μL of internal control (1 bacterial cell / mL) was mixed thoroughly before DNA extraction. The extracted DNA was used for the detection of multiple genes.

[0116] Add 5 μL of DNA sample, 12.5 μL of 2× amplification buffer, and 7.5 μL of primer-probe mixture to the reaction system, with each primer having a concentration of 0.5 μM and each probe having a concentration of 0.3 μM. Then add sterile purified water to bring the total volume to 25 μL.

[0117] Three genes and one internal control were tested in one reaction system (quadruple quantitative PCR). Ten reaction wells (replicas) were required for the assay. The following program was run on the Shanghai Hongshi SLAN-96S real-time quantitative PCR instrument: 94℃ for 60 seconds; 94℃ for 10 seconds, 71℃ for 15 seconds (decreasing by 1℃ per cycle), 72℃ for 15 seconds, 10 cycles; 94℃ for 10 seconds, 61℃ for 30 seconds, 72℃ for 15 seconds, 40 cycles, and fluorescence signals (FAM, HEX, TexRed, Cy5) were collected at 61℃.

[0118] The results are as follows Figure 5 As shown, both the IS6110 channel and the internal control channel exhibited normal amplification signals, indicating that the reaction system was stable and the extraction and amplification processes were effective. The amplification results of the channel corresponding to the gyrA wild-type template were consistent with expectations, while the detection channel corresponding to the gyrB variant template showed a distinguishable difference compared to the expected results for the wild-type template, suggesting that the detection system can identify template variants in the region covered by gyrB. These results demonstrate that the multiplex fluorescent PCR system established in this invention can differentiate between wild-type and variant templates related to gyrB-covered sites and can assist in determining whether there are site variants related to fluoroquinolone resistance in the corresponding regions.

[0119] Discussion: Because multiplex fluorescent PCR systems require the simultaneous detection of multiple targets in the same reaction tube, interference may occur between different primer pairs and probes, affecting amplification efficiency and detection specificity. Therefore, system optimization is quite challenging. After repeated screening and optimization, the quadruple fluorescent PCR system established in this invention can better balance the amplification efficiency, specificity, and reproducibility of each target, and the reliability of result interpretation is improved by introducing an exogenous internal control.

[0120] Experimental results show that the primers and probes provided in this invention can simultaneously detect IS6110, gyrA, gyrB, and internal controls in a quadruple fluorescent PCR system. The limit of detection (LOD) for the IS6110 target is 10 CFU / mL, while the LOD for the corresponding coverage areas of gyrA and gyrB is 100 CFU / mL. Detection of reference samples, non-target mycobacteria, and clinical samples demonstrates that the detection system established in this invention has good sensitivity, specificity, and repeatability. Under the premise that the samples meet the preset interpretation conditions, this invention can rapidly detect Mycobacterium tuberculosis and provide auxiliary evidence for determining whether there are fluoroquinolone resistance-related site variations in the areas covered by gyrA and gyrB.

[0121] Experimental verification shows that the primers and probes provided by this invention can simultaneously detect IS6110, gyrA, gyrB, and internal controls in a quadruple fluorescent PCR system. The limit of detection (LOD) for the IS6110 target is 10 CFU / mL, and the LOD for the corresponding coverage areas of gyrA and gyrB is 100 CFU / mL. Detection of reference samples, non-target mycobacteria, and clinical samples demonstrates that the detection system established by this invention has good sensitivity, specificity, and repeatability. Under the premise that the samples meet the preset interpretation conditions, this invention can rapidly detect Mycobacterium tuberculosis and provide auxiliary evidence for determining whether there are fluoroquinolone resistance-related site variations in the areas covered by gyrA and gyrB.

[0122] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims, and the specification and drawings can be used to interpret the content of the claims.

Claims

1. A primer-probe combo product, characterized in that, Including a)~c): a) The primer pairs shown in SEQ ID NO: 1-2 and the probe shown in SEQ ID NO: 3; b) The primer pairs shown in SEQ ID NO: 4-5 and the probe shown in SEQ ID NO: 6; c) The primer pairs shown in SEQ ID NO: 7-8 and the probe shown in SEQ ID NO:

9.

2. The combined product according to claim 1, characterized in that, It also includes primers and probes for internal control.

3. The combined product according to claim 2, characterized in that, The internal control primers and probes include d): the primer pair shown in SEQ ID NO: 10-11 and the probe shown in SEQ ID NO:

12.

4. The combined product according to any one of claims 1-3, characterized in that, All probes are self-quenching probes.

5. The combined product according to claim 4, characterized in that, The probe is a self-quenching probe, and the probes used for the detection of gyrA and gyrB are preferably molecular beacon probes.

6. A reagent kit, characterized in that, A product containing the primer-probe combination according to any one of claims 1-5.

7. The reagent kit according to claim 6, characterized in that, It also contains one or more of the following: nucleic acid extraction reagent, PCR amplification reagent, positive control, negative control, and internal control.

8. The reagent kit according to claim 7, characterized in that, The PCR amplification reagents include DNA polymerase, buffer system, dNTPs, and Mg. 2+ One or more of the following: stabilizers.

9. The reagent kit according to any one of claims 6-8, characterized in that, At least one component of the kit is a solid, and the solid includes at least one of lyophilized microspheres, lyophilized cakes, lyophilized powder, or spots formed on the surface of a solid carrier.

10. The use of the primer-probe combination product according to any one of claims 1-5 in the preparation of a kit for detecting fluoroquinolone-resistant Mycobacterium tuberculosis.

Images