Molecular marker for identifying 'guiqing pear' and application thereof

Abstract

The present application relates to the technical field of molecular marker, in particular to SNP molecular marker of 'Guiqing pear' and application thereof. The SNP molecular marker of the present application can be used to identify 'Guiqing pear' Pyrus pyrifolia, and has important significance for germplasm resource identification of Pyrus pyrifolia and molecular marker breeding.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the identification of SNP molecular markers for the sand pear variety 'Guiqing Pear' and their applications. Background Technology

[0002] Sand pear (Pyrus pyrifolia) is a high-quality fresh-eating pear variety mainly cultivated in southern my country. It is highly adaptable, high-yielding, and has excellent fruit flavor, possessing both high edible value and economic benefits. It is an important specialty economic fruit in southern pear-producing areas, contributing to increased industry efficiency and farmers' income. In recent years, with the continuous maturation of improved varieties and standardized cultivation techniques, the scale and industrialization of sand pear cultivation in China have continued to improve, market demand has steadily increased, and the promotion and planting of new and superior varieties has accelerated. However, the circulation of sand pear seedlings is currently rife with irregularities, the variety control system is imperfect, and problems such as "different names for the same product" and "different products with the same name" are widespread. Some operators, seeking personal gain, sell ordinary hybrid pear seedlings as high-quality seedlings, frequently engaging in substandard sales, variety fraud, and other unethical practices. Such problems not only lead to growers making mistakes in introducing new varieties, resulting in reduced yields and quality, and damaged economic benefits, but also seriously disrupt the market order of improved sand pear seedlings, and restrict the standardized promotion of new and superior sand pear varieties and the high-quality development of the industry. Therefore, establishing accurate, efficient and stable identification technology for new sand pear seedling varieties has become a key issue that urgently needs to be addressed in the current industrial development.

[0003] 'Qingxiang' pear is a high-quality sand pear core variety officially registered and approved in my country, bred by the Zhejiang Academy of Agricultural Sciences through hybridization of New Century and Sanhua pear. 'Guiqing' pear is a bud mutation of the high-quality Qingxiang pear, inheriting its core advantages of strong adaptability, stable characteristics, and excellent quality. It also exhibits unique varietal traits through bud mutation, demonstrating outstanding comprehensive cultivation value and promotion potential, making it a high-quality new variety for upgrading sand pears. Currently, in the promotion and planting of Guiqing pear, accurate variety identification is difficult. Grassroots technicians rely solely on phenotypic characteristics such as tree growth, fruit shape, and fruit color for identification. This method is simplistic, subjective, and easily affected by external factors such as climate, cultivation management, and tree age and growth. It cannot accurately distinguish the bud mutation variety 'Guiqing' pear from the native 'Qingxiang' pear and other similar sand pear varieties, resulting in unreliable identification results and hindering the effective prevention of counterfeit and substandard seedlings.

[0004] Compared to traditional visual phenotypic identification methods, molecular biological fingerprinting provides more objective, accurate, and persuasive results, making it the mainstream and reliable technology for fruit tree variety identification. DNA barcoding identification technology, developed based on molecular markers, boasts high throughput, high sensitivity, and strong variety specificity. It enables rapid, precise, and large-scale molecular identification of 'Guiqing Pear' seedlings, strictly controlling variety purity from the source, preventing varietal mixing and seedling fraud, ensuring the standardized promotion and scientific cultivation of superior Guiqing Pear varieties, and driving the healthy, orderly, high-quality, and sustainable development of the sand pear industry. Summary of the Invention

[0005] This invention addresses the aforementioned technical problems by providing a simple molecular marker method for the identification of 'Guiqing Pear'. Specifically, this invention provides the following technical solution: In a first aspect, the present invention provides a DNA genotype barcode for identifying or assisting in the identification of the 'Guiqing Pear' variety, characterized in that the unique DNA genotype barcode of the Guiqing Pear is AATTATCC (composed of homozygous genotypes at 9 SNP loci), and the positions of the bases of the DNA genotype barcode on the chromosome are shown in the following table in order: Table 1. SNP locus information of DNA barcodes for the 'Guiqing Pear' variety.

[0006] This invention utilizes high-throughput sequencing to identify nine SNP loci within the pear genome that can be used to identify or assist in the identification of 'Guiqing Pear'. These SNP loci can form a unique DNA genotype barcode for 'Guiqing Pear'. Those skilled in the art will understand that the DNA genotype barcode described in this invention is not composed of continuous bases, but rather consists of genotypes dispersed at different loci on different chromosomes. Therefore, the DNA barcode described in this invention can also be called a genotype barcode, and AATTATCC indicates that each locus is a homozygous base.

[0007] Furthermore, the chromosome location is merely a reference genome based on the embodiments of this application and does not constitute a limitation on the present invention. Those skilled in the art will understand that, based on the homology of SEQ ID NO. 1 to SEQ ID NO. 9 sequences in other reference genomes, the specific location of the SNP in different reference genomes can be obtained. Sites homologous to the present invention in different genomes are not substantially different from the SNP sites described in the present invention and still fall within the scope of protection claimed by the present invention.

[0008] Furthermore, the sequences of the SNP sites in the aforementioned DNA barcode are shown in SEQ ID NO. 1 to SEQ ID NO. 9: SEQ ID NO.1 AATCCTGATGGAACTTTCACACAAAATCTCTATATCCAGATCTCTATAAAGATACGCATTGACCATGTCCATAAATTAGATACTTAGCTTTTCGAAACTACTAAACTGATCCTCATTATTCTCATTATGCTTCCTTCAAATACCCATTTAAAGCCTATGGTTTTTTGTTCTTTTTTATATTTAACATAAAAAGAATGAAACCTTTTTTTTGTTTTATCATTAGATACAACTAAATATAAGTCAATTAAGTTCTTATTATTCCTTGTCTACAAAATATCCAATTTTTTATGCCTAATGCCCC MTAGATAGTTTGAACTACATAGGAACAATAATCAATCTTAGCTCCAATAGTTTATAGAACTCTACGTTTTCGAGTCCATTCAACACGTGCAATTTCAACGTTTAAGGGTGCTGAAACGACTGGTCTGAACACCCAACGATTCACTAAGAA ATCAAGTTTGACTTGGATTACCTCTTTTCGTTTTGGCTAGTCATATCGACAATGTGCTTCAACAACCGATCATGGTTCAATTTAATCGCCCTTTACTGTTTGGACGGCCACAACAAAAGAAAACACATCATCGATGATGATCTCATTTCGT SEQIDNO.2 ATTCAAAATTTCGAAATCGGAAATGTTCGGGCTTAGAACAGAAATTTTCGAGATCGAATAGGTACATTCCAGTCCAACTTGCACAAGAGTTCAACTTCGTCCCTCAATAACATAACATATAATAACTCATTAGAAACCAATAAGTGCTTTCAACATAATCATTCTGACAAATACATATGTGCATTTCTTCGAGATTTGACAAATACATATCGTGCATTTCTTTGAGATTCTTGTCCAAATCCACTCATTTGGTATGCATGATTGTATTGGAATAGATAAATTAAGGATATATTGGAGAAG MAATTATAAAATTATGATCACCTAGAGGTTGATTAACTCATAAAGAATACTTATCCATTCGAATACTCTTTAAAATGGTAGGATTAGAAGCGCTGAATTTCTTTCATAACTAATTCTCTCCAAATGAAAAACCATCCACTTTTGCCTTTAGTATAACTTTAAAATTTGAAAATTCTCCATATCAGTTCAATCATGTGTGCCAAACGAGCTCTAAGGCTTTTGGAGTAATCTTTATAAGTATACTCACCCAGTACACACACCACCCCCTAACTCCTTATAAAAAAATAGAGGGTGAAGAGAGG SEQIDNO.3 GCTTAGAACAGAAATTTTCGAGATCGAATAGGTACATTCCAGTCCAACTTGCACAAGAGTTCAACTTCGTCCCTCAATAACATAACATATAATAACTCATTAGAAACCAATAAGTGCTTTCAACATAATCATTCTGACAAATACATATGTGCATTTCTTCGAGATTTGACAAATACATATCGTGCATTTCTTTGAGATTCTTGTCCAAATCCACTCATTTGGTATGCATGATTGTATTGGAATAGATAAATTAAGGATATATTGGAGAAGCAATTATAAAATTATGATCACCTAGAGGTT KATTAACTCATAAAGAATACTTATCCATTCGAATACTCTTTAAAATGGTAGGATTAGAAGCGCTGAATTTCTTTCATAACTAATTCTCTCCAAATGAAAAACCATCCACTTTTGCCTTTAGTATAACTTTAAATTTGAAAATTCTCCATA TCAGTTCAATCATGTGTGCCAAACGAGCTCTAAGGCTTTTGGAGTAATCTTTATAAGTATACTCACCCAGTACACACACACCACCCCCTAACTCCTTATAAAAAAATAGAGGGTGAAGAGAGGGGGGATCAAGTTGTCTGTCCGAGTTTATTC SEQIDNO.4 ATTCTAAATGACATTCCTCATGTACCGATGATAGTGAAATTAGTTTCGACTGGGAATCACAAGAGGTCCAAAGCTTCCAATTATTCCAGGAGCAAGTGCAACCACAGAACTCGCAAAAAATATGTAACATTAAAGAAATCTAACCTAAATTAGTTATCTGGAACTGCATCTAAGTTGATGCAACTGCATTAAAACGCAAGCTAATGGTGACAGCTGATATTTAAAGCTTGTTTTGTAAAAGGTTAAGTTGTTCAGTATAAAGTTGTTATAGTAGATCAAAACAATTGGCACTCACAGATAWTATCTTGTTACGTGTTCTATCCAGTTGCATAAAATATGCATCAAGCAGCATCTCTAGATCTTCTACGTCATCGTGGTCCATATAGTAACTGGTTATCAAACTCCCGCTTCTGGTGGAACCAAGCCGACGAAGATGGGATGTGGGGATTCTATTTGACGCAGAACGCCCCAACAAATCCTCGGGCTGTTGATTCTGCATCCATTTCCTTGTTAAATATAAATGTGCCATATCTGCATTGTCATCCAACAAATTTTCGATTTCATCCTTCATCTGAAATCAGACAGACACGTGCTTCTTACT SEQIDNO.5 AACCTTTGACAGGCGATCTGTTTACCGCTCGTTTCGTGGATTGTCACTTCTATAAAACAGTATTCCCATCGTTAGGGGGAGATAAGAACGTCAACATTCTTAAAGAACGACGCGAATTATCATGGACGGCTCTCACCTTGTCTCATTTAGATCCTTGCACCGCTCAGTCTAAAACTAAAGTGTAGCACATATTAGATCTCCAGAGCAATATCACATATTCCAGCTGCGAATACACCTGCAAAGATAGATATACCAAATGTATGACGGACTTCCATCCTAGAGGCCCAGGGCACCAATCTTRGTGATCCACATAAATTAGCAACTAGCCAATCATCTGCCCCTACACAAAAGTGTGGCAGACCCCTTAGTTCAAAGAATTCACACCCTTAGAAGAGGAAATCCATGGCACAAGGTCCCAAAGAGCCTACCATGAATCCGACTATCGCTTACTCATTCTATCCAACTCATGAGGAAATTCTAGATTATGGAAACTGTCACATCCCAGCCCGGGCCCCCACCACATCCCGGGCTCGACTCCACCGTAGCACAATATTGTCCACTTTGGGCCCCTACCACGCCCTCATGGTTTTGTTTCTGGGAA SEQIDNO.6 GATCTGACTGTATTTTCATGTGGAAGTATGTTAATCTCCATATAACATCTTATCGTTAACTTCAAACGATAAGATGGTAGTAAAATGAAGAACCTCTCGATAAATAATCTCATTTTATATCATTTTTGTTGTAAATTGTATTATTAATTAGCAATGTGATTATGTAAATTTAAAGTAGAATATAAAAGGATTTGGAGATCAAATTCTCCTAGGCTTCGTATTACTTATAAGGGAAGAAGCTCATCATGAATAGTAAAAATAAAGGTATGAGGCTAGGAGTGAACATACAATTCTCATACA YCTGAATCATTCTATCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCACCCACTTTTATAATTTAGTTTACAACAATTTTTAAATTATAAGGCCGGGGTTGAGTCGCTTTTAATTTTTTTACATTTATAACTATAGATTAGTAAGTGGAAAAATTAAAACCTATTGCGTGCCAAAACTCTATGGTTACGTAGATAAGGGACTAAAATTCTCTCCCTTCTTCTTTCTATCCCATTCCATCCCCTCCTCTCACACTCTCTATTTTGTTTTTCTCTTTCTATAAAAA SEQIDNO.7 ACCCTGTGATATACCATTTTAAGCACAGATTATCATCCTTAAGCACATATTATATCATCCTTGACCTCAAATTTGAAAAATCTCACCCAAAAATAATGATATAACCACAACAACAACAAAACAAGTGTATTCAAACACAAACTACTCATCATTTGCAAGAAAAATATGAAATAGACCAAATTAAGCATAAAACCTGCTTGATTATCCAGAAATTGTTAAACCTGTTAAAAAAACTAACATAATTCATCTAGCATCTCCAACCAACATTACAAAACCTACTGAATTCATAAAAACCTACTAYATCATCCATTCAATTCACAAAAGACCTATTGGAGGCATAAAACTTGTTCTAACTTCACAATTCTTTTACAAAAAACAACCATCTGTGCCAAAAACGTGGATATGGCTGGGTTGGTTGGTATTTCTGTGCTTGGTGCCTTTGGATGATTCAGTTAGTGGATTGCTTGGTCTTTCTCTGCTTGGTGCTTCTAGGTGATTCAATTATTGATTGTGATGCCTAAATCCAAAGTTCATTTAGAGACCAAGCAAGCTTTTTAACTAAATCCAAATGTTTTACAACTAAGGAAATGGTTAAGTTTTT SEQIDNO.8 CAAAGTTAATGGCTCCATAAAAAAGGCTCGTGGTGTGGGGAAAAGTTTCACACAAACCTATAGCATTGATTATCTCGAGACGTTTGCTGTTGTGGCCAAACTAAACTCAACTCCATAATCATTATGTTAGTTACAACTAACAGATCTTGACCACTGCATCAGCTCAATGTCAAAAGGGCCTTTCTTCATGAAGACCTCCACTAAGTTTTCGAGTTCAAGGGGAGGAAGGGAAAGTTTTCAGGTGAAAAAAGGTGATATATGGTCTCCAGTAGTCTCCTCAGCCATGGCTAAGTGATCCTA MTCACATTGGACCCAGTGCCCAAGTGGTTTGGCCAATAATGGGGTCAAGAAATATTGAATGGTGAAGTAGGGGGAGTTTCCGAGGAATACAAATAACCTCTGGGTTTTTTTTTTTTCAAATTTGGCTAGCATCTAGAATAACTAGTGAATTACAACTCTATTGTATTGCAATTGGTGCATTGGTCCTGCTACCTCAATACTTCTTGCTAGTTGGTTCGATTATCACAAAATTGCTACGAAACTAATGAGCAAATTAATAGATACAGAAAAAGTCAAACTCAAGAACAAGAAAGAAGGGCAGTAG SEQIDNO.9 .

[0009] In particular, the genotype of locus CHR3_15379420 (chromosome 3, locus 15379420) is TT, which is different from all other varieties. Since pear cultivar propagation after selection is done through single-plant asexual reproduction to ensure the stability of cultivar traits, the TT genotype at locus CHR3_15379420 can be considered a unique locus for 'Guiqing Pear' and can be used for the identification or auxiliary identification of this variety.

[0010] Furthermore, the sequence of the SNP molecular marker CHR3_15379420 is shown in SEQ ID NO.3. The SNP molecular marker CHR3_15379420 is a G / T mutation located at position 301 of SEQ ID NO.3. The genotype of the SNP molecular marker CHR3_15379420 in 'Guiqing Pear' is TT.

[0011] On the other hand, another object of the present invention is to provide any of the following applications of the above-mentioned DNA barcodes and molecular markers: (1) Application in identifying the 'Guiqing Pear' sand pear variety; (2) Application in the identification, improvement or molecular marker-assisted breeding of sand pear germplasm resources; (3) Application in screening or creating different varieties of sand pear; (4) Application in constructing a DNA fingerprint database of sand pear.

[0012] On the other hand, another object of the present invention is to provide a method for identifying or assisting in the identification of the 'Guiqing Pear' sand pear variety, characterized in that it includes: (1) Extract total DNA from the sand pear samples to be identified; (2) Detect the genotype of each base of the aforementioned DNA barcode; (3) Determine whether the sand pear sample to be identified is 'Guiqing pear' based on the test results.

[0013] Optionally, step 2) can be performed by sequencing or KASP or any other available genotyping technique to detect the genotype of each base of the aforementioned DNA barcode.

[0014] The specific judgment method for step 3) is that if the genotype of the sand pear sample to be identified is inconsistent with the aforementioned DNA barcode, it is judged to be a non-'Guiqing Pear' sand pear variety.

[0015] Furthermore, in step 3), if the genotype of the sand pear sample to be identified matches the aforementioned DNA barcode, it is determined to be the 'Guiqing Pear' sand pear variety.

[0016] On the other hand, another object of the present invention is to provide another method for identifying or assisting in the identification of the 'Guiqing Pear' variety, characterized by comprising: (1) Extract total DNA from the sand pear samples to be identified; (2) Detect the genotype of the SNP molecular marker CHR3_15379420; (3) Determine whether the sand pear sample to be identified is 'Guiqing pear' based on the test results.

[0017] Optionally, step 2) can be performed by sequencing or any other available genotyping technique to detect the genotype of the aforementioned SNP molecular marker.

[0018] The specific judgment method for step 3) is as follows: if the genotype of the sand pear sample to be identified is inconsistent with the genotype of the aforementioned SNP molecular marker CHR3_15379420, it is determined that it is not the 'Guiqing Pear' sand pear variety.

[0019] Furthermore, in step 3), if the genotype of the sand pear sample to be identified matches the genotype of the SNP molecular marker CHR3_15379420, it is determined to be the 'Guiqing Pear' sand pear variety.

[0020] The aforementioned identification or auxiliary identification means directly identifying the sample to be tested as the 'Guiqing Pear' sand pear variety, or using it only as an auxiliary means to exclude the sample to be identified as the 'Guiqing Pear' sand pear variety.

[0021] Furthermore, the aforementioned identification or auxiliary identification methods can at least distinguish 'Guiqing Pear' from any other variety described in this invention.

[0022] On the other hand, the present invention provides any of the following applications of the aforementioned method: (1) Application in identifying the 'Guiqing Pear' sand pear variety; (2) Application in the identification, improvement or molecular marker-assisted breeding of sand pear germplasm resources; (3) Application in screening or creating different varieties of sand pear; (4) Application in constructing a DNA fingerprint database of sand pear.

[0023] This invention offers the following advantages: by using a single DNA barcode or SNP molecular marker, it is possible to effectively distinguish whether a tested variety is 'Guiqing Pear' sand pear, thus providing assurance for the identification, planting, resource utilization, and breeding of 'Guiqing Pear' sand pear. It also has significant implications for molecular marker breeding of sand pears. Attached Figure Description

[0024] The method of the present invention and its beneficial effects will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0025] Figure 1 This is the fingerprint spectrum of the verification results of 21 samples. The horizontal axis represents the SNP marker name, and the vertical axis represents the sample number. Detailed Implementation

[0026] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. The sand pear plant samples used in the following embodiments are commercially available or collected from the wild. Example 1 Resequencing Analysis

[0028] 1. Experimental Materials The experimental materials included Guiqing pear, Qingxiang pear, and 312 reported sand pear varieties (doi: 10.1038 / s41467-021-21378-y. PMID: 33602909; PMCID: PMC7892570.).

[0029] 2. Sample DNA extraction, library construction, and sequencing First, the leaves of each sample were preserved using liquid nitrogen. Genomic DNA was extracted from the samples using a kit and then subjected to next-generation sequencing using NGS. The sequencing results were 150bp paired-end data.

[0030] 3. Data quality control Use the FastP software for read quality control.

[0031] 4. Data comparison and SNP variant detection In this invention, we used the genome of Dangshan pear as the reference genome (https: / / pearomics.njau.edu.cn / genome_data, Dangshansuli_V121010), used BWA alignment software to align the sequencing fragments back to the reference genome, and then used Picard-tools to remove the sequencing fragments generated by PCR-duplication.

[0032] For each sample, a bwa (version: 0.7.17; parameter: mem) alignment analysis was performed. The filtered clean reads were aligned to the reference genome, and the alignment results were statistically analyzed. The specific analysis steps are as follows: (1) Use bwa alignment software (parameter: mem -R, other parameters are the software default parameters) to align the clean reads of all samples with the reference genome; (2) Use samtools (parameter: sort) to convert the alignment results from the sam (Sequence Alignment / MAP) file to a sorted bam (binary Alignment / Map) file; (3) Use samtools (parameter: markdup -r) to remove duplicates from the sorted alignment results for subsequent analysis; (4) Use GATK software to call SNP.

[0033] Example 2: Development of core SNPs for identifying 'Guiqing Pear' 1. Identification of core SNPs Based on the grouping of 'Guiqing Pear' and other sand pears, select SNPs that can distinguish 'Guiqing Pear' from other sand pears. The selection criteria are that no more than 50% of the loci are the same as the 'Guiqing Pear' genotype, and the combination can identify 'Guiqing Pear'.

[0034] Finally, nine markers were selected as core SNPs, and these nine core SNP loci were used as the core SNP loci for identifying 'Guiqing Pear'. The genotypes of the nine core SNP loci in different varieties are sorted from smallest to largest according to chromosome number and position, as shown in Table 1. The specific sorting order is Chr3_166432, Chr3_15379390, Chr3_15379420, Chr8_4019996, Chr10_22168272, Chr14_20248886, Chr17_21716628, Chr17_23812529, and Chr17_23812542.

[0035] The genotype combinations of these 9 loci form the barcode sequence AATTATTCC in 'Guiqing Pear' (GQL) and CCGAGCTAC in 'Qingxiang Pear'. These genotypes at these 9 loci are completely different from the SNP genotype combinations of other varieties (Table 2) and can be used as DNA barcodes for identifying 'Guiqing Pear'. In particular, the genotype of locus CHR3_15379420 is TT, which is different from all other varieties, including 'Qingxiang' pear (QXL). The ". / " indicates undetected, possibly because the relevant sample differs significantly from the reference genome at this locus, making detection / genotyping impossible. Considering that pear cultivar propagation after breeding is done through single-plant asexual reproduction to ensure varietal stability, the TT genotype at locus CHR3_15379420 can be considered a unique locus of 'Guiqing Pear' and can be used for the identification of this variety.

[0036] Table 1 SNP locus information Table 2. SNP marker combinations for different samples Example 3 Molecular marker verification Twenty non-Qingxiang pear varieties and one Qingxiang pear variety were selected and numbered 1 to 21. Next-generation sequencing was used for further validation.

[0037] The results are shown in Table 2. Table 1 shows that sample number 1 is the 'Guiqing Pear' variety, and its genotype sequence at 9 loci is AATATCC, completely different from the genotypes of other samples. Furthermore, the 'Guiqing Pear' variety has a TT sequence at the CHR3_15379420 locus, which is completely different from other samples. Sample number 21 is the 'Qingxiang' pear. Table 2. Test results of 21 samples In summary, the DNA barcode prepared by this invention can be used for the accurate identification of the 'Guiqing Pear' variety, and the single SNP locus CHR3_15379420 variant can directly identify the 'Guiqing Pear' variety.

[0038] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to the above embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The application of reagents for detecting SNP molecular markers in the identification of the 'Guiqing Pear' sand pear variety, characterized in that, The sequence of the SNP molecular marker is shown in SEQ ID NO.

3. Its SNP site is located at position 301 of SEQ ID NO.3, the mutation type is G>T, and the genotype of the SNP molecular marker in the 'Guiqing Pear' sand pear variety is TT.

2. The application of reagents for detecting SNP molecular marker combinations in the identification of the 'Guiqing Pear' sand pear variety, characterized in that, The sequences of the SNP molecular marker combinations are shown in SEQ ID NO.1~SEQ ID NO.

9. The site information and genotype of the SNP molecular marker combinations in the 'Guiqing Pear' sand pear variety are shown in the table below:

3. A method for identifying the 'Guiqing Pear' sand pear variety, characterized in that, include: (1) Extract total DNA from the sand pear samples to be identified; (2) Detect the genotype of the SNP molecular marker, the sequence of which is shown in SEQ ID NO.3, the SNP site is located at position 301 of SEQ ID NO.3, and the mutation type is G>T; (3) When the genotype of the SNP molecular marker is TT, the sample is determined to be 'Guiqing Pear'.

4. The method according to claim 3, characterized in that, Step 2) Detect the genotype of the SNP molecular marker by sequencing.

5. A method for identifying the 'Guiqing Pear' sand pear variety, characterized in that, include: (1) Extract total DNA from the sand pear samples to be identified; (2) Detect the genotype of the SNP molecular marker combination. The sequences of the SNP molecular marker combination are shown in SEQ ID NO.1~SEQ ID NO.

9. The site information and genotype of the SNP molecular marker combination in the 'Guiqing Pear' sand pear variety are shown in the table below: (3) When the genotype of the SNP molecular marker combination is consistent with the genotype of Guiqing pear in step (2), the sample is determined to be 'Guiqing pear'.

6. The method according to claim 5, characterized in that, Step 2) Detect the genotype of the SNP molecular marker combination by sequencing.

Images