Artificial micro-rnas targeting tau

Abstract

This article provides artificial microRNA (miRNA) molecules for the treatment of tau protein diseases. In some embodiments, these miRNA molecules target the expression of the tau protein. This article further provides expression constructs, vectors (e.g., rAAV), cells, viral particles, and pharmaceutical compositions containing these artificial miRNA molecules. This article further provides methods and kits related to the use of these miRNA molecules, for example, for the treatment of tau protein diseases, including Alzheimer's disease, progressive supranuclear palsy, corticobasal degeneration, frontotemporal dementia with Parkinson's syndrome-17, Pick's disease, aerobatic granuloma, glioblastoma, chronic traumatic encephalopathy, and post-encephalitis Parkinson's syndrome.

Description

Cross-references to related applications

[0001] This application claims priority to U.S. Provisional Application No. 63 / 610,638, filed December 15, 2023, which is incorporated herein by reference in its entirety. Reference to electronic sequence listing

[0002] The contents of the electronic sequence list (159792018340seqlist.xml; size: 56,193 bytes; and creation date: December 10, 2024) are incorporated herein by reference in their entirety. Technical Field

[0003] This disclosure relates to artificial microRNA molecules. In some aspects, this disclosure relates to artificial microRNA molecules that reduce the expression of the microtubule-associated protein tau. Background Technology

[0004] Pathological accumulation of tau protein drives neurotoxicity and focal brain atrophy in a group of neurodegenerative diseases known as tauopathies (e.g., progressive supranuclear palsy, corticobasal degeneration, Alzheimer's disease). These neurodegenerative diseases manifest as progressive and fatal cognitive and motor impairments, and no known approved treatments alter their course. Microtubule-associated protein tau is a recognized therapeutic target due to: i) the strongest known genetic risk factors affecting the MAPT gene encoding tau, and ii) clinical impairment significantly associated with tau burden. Reduction of tau in preclinical models may not only prevent further accumulation but also enable the clearance of existing tau aggregates.

[0005] Current treatments for tau proteinopathy are largely symptomatic and supportive, and none have shown significant reductions in tau proteinopathy symptoms. While many tau-targeting therapeutics are under development, most target the tau protein itself. Given the heterogeneity of tau isoform expression, post-translational modifications, and conformation among tau proteinopathy cases, directly targeting a specific form of tau protein may not have the broadest therapeutic impact. Summary of the Invention

[0006] This disclosure provides artificial microRNA (miRNA) molecules that target human MAPT mRNA. Gene therapy using artificial miRNAs targeting MAPT supports significant improvements in quality of life and slows disease progression. The constructs described herein have broad commercial applicability in both rare and common neurodegenerative tau protein diseases.

[0007] On one hand, this disclosure provides an artificial miRNA comprising a first strand and a second strand, wherein (a) The first chain and the second chain form a double chain; (b) The first strand contains a guide region that contains a nucleotide sequence having at least about 90% or at least about 95% identity with the following sequence: SEQ ID NO: 1 (5'-UUCGCGGAAGGUCAGCUUGUG-3'), SEQ ID NO: 2 (5'-GACGGCGACUUGGGUGGAGUA-3'), SEQ ID NO: 3 (5'- UGUCGAUGCUGCCGGUGGAGG-3'), SEQ ID NO: 4 (5'- UUUCGACUGGACUCUGUCCUU-3'), SEQ ID NO 5 (5'- AGUACGGACCACUGCCACCU-3'), SEQ ID NO: 6 (5'- AGCCGAUCUUGGACUUGACAU-3'), SEQ ID NO: 7 (5'- GUACGUCCCAGCGUGAUCUUC-3'), SEQ ID NO: 8 (5'- AUGUCGAUGCUGCCGGUGGAG-3'), SEQ ID NO: 9 (5'- UUCGACUGGACUCUGUCCUUG-3'), SEQ ID NO: 10 (5'- GGCGACUUGGGUGGAGUACGG-3'), SEQ ID NO: 11 (5'- GGCGACUUGUACACGAUCUCC-3'), SEQ ID NO: 12 (5'- UAUGUCGAUGCUGCCGGUGGA-3'), SEQ ID NO: 13 (5'- UAUGCGAGCUUGGGUCACUG-3'), SEQ ID NO: 14 (5'- UGUACGUCCCAGCGUGAUCUU-3'), SEQ ID NO: 15 (5'- GUCGAUGCUGCCGGUGGAGGA-3'), SEQ ID NO: 16 (5'- AACCCGUACGUCCCAGCGUGA-3'), SEQ ID NO: 17 (5'- GUACGGACCACUGCCACCUUC-3'), SEQ ID NO: 18 (5'- GUAGCCGCUGCGAUCCCCUGA-3'), SEQ ID NO: 19 (5'- UGGCGAUCUUCGUUUUACCAU-3'), SEQ ID NO: 20 (5'- UUCGUCAGCUAGCGUGGCGAG-3'), SEQ ID NO: 21 (5'- UCUUUGCUUUUACUGACCAUG-3') or SEQ ID NO: 22 (5'- UCAAGCUUCUCAGAUUUUAC-3'); and (c) The second strand (lazy strand) contains a non-guided region containing a nucleotide sequence that is fully or partially complementary to the nucleotide sequence of the guide region.

[0008] In some embodiments, the first chain comprises a guide sequence having the following sequences: SEQ ID NO: 1 (5'-UUCGCGGAAGGUCAGCUUGUG-3'), SEQ ID NO: 2 (5'- GACGGCGACUUGGGUGGAGUA-3'), SEQ ID NO: 3 (5'- UGUCGAUGCUGCCGGUGGAGG-3'), SEQ ID NO: 4 (5'- UUUCGACUGGACUCUGUCCUU-3'), SEQ ID NO: 5 (5'- AGUACGGACCACUGCCACCU-3'), SEQ ID NO: 6 (5'- AGCCGAUCUUGGACUUGACAU-3'), SEQ ID NO: 7 (5'- GUACGUCCCAGCGUGAUCUUC-3'), SEQ ID NO: 8 (5'- AUGUCGAUGCUGCCGGUGGAG-3'), SEQ ID NO: 9 (5'- UUCGACUGGACUCUGUCCUUG-3'), SEQ ID NO: 10 (5'- GGCGACUUGGGUGGAGUACGG-3'), SEQ ID NO: 11 (5'- GGCGACUUGUACACGAUCUCC-3'), SEQ ID NO: 12 (5'- UAUGUCGAUGCUGCCGGUGGA-3'), SEQ ID NO: 13 (5'- UAUGCGAGCUUGGGUCACUG-3'), SEQ ID NO: 14 (5'- UGUACGUCCCAGCGUGAUCUU-3'), SEQ ID NO: 15 (5'- GUCGAUGCUGCCGGUGGAGGA-3'), SEQ ID NO: 16 (5'- AACCCGUACGUCCCAGCGUGA-3'), SEQ ID NO: 17 (5'- GUACGGACCACUGCCACCUUC-3'), SEQ ID NO: 18 (5'- GUAGCCGCUGCGAUCCCCUGA-3'), SEQ ID NO: 19 (5'- UGGCGAUCUUCGUUUUACCAU-3'), SEQ ID NO: 20 (5'- UUCGUCAGCUAGCGUGGCGAG-3'), SEQ ID NO: 21 (5'- UCUUUGCUUUUACUGACCAUG-3') or SEQ ID NO: 22 (5'- UCAAGCUUCUCAGAUUUUAC-3').

[0009] In one embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 1 (5'-UUCGCGGAAGGUCAGCUUGUG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 23 (5'-CACAAGCUCCUUCCGCGAG-3'). In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 1 (5'-UUCGCGGAAGGUCAGCUUGUG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 23 (5'-CACAAGCUCCUUCCGCGAG-3').

[0010] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 2 (5'-GACGGCGACUUGGGUGGAGUA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 24 (5'-UACUCCACAAGUCGCCGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 2 (5'-GACGGCGACUUGGGUGGAGUA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 24 (5'-UACUCCACAAGUCGCCGUU-3').

[0011] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 3 (5'-UGUCGAUGCUGCCGGUGGAGG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 25 (5'-CCUCCACCCAGCAUCGAUA-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 3 (5'-UGUCGAUGCUGCCGGUGGAGG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 25 (5'-CCUCCACCCAGCAUCGAUA-3').

[0012] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 4 (5'-UUUCGACUGGACUCUGUCCUU-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 26 (5'-AAGGACAGUCCAGUCGAAG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 4 (5'-UUUCGACUGGACUCUGUCCUU-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 26 (5'-AAGGACAGUCCAGUCGAAG-3').

[0013] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 5 (5'-AGUACGGACCACUGCCACCUU-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 27 (5'-AAGGUGGCUGGUCCGUAUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 5 (5'-AGUACGGACCACUGCCACCUU-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 27 (5'-AAGGUGGCUGGUCCGUAUU-3').

[0014] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 6 (5'-AGCCGAUCUUGGACUUGACAU-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 28 (5'-AUGUCAAGCAAGAUCGGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 5 (5'-AGUACGGACCACUGCCACCUU-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 28 (5'-AAGGUGGCUGGUCCGUAUU-3').

[0015] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 7 (5'-GUACGUCCCAGCGUGAUCUUC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 29 (5'-GAAGAUCACUGGGACGUAU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 7 (5'-GUACGUCCCAGCGUGAUCUUC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 29 (5'-GAAGAUCACUGGGACGUAU-3').

[0016] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 8 (5'-AUGUCGAUGCUGCCGGUGGAG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 30 (5'-CUCCACCGAGCAUCGAUAU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 8 (5'-AUGUCGAUGCUGCCGGUGGAG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 30 (5'-CUCCACCGAGCAUCGAUAU-3').

[0017] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 9 (5'-UUCGACUGGACUCUGUCCUUG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 31 (5'-CAAGGACAGUCCAGUCGAA-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 9 (5'-AUGUCGAUGCUGCCGGUGGAG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 31 (5'-CUCCACCGAGCAUCGAUAU-3').

[0018] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 10 (5'-GGCGACUUGGGUGGAGUACGG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 32 (5'-CCGUACUCCCCAAGUCGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 10 (5'-GGCGACUUGGGUGGAGUACGG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 32 (5'-CCGUACUCCCCAAGUCGUU-3').

[0019] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 11 (5'-GGCGACUUGUACACGAUCUCC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 33 (5'-GGAGAUCGUACAAGUCGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 11 (5'-GGCGACUUGUACACGAUCUCC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 33 (5'-GGAGAUCGUACAAGUCGUU-3').

[0020] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 12 (5'-UAUGUCGAUGCUGCCGGUGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 34 (5'-UCCACCGGGCAUCGACAUG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 12 (5'-UAUGUCGAUGCUGCCGGUGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 34 (5'-UCCACCGGGCAUCGACAUG-3').

[0021] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 13 (5'-UAUGCGAGCUUGGGUCACGUG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 35 (5'-CACGUGACAAGCUCGCAUG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 13 (5'-UAUGCGAGCUUGGGUCACGUG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 35 (5'-CACGUGACAAGCUCGCAUG-3').

[0022] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 14 (5'-UGUACGUCCCAGCGUGAUCUU-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 36 (5'-AAGAUCACUGGGACGUAUG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 14 (5'-UGUACGUCCCAGCGUGAUCUU-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 36 (5'-AAGAUCACUGGGACGUAUG-3').

[0023] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 15 (5'-GUCGAUGCUGCCGGUGGAGGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 37 (UCCUCCACGCAGCAUCGAU). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 15 (5'-GUCGAUGCUGCCGGUGGAGGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 37 (UCCUCCACGCAGCAUCGAU).

[0024] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 16 (5'-AACCCGUACGUCCCAGCGUGA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 38 (5'-UCACGCUGACGUACGGGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 16 (5'-AACCCGUACGUCCCAGCGUGA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 38 (5'-UCACGCUGACGUACGGGUU-3').

[0025] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 17 (5'-GUACGGACCACUGCCACCUUC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 39 (5'-GAAGGUGGGUGGUCCGUAU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 17 (5'-GUACGGACCACUGCCACCUUC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 39 (5'-GAAGGUGGGUGGUCCGUAU-3').

[0026] In another embodiment, the guide sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 18 (5'-GUAGCCGCUGCGAUCCCCUGA-3'), and the non-guide region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 40 (5'-UCAGGGGAGCAGCGGCUAU-3'). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 18 (5'-GUAGCCGCUGCGAUCCCCUGA-3'), and the non-guide region comprises the sequence of SEQ ID NO: 40 (5'-UCAGGGGAGCAGCGGCUAU-3').

[0027] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 19 (5'-UGGCGAUCUUCGUUUUACCAU-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 41 (5'-AUGGUAAAGAAGAUCGUUA-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 19 (5'-UGGCGAUCUUCGUUUUACCAU-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 41 (5'-AUGGUAAAGAAGAUCGUUA-3').

[0028] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 20 (5'-UUCGUCAGCUAGCGUGGCGAG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 42 (5'-CUCGCCACUAGCUGACGAG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 20 (5'-UUCGUCAGCUAGCGUGGCGAG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 42 (5'-CUCGCCACUAGCUGACGAG-3').

[0029] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 21 (5'-UCUUUGCUUUUACUGACCAUG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 43 (5'-CAUGGUCAAAAAGCAAAGA-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 21 (5'-UCUUUGCUUUUACUGACCAUG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 43 (5'-CAUGGUCAAAAAGCAAAGA-3').

[0030] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 22 (5'-UCAAGCUUCUCAGAUUUUAC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 44 (5'-GUAAAAUCAGAAGCUUGA-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 22 (5'-UCAAGCUUCUCAGAUUUUAC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 44 (5'-GUAAAAUCAGAAGCUUGA-3').

[0031] In any of the embodiments described herein, the guiding strand and the non-guiding strand may be joined by an RNA adapter capable of forming a loop structure. In some embodiments, the RNA adapter comprises 4 to 50 nucleotides. In some embodiments, the loop structure comprises 4 to 20 nucleotides.

[0032] In some embodiments of the above aspects and examples, these artificial miRNA molecules target the 3'-untranslated region (3'-UTR) of tau mRNA. In some embodiments, these artificial miRNA molecules exhibit low off-target potential.

[0033] In some embodiments of the foregoing aspects and examples, this disclosure provides an expression construct comprising a nucleic acid encoding an artificial miRNA molecule described herein. In some embodiments, the nucleic acid encoding these artificial miRNA molecules is embedded in a miRNA scaffold. In some embodiments, the nucleic acid encoding the artificial miRNA is operatively linked to a promoter. In some embodiments, the promoter is selected from cytomegalovirus (CMV) immediate early promoter, RSV LTR, MoMLV LTR, phosphoglycerate kinase-1 (PGK) promoter, simian virus 40 (SV40) promoter, CK6 promoter, thyroxine transporter promoter (TTR), TK promoter, tetracycline-responsive promoter (TRE), HBV promoter, hAAT promoter, LSP promoter, chimeric liver-specific promoter (LSP), E2F promoter, telomerase (hTERT) promoter; cytomegalovirus enhancer / chicken β-actin / rabbit β-globin promoter (CAG) promoter, elongation factor 1-α promoter (EF1-α) promoter, human β-glucuronidase promoter, chicken β-actin (CBA) promoter, retroviral Rous sarcoma virus (RSV) LTR promoter, dihydrofolate reductase promoter, and 13-actin promoter. In some embodiments, the expression construct further includes introns. In some embodiments, the intron is a CBA intron or an hEF1α intron. In some embodiments, the intron is a chimeric intron. In some embodiments, the expression vector is a self-complementary vector, and the intron is a δ-chimeric intron. In some embodiments, the expression construct further comprises a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK polyadenylation signal.

[0034] In some embodiments, this disclosure provides a vector comprising any of the expression constructs described herein. In some embodiments, the vector is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the expression construct is flanked by one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the expression construct is flanked by two AAV ITRs. In some embodiments, these AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV serotype ITRs. In some embodiments, these AAV ITRs are AAV2 ITRs. In some embodiments, the vector further comprises a filler nucleic acid. In some embodiments, the filler nucleic acid is located upstream or downstream of the nucleic acid encoding the artificial miRNA. In some embodiments, the vector is a self-complementary rAAV vector. In some embodiments, the vector comprises a first nucleic acid sequence encoding the artificial miRNA and a second nucleic acid sequence encoding the complement of the artificial miRNA, wherein the first nucleic acid sequence may form intrastrand base pairs with the second nucleic acid sequence along most or all of its length. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion of the D region and a mutation comprising a terminal resolution sequence.

[0035] In some embodiments, this disclosure provides cells comprising any rAAV vector as described herein.

[0036] In some embodiments, this disclosure provides recombinant AAV particles comprising any rAAV vector as described herein. In some embodiments, the AAV virus particle comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, AAV2-HBKO, AAVDJ8, AAVPHP.B, AAVPHP.eB, AAVBR1, AAVHSC15, AAVHSC17, goat AAV, AAV1 / AAV2 chimeric capsid, bovine AAV or mouse AAV capsid, or rAAV2 / HBoV1 serotype capsid. In some embodiments, the ITR and the capsid of the rAAV viral particle originate from the same AAV serotype. In some embodiments, the ITR and the capsid of the rAAV viral particle originate from different AAV serotypes. In some embodiments, the ITR originates from AAV2 and the capsid of the rAAV particle originates from AAV1.

[0037] In some embodiments, the capsid protein of the rAAV particle is a modified AAV9 capsid. In some such embodiments, the modified AAV9 capsid protein of the AAV viral particle contains targeting peptides inserted into the AAV9 capsid that alter the transduction and / or endosomal release of the viral particle upon administration to a patient. As disclosed herein, these rAAV particles containing modified AAV9 capsid proteins comprise three structural capsid proteins, VP1, VP2, and VP3. These three capsid proteins are alternative splice variants. In some embodiments, targeting peptides are inserted into the VP1, VP2, and VP3 capsid proteins within the rAAV particle.

[0038] In certain embodiments, the targeting peptide of the modified AAV9 capsid is inserted after residue 588 (numbered based on the VP1 number of AAV9) of the AAV9 structural protein. In some embodiments, the targeting peptide has SEQ ID NO: 57. In some embodiments, the targeting peptide is flanked by linker sequences at the N-terminus and C-terminus of the targeting peptide. In some embodiments, the linker sequence on the N-terminal side has sequence AAA. In some embodiments, the linker sequence on the C-terminal side is AS. In some embodiments, the complete sequence inserted after residue 588 of the AAV9 capsid structural protein has SEQ ID NO: 58. In some embodiments, the complete modified AAV9 capsid structural protein has SEQ ID NO: 59. In some embodiments, the complete modified AAV9 capsid structural protein is at least 90% (e.g., at least 92%, at least 95%, at least 98%, at least 98.5%, at least 99%, at least 99.2%, at least 99.5%, or at least 99.8%) identical to SEQ ID NO: 59, wherein the modified AAV9 structural capsid contains the targeting peptide of SEQ ID NO: 57. The capsid with SEQ ID NO: 59 is also referred to herein as SAN006 or AAV.SAN006.

[0039] In some embodiments, this disclosure provides a composition comprising any of the rAAV particles described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0040] In some embodiments, this disclosure provides a kit comprising any artificial miRNA molecule described herein. In some embodiments, this disclosure provides a kit comprising any AAV particles described herein. In some embodiments, this disclosure provides a kit comprising any composition described herein. In some embodiments, the kit further comprises instructions for use.

[0041] In some aspects, this disclosure provides methods for treating tau proteinopathy in patients of need, methods comprising administering to the patient a composition comprising an artificial miRNA containing a guide strand and a non-guided (follower) strand that binds tau mRNA, wherein the guide strand and the non-guided strand have sequences as disclosed herein. In some embodiments, the tau proteinopathy is progressive supranuclear palsy (PSP). In other embodiments, the tau proteinopathy is Alzheimer's disease (AD). In some embodiments, the tau proteinopathy is corticobasal degeneration.

[0042] In some aspects, this disclosure provides methods for reducing tau expression in patients with tau proteinopathy, methods comprising administering to the patient a composition comprising a miRNA containing a guide strand and a non-guided (follower) strand that binds tau mRNA, wherein the guide strand and the non-guided strand have sequences as disclosed herein. In some embodiments, administration of the artificial miRNA molecule disclosed herein prevents tau aggregation. In some embodiments, administration of the artificial miRNA molecule disclosed herein results in a reduction of existing tau aggregates. Attached Figure Description

[0043] Figure 1 This study demonstrates how the artificial miRNA sequence disclosed herein reduces tau expression in human cells. U2OS cells stably expressing full-length 4R tau with G272V and P301S mutations were transfected in triplicate with the indicated plasmid. Cells were lysed 72 hours after expression, and human tau protein was measured by ELISA and normalized relative to the total protein content in each sample. Values ​​represent the normalized mean + / - SEM relative to the control (CTL3). p<0.01, p<0.05, one-way ANOVA. The x-axis shows the various artificial miRNA molecules disclosed herein (see Table 1). The y-axis shows the decrease in tau expression levels.

[0044] Figures 2A-2B This study demonstrates that artificial miRNA sequences reduced tau expression in a mouse model of tau proteinopathy following intrastriatal injection of AAVrh.10. Total mRNA and protein were isolated from striatal tissue 4 weeks after delivery of the AAVrh.10-artificial miRNA. MAPT mRNA expression was quantified by TaqMan qPCR. Figure 2A ), and the reduction in human tau protein relative to total protein content was quantified using HT7 anti-human tau ELISA (). Figure 2B The data is the mean plus / minus SEM. p<0.05, p<0.01, p<0.001, one-way ANOVA.

[0045] Figure 3This study demonstrates that an artificial miRNA sequence, following injection of AAVrh.10 into the hippocampus, reduces human tau protein expression in a mouse model of tau proteinopathy. Sagittal sections of the brains of Tau22 mice were collected four weeks after hippocampal injection of the indicated AAVrh.10-artificial miRNA. Immunostaining of the tissues against human tau and the neuronal marker NeuN revealed a reduction in tau in neurons of the dentate gyrus of the hippocampus.

[0046] Figure 4 This study demonstrates that an artificial miRNA sequence reduced human tau expression in a mouse model of tau proteinopathy following intrastriatal injection of AAV.SAN006. Total mRNA was isolated from striatal tissue 4 weeks after delivery of the AAV.SAN006-artificial miRNA. MAPT mRNA expression was quantified by TaqMan RT-dPCR. Data are mean ± SEM. p<0.01, one-way ANOVA.

[0047] Figures 5A-5B This demonstrates that the artificial miRNA sequences exhibit excellent strand bias and accurate 5' processing in vivo. Total striatal RNA was isolated from Tau22 animals treated with the AAVrh.10 vector expressing the indicated artificial miRNA and submitted for small RNA sequencing. The expression of the guide strand and lagging strand was analyzed from three animals from each treatment. Figure 5A ) and the cleavage efficiency of precursor miRNA ( Figure 5B This is used to generate a mature guidance chain for prediction. The data is the mean + / - SD, and individual animals are plotted.

[0048] Figures 6A-6B This study demonstrates that the artificial miRNA sequence disclosed herein reduced human tau mRNA and protein in a mouse model of tau proteinopathy following intravenous injection of AAV-PHP.eB. Total mRNA and protein were isolated from hindbrain tissue four weeks after delivery of the AAV-PHP.eB vector expressing the indicated artificial miRNA. Gene expression was analyzed using ddPCR and human MAPT TaqMan assays. Figure 6A ), and the expression of human tau protein from the same samples was quantified using an anti-human tau ELISA. Figure 6B The data is the mean plus / minus SEM. p<0.01, p<0.0001, one-way ANOVA.

[0049] Figures 7A-7B The use of a late-intervention efficacy paradigm demonstrates the reduction of total tau and phosphate-bound tau protein in a mouse model of tau proteinopathy using artificial miRNA sequences. Tissue homogenates were prepared from the hindbrain and spinal cord three months after delivery of the AAV-PHP.eB vector expressing the indicated artificial miRNA into six-month-old Tau22 mice. Total tau protein was analyzed using the Quanterix Simoa assay. Figure 7A ) and phosphate tau 181 protein ( Figure 7B The data is the mean plus / minus SEM. p<0.05, p<0.01, p<0.001, p<0.0001, one-way ANOVA.

[0050] Figures 8A-8D The use of a late-intervention efficacy paradigm demonstrated the reduction of phosphate-tau aggregates in a mouse model of tau proteinopathy using an artificial miRNA sequence. Three months after delivery of the AAV-PHP.eB vector expressing the indicated artificial miRNA into six-month-old Tau22 mice, fixed tissue sections were prepared from the cortex and hindbrain. Immunohistochemistry of the tissues was performed using an AT8 antibody recognizing phosphate-tau 202 / 205. Figure 8A ), and in the cortex ( Figure 8C ) and the back of the head ( Figure 8D Pixel-based thresholding analysis of images using weak, medium, and strong AT8+ signals ( ) Figure 8B The data is the average plus or minus SD. p<0.05, p<0.01, two-way ANOVA.

[0051] Figures 9A-9B The efficacy paradigm of late intervention demonstrates the reduction of neurofilament light chains in plasma and CSF in a mouse model of tau proteinopathy using an artificial miRNA sequence. Plasma and CSF were collected three months after delivery of the AAV-PHP.eB vector expressing the indicated artificial miRNA into six-month-old Tau22 mice. Plasma was measured using the Quanttrics Simoa assay. Figure 9A ) and CSF ( Figure 9B Neurofilament light chains (NfL) in ). Data are mean + / - SEM. p<0.05, p<0.01, two-way ANOVA, such as Figure 9A The data described in the text, and α: p < 0.01, one-way ANOVA, such as... Figure 9B As depicted in the text. Detailed Implementation

[0052] Microtubule-associated protein tau (MAPT) plays a pathogenic role in a range of devastating and incurable neurodegenerative diseases known as tau diseases. Among these, progressive supranuclear palsy (PSP) is a predominantly sporadic disease characterized by the presence of tetraduplex tau atypical structures in neurons and glial cells, as well as degeneration of subcortical structures. This pathology manifests as severe and progressive motor and cognitive deficits, for which there are no approved disease-modifying therapies.

[0053] In some respects, methods for reducing MAPT expression in multiple models of neurological disorders can provide safe treatment; can reverse neuropathology; can slow tau aggregate formation and spread; and / or can improve cognitive deficits. RNA interference (RNAi) has shown increasing promise as a therapeutic approach for reducing target mRNA and protein levels. In some embodiments, the method may include the use of RNAi. In some embodiments, adeno-associated virus (AAV) may be a gene delivery vector configured to express a therapeutic construct in the brain over a long period. Various embodiments are provided, including the use of AAV-RNAi vectors for total MAPT reduction for the treatment of tau proteinopathy, such as PSP.

[0054] Current treatments for tau proteinopathy are largely symptomatic and supportive, and none have shown significant reduction in tau proteinopathy symptoms. While many tau-targeting therapeutics are under development, most target the tau protein itself. However, given the heterogeneity of tau isoform expression, post-translational modifications, and conformation among tau proteinopathy patients, targeting the tau protein itself may be problematic.

[0055] In some respects, this disclosure provides methods for targeting upstream MAPT mRNA with artificial miRNAs. Such methods may support broad therapeutic effects.

[0056] In some aspects, this disclosure provides artificial miRNA molecules for treating tau proteinopathy. In some embodiments, tau proteinopathy is supranuclear paralysis (PSP). In some embodiments, tau proteinopathy is Alzheimer's disease (AD). In some embodiments, tau proteinopathy is corticobasal degeneration. In some embodiments, the artificial miRNA reduces the expression of tau protein.

[0057] In some embodiments, the therapeutic constructs described herein may relate to fields including RNA inhibition, molecular biology, and / or central nervous system (CNS) gene therapy. In some embodiments, the therapeutic constructs described herein may be designed to reduce the expression of the microtubule-associated protein tau and may provide a method for treating neurodegenerative tau protein diseases, including progressive supranuclear palsy (PSP) and / or Alzheimer's disease (AD).

[0058] In some embodiments, the artificial miRNA comprises a guide strand having a nucleotide sequence having at least about 90% or at least about 95% identity with the following sequences: SEQ ID NO: 1 (5'-UUCGCGGAAGGUCAGCUUGUG-3') SEQ ID NO: 51 (5'- XUCGCGGAAGGUCAGCUUGUG-3'), SEQ ID NO: 2 (5'- GACGGCGACUUGGGUGGAGUA-3'), SEQ ID NO: 3 (5'- UGUCGAUGCUGCCGGUGGAGG-3'), SEQ ID NO: 4 (5'- UUUCGACUGGACUCUGUCCUU-3'), SEQ ID NO: 52 (5'- XUUCGACUGGACUCUGUCCUU-3'), SEQ ID NO: 5 (5'- AGUACGGACCACUGCCACCU-3'), SEQ ID NO: 6 (5'- AGCCGAUCUUGGACUUGACAU-3'), SEQ ID NO: 7 (5'- GUACGUCCCAGCGUGAUCUUC-3'), SEQ ID NO: 8 (5'- AUGUCGAUGCUGCCGGUGGAG-3'), SEQ ID NO: 9 (5'- UUCGACUGGACUCUGUCCUUG-3'), SEQ ID NO: 10 (5'- GGCGACUUGGGUGGAGUACGG-3'), SEQ ID NO: 11 (5'- GGCGACUUGUACACGAUCUCC-3'), SEQ ID NO: 12 (5'- UAUGUCGAUGCUGCCGGUGGA-3'), SEQ ID NO: 53 (5'- XAUGUCGAUGCUGCCGGUGGA-3'), SEQ ID NO: 13 (5'- UAUGCGAGCUUGGGUCACGUG-3'), SEQ ID NO: 54 (5'- XAUGCGAGCUUGGGUCACGUG-3'), SEQ ID NO: 14 (5'- UGUACGUCCCAGCGUGAUCUU-3'), SEQ ID NO: 55 (5'- XGUACGUCCCAGCGUGAUCUU-3'), SEQ ID NO: 15 (5'- GUCGAUGCUGCCGGUGGAGGA-3'), SEQ ID NO: 16 (5'- AACCCGUACGUCCCAGCGUGA-3'), SEQ ID NO: 17 (5'- GUACGGACCACUGCCACCUUC-3'), SEQ ID NO: 18 (5'- GUAGCCGCUGCGAUCCCCUGA-3'), SEQ ID NO: 19 (5'- UGGCGAUCUUCGUUUUACCAU-3'), SEQ ID NO: 20 (5'- UUCGUCAGCUAGCGUGGCGAG-3'), SEQ ID NO: 56 (5'- XUCGUCAGCUAGCGUGGCGAG-3'), SEQ ID NO: 21 (5'- UCUUUGCUUUUACUGACCAUG-3') or SEQ ID NO: 22 (5'- UCAAGCUUCUCAGAUUUUAC-3'), wherein X is a nucleotide selected from C, A, and G.

[0059] In some embodiments, the artificial miRNA comprises a second strand (lagging strand) containing a non-guided region comprising a nucleotide sequence partially complementary to the nucleotide sequence of the guide region. In one embodiment, the guide sequence comprises the sequence of SEQ ID NO: 1, and the non-guided region comprises the sequence of SEQ ID NO: 23. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 2, and the non-guided region comprises the sequence of SEQ ID NO: 24. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 3, and the non-guided region comprises the sequence of SEQ ID NO: 25. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 4, and the non-guided region comprises the sequence of SEQ ID NO: 26. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 5, and the non-guided region comprises the sequence of SEQ ID NO: 27. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 6, and the non-guided region comprises the sequence of SEQ ID NO: 28. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 7, and the unguided region comprises the sequence of SEQ ID NO: 29. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 8, and the unguided region comprises the sequence of SEQ ID NO: 30. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 9, and the unguided region comprises the sequence of SEQ ID NO: 31. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 10, and the unguided region comprises the sequence of SEQ ID NO: 32. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 11, and the unguided region comprises the sequence of SEQ ID NO: 33. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 12, and the unguided region comprises the sequence of SEQ ID NO: 34. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 13, and the unguided region comprises the sequence of SEQ ID NO: 35. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 14, and the unguided region comprises the sequence of SEQ ID NO: 36. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 15, and the unguided region comprises the sequence of SEQ ID NO: 37. In yet another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 16, and the unguided region comprises the sequence of SEQ ID NO: 38.In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 17, and the unguided region comprises the sequence of SEQ ID NO: 39. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 18, and the unguided region comprises the sequence of SEQ ID NO: 40. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 19, and the unguided region comprises the sequence of SEQ ID NO: 41. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 20, and the unguided region comprises the sequence of SEQ ID NO: 42. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 21, and the unguided region comprises the sequence of SEQ ID NO: 43. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 22, and the unguided region comprises the sequence of SEQ ID NO: 44.

[0060] In one embodiment, the guide sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 51 (5'-XUCGCGGAAGGUCAGCUUGUG-3'), and the non-guide region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 23 (5'-CACAAGCUCCUUCCGCGAG-3'). In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 51 (5'-XUCGCGGAAGGUCAGCUUGUG-3'), and the non-guide region comprises the sequence of SEQ ID NO: 23 (5'-CACAAGCUCCUUCCGCGAG-3'), wherein X is a nucleotide selected from C, A, and G.

[0061] In another embodiment, the guide sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 52 (5'-XUUCGACUGGACUCUGUCCUU-3'), and the non-guide region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 26 (5'-AAGGACAGUCCAGUCGAAG-3'). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 52 (5'-XUUCGACUGGACUCUGUCCUU-3'), and the non-guide region comprises the sequence of SEQ ID NO: 26 (5'-AAGGACAGUCCAGUCGAAG-3'), wherein X is a nucleotide selected from C, A, and G.

[0062] In another embodiment, the guide sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 53 (5'-XAUGUCGAUGCUGCCGGUGGA-3'), and the non-guide region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 34 (5'-UCCACCGGGCAUCGACAUG-3'). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 53 (5'-XAUGUCGAUGCUGCCGGUGGA-3'), and the non-guide region comprises the sequence of SEQ ID NO: 34 (5'-UCCACCGGGCAUCGACAUG-3'), wherein X is a nucleotide selected from C, A, and G.

[0063] In another embodiment, the guide sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 54 (5'-XAUGCGAGCUUGGGUCACGUG-3'), and the non-guide region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 35 (5'-CACGUGACAAGCUCGCAUG-3'). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 54 (5'-XAUGCGAGCUUGGGUCACGUG-3'), and the non-guide region comprises the sequence of SEQ ID NO: 35 (5'-CACGUGACAAGCUCGCAUG-3'), wherein X is a nucleotide selected from C, A, and G.

[0064] In another embodiment, the guide sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 55 (5'-XGUACGUCCCAGCGUGAUCUU-3'), and the non-guide region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 36 (5'-AAGAUCACUGGGACGUAUG-3'). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 55 (5'-XGUACGUCCCAGCGUGAUCUU-3'), and the non-guide region comprises the sequence of SEQ ID NO: 36 (5'-AAGAUCACUGGGACGUAUG-3'), wherein X is a nucleotide selected from C, A, and G.

[0065] In another embodiment, the guide sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 56 (5'-XUCGUCAGCUAGCGUGGCGAG-3'), and the non-guide region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 42 (5'-CUCGCCACUAGCUGACGAG-3'). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 56 (5'-XUCGUCAGCUAGCGUGGCGAG-3'), and the non-guide region comprises the sequence of SEQ ID NO: 42 (5'-CUCGCCACUAGCUGACGAG-3'), wherein X is a nucleotide selected from C, A, and G.

[0066] In some aspects, this disclosure provides expression constructs, vectors (e.g., recombinant AAV vectors), cells, viral particles (e.g., AAV particles), and pharmaceutical compositions comprising the artificial miRNAs disclosed herein. In other aspects, this disclosure provides methods for treating tau proteinosis in mammals, methods comprising administering to the mammal a pharmaceutical composition comprising the artificial miRNAs disclosed herein. In some embodiments, tau proteinosis is supranuclear paralysis (PSP), Alzheimer's disease (AD), or corticobasal degeneration. I. General Technology

[0067] The techniques and procedures described or cited herein are generally well known to those skilled in the art and are typically employed using conventional methods, such as those widely used as described in the following literature: *Molecular Cloning: A Laboratory Manual* (Sambrook et al., 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2012); *Current Protocols in Molecular Biology* (edited by F.M. Usubel et al., 2003); *Methods in Enzymology* (Academic Press, Inc.); *PCR 2: A Practical Approach* (edited by M.J. MacPherson, B.H. Dames, and G.R. Taylor, 1995); *Antibodies, A Laboratory Manual* (edited by Harlow and Lane, 1988); *Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications*. [Animal Cell Culture: Basic Techniques and Specialized Applications] (RIFreshney, 6th Edition, J. Wiley and Sons, 2010); Oligonucleotide Synthesis (edited by MJ Gait, 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (edited by JECellis, Academic Press, 1998); Introduction to Cell and Tissue Culture (JP Mather and PE...)Roberts, Plenum Press, 1998); Celland Tissue Culture: Laboratory Procedures (edited by A. Doyle, J.B. Griffiths, and D.G. Newell, J. Wiley and Sons, 1993-8); Handbook of Experimental Immunology (edited by D.M. Weir and C.C. Blackwell, 1996); Gene Transfer Vectors for Mammalian Cells (edited by J.M. Miller and MP. Calos, 1987); PCR: The Polymerase Chain Reaction (edited by Mullis et al., 1994); Current Protocols in Immunology (edited by J.E. Coligan et al., 1991); Short Protocols in Molecular Biology (edited by Ausubel et al., J. Wiley and Sons). [John Willie & Son Publishing, 2002]); Immunobiology (CA Janeway et al., 2004); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (D. Catty, ed., IRL Press, 1988-1989); Monoclonal Antibodies: A Practical Approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D.Lane, Cold Spring Harbor Laboratory Press, 1999; The Antibodies (edited by M. Zanetti and JD Capra, Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (edited by VT DeVita et al., JB Lippincott Company, 2011). II. Definition

[0068] As used in this article, “vector” refers to a recombinant plasmid or virus containing nucleic acid to be delivered to a host cell in vitro or in vivo.

[0069] As used herein, the term "polynucleotide" or "nucleic acid" refers to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Therefore, the term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases. The backbone of a polynucleotide may contain sugar and phosphate groups (as commonly found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of a polynucleotide may contain polymers of synthetic subunits such as aminophosphates, and thus may be oligodeoxynucleotide aminophosphates (P-NH2) or mixed aminophosphate-phosphodiester oligomers. Furthermore, double-stranded polynucleotides can be obtained from chemically synthesized single-stranded polynucleotide products by synthesizing the complementary strand and annealing it under appropriate conditions, or by using a DNA polymerase to synthesize the complementary strand de novo with appropriate primers.

[0070] The terms “peptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues, and are not limited to a minimum length. Such polymers of amino acid residues can contain native or non-native amino acid residues, and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and polymers of amino acid residues. Full-length proteins and fragments thereof are included in this definition. These terms also include post-expression modifications of peptides, such as glycosylation, sialylation, acetylation, phosphorylation, etc. Furthermore, for the purposes of this disclosure, “peptide” refers to a protein that includes modifications to its native sequence, such as deletions, additions, and substitutions (generally conserved in nature), provided that the protein maintains the desired activity. These modifications can be intentional, such as by site-directed mutagenesis, or accidental, such as by mutations in the host that produces the protein or by errors due to PCR amplification.

[0071] "Recombinant viral vector" refers to a recombinant polynucleotide vector containing one or more heterologous sequences (i.e., nucleic acid sequences not derived from viruses). In the case of recombinant AAV vectors, the recombinant nucleic acid is flanked by at least one (and in some embodiments, two) inverted terminal repeat (ITR) sequences.

[0072] "Recombinant AAV vector (rAAV vector)" refers to a polynucleotide vector containing one or more heterologous sequences (i.e., nucleic acid sequences not derived from AAV), flanked by at least one (and in this example, two) AAV inverted terminal repeat (ITR) sequences. Such rAAV vectors can replicate and be packaged into infectious viral particles when present in host cells that have been infected with a suitable helper virus (or are expressing a suitable helper function) and are expressing AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). When the rAAV vector is incorporated into a larger polynucleotide (e.g., into a chromosome or into another vector such as a plasmid used for cloning or transfection), it can be referred to as a "pro-vector," which can be "rescued" through replication and capsidation in the presence of AAV packaging function and a suitable helper function. rAAV vectors can be in any of a variety of forms, including but not limited to plasmids, linear artificial chromosomes, lipid complexes, encapsulated in liposomes, and capsidated within viral particles, particularly AAV particles. The rAAV vector can be packaged into the capsid of the AAV virus to produce "recombinant adeno-associated virus particles (rAAV particles)".

[0073] "Heterologous" means originating from an entity that is genotypically different from the entity being compared to it or which is introduced or incorporated into it. For example, polynucleotides introduced into different cell types through genetic engineering are heterologous polynucleotides (and when expressed, can encode heterologous polypeptides). Similarly, cellular sequences (e.g., genes or portions thereof) incorporated into viral vectors are heterologous nucleotide sequences relative to the vector.

[0074] The term "transgenic" refers to a polynucleotide introduced into a cell that is capable of being transcribed into RNA and optionally translated and / or expressed under appropriate conditions. In some respects, it confers desired properties to the cell into which it is introduced, or otherwise produces desired therapeutic or diagnostic outcomes. In other respects, it can be transcribed into molecules that mediate RNA interference, such as miRNA, siRNA, or shRNA.

[0075] “Chicken β-actin (CBA) promoter” refers to a polynucleotide sequence derived from the chicken β-actin gene (e.g., Gallus gallus β-actin, represented by GenBank Entrez gene ID 396526). As used herein, “chicken β-actin promoter” can refer to a promoter containing a cytomegalovirus (CMV) early enhancer element, the promoter and first exon and intron of the chicken β-actin gene, and the splice acceptor of the rabbit β-globin gene, such as the sequence described in Miyazaki, J. et al. (1989) Gene [Gene] 79(2):269-77. As used herein, the term “CAG promoter” is used interchangeably. As used herein, the terms “CMV early enhancer / chicken β-actin (CAG) promoter” are used interchangeably.

[0076] The terms “genomic particles (gp),” “genomic equivalent,” or “genomic copy” used in relation to viral titers refer to the number of virions containing the recombinant AAV DNA genome, and are unrelated to infectivity or functionality. The number of genomic particles in a particular vector formulation can be measured using procedures as illustrated in the examples herein or described, for example, in the following literature: Clark et al. (1999) Hum. Gene Ther. [Human Gene Therapy], 10:1031-1039; Veldwijk et al. (2002) Mol. Ther. [Molecular Therapy], 6:272-278.

[0077] As used herein, the term "vector genome (vg)" can refer to one or more polynucleotides comprising a set of polynucleotide sequences of a vector (e.g., a viral vector). The vector genome may be capsidated within the viral particle. Depending on the specific viral vector, the vector genome may comprise single-stranded DNA, double-stranded DNA, or single-stranded RNA, or double-stranded RNA. The vector genome may include endogenous sequences associated with the specific viral vector and / or any heterologous sequences inserted into the specific viral vector via recombination techniques. For example, a recombinant AAV vector genome may include at least one ITR sequence flanking the promoter, filler sequence, target sequence (e.g., miRNA), and polyadenylated sequence. A complete vector genome may comprise a complete set of polynucleotide sequences of the vector. In some embodiments, the nucleic acid titer of the viral vector may be measured in vg / mL. Suitable methods for measuring such titers are known in the art (e.g., quantitative PCR).

[0078] As used herein, the term “inhibition” can refer to an action that blocks, reduces, eliminates, or otherwise antagonizes the presence or activity of a particular target. Inhibition can refer to partial or complete inhibition. For example, inhibiting gene expression can refer to any action that results in the arrest, reduction, elimination, or any other antagonism of gene expression, including a decrease in mRNA abundance (e.g., silencing mRNA transcription), mRNA degradation, inhibition of mRNA translation, etc. In some embodiments, inhibiting Tau protein expression can refer to the arrest, reduction, elimination, or any other antagonism of Tau protein expression, including a decrease in Tau mRNA abundance (e.g., silencing Tau mRNA transcription), Tau mRNA degradation, inhibition of Tau mRNA translation, etc. As another example, inhibiting protein accumulation in cells can refer to any action that results in the arrest, reduction, elimination, or any other antagonism of protein expression, including a decrease in mRNA abundance (e.g., silencing mRNA transcription), mRNA degradation, inhibition of mRNA translation, protein degradation, etc. In some embodiments, inhibiting the accumulation of Tau protein in cells refers to the blocking, reduction, elimination, or other antagonism of Tau protein expression in cells, including a decrease in Tau mRNA abundance (e.g., silencing Tau mRNA transcription), degradation of Tau mRNA, inhibition of Tau mRNA translation, degradation of Tau protein, etc.

[0079] The terms “infectious unit (iu),” “infectious particle” or “replication unit” used in relation to viral titers refer to the number of infectious and reproducible recombinant AAV vector particles as measured by an infection center assay (also known as a replication center assay), as described, for example, in McLaughlin et al. (1988) J. Virol. [Journal of Virology], 62:1963-1973.

[0080] For example, the term “transduction unit (tu)” used in relation to viral titers refers to the number of infectious recombinant AAV vector particles that cause the production of functional transgenic products, as measured in functional assays such as those described in the examples herein or in, for example, the following literature: Xiao et al. (1997) Exp. Neurobiol. [Experimental Neurobiology], 144:113-124; or Fisher et al. (1996) J. Virol. [Journal of Virology], 70:520-532 (LFU assay).

[0081] "Inverted terminal repeat" or "ITR" sequence is a well-known term in the field, referring to a relatively short sequence with opposite orientation found at the end of a viral genome.

[0082] The term "AAV inverted terminal repeat (ITR)" is well-known in the art and refers to a sequence of approximately 145 nucleotides located at both ends of a natural single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be present in either of two optional orientations, resulting in heterogeneity between different AAV genomes and between the two ends of a single AAV genome. These outermost 125 nucleotides also contain several shorter, self-complementary regions (named A, A', B, B', C, C', and D regions), allowing intrastrand base pairing to occur within this portion of the ITR.

[0083] The "terminal dissociation sequence" or "trs" is a sequence in the D region of the AAV ITR that is cleaved by the AAV rep protein during viral DNA replication. The mutant terminal dissociation sequence is resistant to AAV rep protein cleavage.

[0084] "AAV helper functions" refer to the functions that allow AAV to be replicated and packaged by the host cell. AAV helper functions can be provided in any of a variety of forms, including but not limited to helper viruses or helper virus genes that assist AAV replication and packaging. Other AAV helper functions are known in the art, such as genotoxic agents.

[0085] A "helper virus" in AAV refers to a virus that allows AAV (a defective parvovirus) to be replicated and packaged by host cells. Helper viruses provide the "accessory function" that allows AAV replication. Many such helper viruses have been identified, including adenoviruses, herpesviruses, and poxviruses such as vaccinia and baculoviruses. Adenoviruses encompass many different subgroups, but subgroup C-type 5 adenovirus (Ad5) is the most commonly used. Many adenoviruses of human, non-human mammalian, and avian origin are known and available from collections such as the ATCC. Herpesviruses also available from collections such as the ATCC include, for example, herpes simplex virus (HSV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), and pseudorabies virus (PRV). Examples of adenovirus helper functions used for AAV replication include E1A, E1B, E2A, VA, and E4orf6 functions. Baculoviruses available from collections include the nucleopolyhedrovirus of the alfalfa silver-striped moth (Autographa californica).

[0086] If the ratio of infectious AAV particles to infectious helper virus particles is at least about 10... 2 : 1; at least about 10 4 1. At least about 10 6 : 1; or at least about 10 8 If the level is 1 or greater, the rAAV formulation is said to be "substantially free" of helper virus. In some embodiments, the formulation also does not contain an equivalent amount of helper virus proteins (i.e., proteins present due to this level of helper virus if the aforementioned helper virus particle impurities are present in cleaved form). Viral and / or cellular protein contamination can typically be observed as the presence of Coomassie staining bands on an SDS gel (e.g., the appearance of bands other than those corresponding to AAV capsid proteins VP1, VP2, and VP3).

[0087] The “sequence identity percentage (%)” for a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical to those in a reference polypeptide or nucleic acid sequence after sequence alignment and the introduction of vacancies (if necessary) to obtain the maximum sequence identity percentage, and without considering any conserved substitutions as part of the sequence identity. Alignments used to determine the amino acid or nucleic acid sequence identity percentage can be performed in various ways within the scope of the art, for example, using publicly available computer software programs, such as those described in Current Protocols in Molecular Biology (edited by Ausubel et al., 1987), Supplement 30, Chapter 7.7.18, Table 7.7.1, and including BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. A preferred alignment program is ALIGN Plus (Scientific and Educational Software, Pennsylvania). Those skilled in the art can determine appropriate parameters for measuring alignments, including any algorithms required to achieve maximum alignment across the full length of the sequences being compared. For the purposes of this paper, the percentage of amino acid sequence identity between a given amino acid sequence A and, and, with respect to a given amino acid sequence B (which can be alternatively expressed as a given amino acid sequence A having or containing a certain percentage of amino acid sequence identity with, and, and, with respect to a given amino acid sequence B) is calculated as follows: 100 multiplied by the fraction X / Y, where X is the number of amino acid residues that are identified as identical matches in the alignment of A and B by a sequence alignment program, and Y is the total number of amino acid residues in B. It should be understood that when the lengths of amino acid sequences A and B are not equal, the percentage of amino acid sequence identity between A and B will not be equal to the percentage of amino acid sequence identity between B and A. For the purposes of this paper, the percentage of nucleic acid sequence identity between a given nucleic acid sequence C and, or with respect to a given nucleic acid sequence D (which can be alternatively expressed as a given nucleic acid sequence C having or containing a certain percentage of nucleic acid sequence identity with, or with respect to, a given nucleic acid sequence D) is calculated as follows: 100 multiplied by the fraction W / Z, where W is the number of nucleotides that are identified as identical matches in the alignment of C and D by the sequence alignment program, and Z is the total number of nucleotides in D. It should be understood that when the lengths of nucleic acid sequences C and D are not equal, the percentage of nucleic acid sequence identity between C and D will not be equal to the percentage of nucleic acid sequence identity between D and C.

[0088] "Isolated" molecules (e.g., nucleic acids or proteins) or cells mean that they have been identified and separated from and / or recovered from their natural environment.

[0089] An "effective dose" is a dose sufficient to achieve a beneficial or desired outcome (including clinical outcomes, such as symptom improvement, achievement of clinical endpoints, etc.). An effective dose can be administered once or multiple times. In terms of disease state, an effective dose is a dose sufficient to improve, stabilize, or delay disease progression.

[0090] "Individual" or "subject" is a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In some embodiments, the individual or subject is a human.

[0091] As used herein, “treatment” is a method used to obtain a beneficial or desired clinical outcome. For the purposes of this disclosure, a beneficial or desired clinical outcome includes, but is not limited to, relief of symptoms, reduction of disease severity, stabilization of disease status (e.g., no worsening), prevention of disease spread (e.g., metastasis), delay or slowing of disease progression, improvement or mitigation of disease status, and remission (partial or complete), whether detectable or undetectable. “Treatment” may also mean prolonged survival compared to expected survival in the untreated condition.

[0092] As used herein, the term "preventive treatment" refers to treatment in which an individual is known or suspected of having a disorder or is at risk of developing a disorder, but has not yet exhibited symptoms of the disorder or has exhibited the minimum symptoms of the disorder. Individuals undergoing preventive treatment may receive treatment before symptoms develop.

[0093] As used herein, the term "tau proteinopathy" refers to heterogeneous neurodegenerative disorders characterized by the accumulation of phosphorylated and misfolded tau proteins in the brain parenchyma. Examples include, but are not limited to, Alzheimer's disease (AD), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), frontotemporal dementia with Parkinson's syndrome-17 (FTDP-17), Pick's disease (PiD), aerophilic granulomatosis (AGD), glioblastomatosis (GGT), chronic traumatic encephalopathy, and post-encephalitis Parkinson's syndrome.

[0094] A “miRNA scaffold” can refer to a polynucleotide containing: (i) a double-stranded sequence targeting a target gene for miRNA knockdown and (ii) an additional sequence forming a stem-loop structure similar to that of an endogenous miRNA. The target gene sequence (e.g., a short sequence of about 20 nt) can be linked to a sequence that produces a miRNA-like stem-loop and a sequence that base-pairs with the target sequence to form a double strand when the polynucleotide is assembled into a miRNA-like secondary structure. As described herein, this double strand may not be fully hybridized; for example, it may contain one or more unpaired or mispaired bases. When the polynucleotide is cleaved by Dicer, the double strand containing the target gene sequence can be unfolded and incorporated into the RISC complex. A miRNA scaffold can refer to the miRNA itself or to the DNA polynucleotide encoding the miRNA. An example of a miRNA scaffold is the miR-155 sequence (Lagos-Quintana, M. et al. (2002) Curr. Biol. [Current Biology] 12:735-9). Commercially available kits for cloning sequences into miRNA scaffolds are known in the art (e.g., the Invitrogen™ BLOCK-iT™ Pol II miRNA interference expression vector kit, from Life Technologies, Thermo Fisher Scientific, Waltham, MA).

[0095] As used herein, a "bulge" refers to a region in a nucleic acid that is not complementary to its counterpart in the duplex nucleic acid. For example, a bulge can refer to a nucleic acid sequence that is not complementary to its counterpart in the duplex nucleic acid, where the flanks of the bulge are regions in the nucleic acid complementary to its counterpart in the duplex nucleic acid. In some instances, the length of a bulge can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 bases. In some instances, a bulge may be the result of mispairing (e.g., the counterpart contains non-complementary bases), or it may be the result of unpairing (e.g., the counterpart contains a nucleic acid complementary to the nucleic acid flanking the bulge, but the counterpart does not contain the nucleic acid opposite the bulge).

[0096] As used herein, the term "sense" nucleic acid is a nucleic acid that contains all or part of the sequence encoding a transgene. In some instances, the mRNA of a transgene is a sense nucleic acid.

[0097] As used in this article, "antisense" nucleic acid is a nucleic acid sequence that is complementary to "sense" nucleic acid. For example, antisense nucleic acid can be complementary to mRNA encoding transgenes.

[0098] As used in this article, the “guide region” of a miRNA is the strand of the miRNA that binds to the target mRNA, typically based on complementarity binding. The complementarity region may encompass all or part of the guide region. Typically, the complementarity region includes at least the seed region. In many cases, the antisense region of the miRNA is the guide region.

[0099] As used herein, the “lazy region” or “non-directing region” of a miRNA, which can be used interchangeably here, is a region of the miRNA that is complementary to the directing region. In many cases, the sense region of a miRNA is the lazy region.

[0100] As used in this article, the "seed region" of a miRNA is a region of approximately 1–8 nucleotides in length within the miRNA. In some instances, the seed region and its 3'-UTR of the target mRNA may be key determinants in miRNA recognition.

[0101] As used in this article, “off-target gene silencing” refers to the pairing of the seed region of a miRNA with a sequence in the 3'-UTR of an unintended mRNA, and the resulting translational repression and destabilization of those transcripts (e.g., reducing the expression of the unintended mRNA).

[0102] When this document refers to a value or parameter “about”, it includes (and describes) embodiments relating to that value or parameter itself. For example, a description of “about X” includes a description of “X”.

[0103] As used herein, unless otherwise indicated, the singular articles “a”, “an”, and “the” include plural indicators.

[0104] It should be understood that the aspects and embodiments described herein include “comprising aspects and embodiments,” “consisting of aspects and embodiments,” and / or “substantially consisting of aspects and embodiments.” III. Artificial miRNA molecules

[0105] In some aspects, this disclosure provides artificial miRNA molecules comprising the sequences disclosed herein. miRNAs are known in the art as RNA molecules that induce RNA interference in cells, comprising a short (e.g., 19-25 base pairs) sequence of a double-stranded RNA linked by a loop and one or more additional sequences containing one or more bumps (e.g., mispaired or unpaired base pairs) of the double-stranded RNA. In some embodiments, “miRNA” may refer to a primary miRNA (pri-miRNA) or a precursor miRNA. During miRNA processing, a primary miRNA transcript is produced. A precursor miRNA is produced by processing the primary miRNA with Drosha-DGCR8, which is done by removing one or more sequences to leave the precursor miRNA having a 5' flanking region, a guiding strand, a loop region, an unguided strand, and a 3' flanking region; or a 5' flanking region, an unguided strand, a loop region, a guiding strand, and a 3' flanking region. The precursor miRNA is then exported to the cytoplasm and processed by Dicer to produce a miRNA having a guiding strand and an unguided (or lagging) strand. The RISC complex then uses a guide strand to catalyze gene silencing, for example by recognizing a target RNA sequence complementary to the guide strand. miRNA recognition of target sequences is primarily determined by the pairing between the target and the miRNA seed sequence (e.g., nucleotides 1–8 (5' to 3') of the guide strand) (see, for example, Boudreau, RL et al. (2013) Nucleic Acids Res. [Nucleic Acid Research] 41:e9).

[0106] In the primary / precursor miRNA structure, the guide strand:non-guide strand interface in the duplex is partially formed by complementary base pairing (e.g., Watson-Crick base pairing). However, in some embodiments, this complementary base pairing does not extend throughout the entire duplex. In some embodiments, a protrusion in this interface may be present at one or more nucleotide sites. As used herein, the term "protrusion" may refer to a region in the nucleic acid that is not complementary to its opposite nucleic acid in the duplex. In some embodiments, a protrusion is formed when regions of complementary nucleic acids bind to each other, while regions of the central non-complementary region do not bind. In some embodiments, a protrusion is formed when the two nucleic acid strands located between two complementary regions have different lengths. As described below, a protrusion may comprise one or more nucleotides. In some embodiments, the miRNA includes an internal protrusion created by deleting two bases (bases 9-10, counted from the start of the lagging strand) from the lagging strand of the miRNA.

[0107] In certain aspects, the artificial miRNA molecules described in this disclosure are inhibitory to tau mRNA. In some embodiments, the tau mRNA is human tau mRNA. In some embodiments, the artificial mRNA targets the coding sequence of the tau mRNA. In some embodiments, the artificial miRNA targets the 3'-UTR region of the mRNA encoding tau. In some embodiments, the artificial miRNA inhibits tau expression in a subject. In some embodiments, the artificial miRNA inhibits the accumulation of tau protein in a subject. In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.

[0108] The safety of miRNA-based therapies can be hampered by the ability of miRNAs to bind to and reduce the expression of unintended mRNAs (an effect known as off-target gene silencing). Off-target effects primarily occur when the seed region (nucleotides 2–8 of the small miRNA) pairs with sequences in the 3'-UTR of the unintended mRNA, leading to translational repression and destabilization of those transcripts. Reduced off-target miRNAs can be engineered by substituting bases within both the guiding and unguided sequences; for example, by generating CpG motifs. Potential substitutions that could produce significantly lower off-target scores can be evaluated using the SiSPOTR algorithm, a specificity-focused design algorithm that identifies candidate sequences with the lowest off-target potential and effective silencing ability (Boudreau et al., Nucleic Acids Res. 2013 Jan; 41(1) e9). Reduced SiSPOTR scores predict a lower number of potential human off-target sequences compared to the parental miRNA molecule. In some embodiments disclosed herein, miRNAs are modified to reduce off-target gene silencing. In some embodiments, the miRNA contains one or more CpG motifs. In some embodiments, the miRNA contains one or more CpG motifs in a seed region.

[0109] In some embodiments, the first and second strands are joined by an RNA capable of forming a loop structure (e.g., an RNA adapter). As is generally known in the art, RNA loop structures (e.g., stem-loops or hairpins) are formed when an RNA molecule contains two RNA sequences whose bases are paired together and separated by an RNA sequence whose bases are not paired together. For example, a loop structure can be formed in RNA molecule ABC if sequences A and C are complementary or partially complementary such that their bases are paired together, but the bases in sequence B are not paired together. In some embodiments, the loop sequence is 5'-GTTTTGGCCACTGACTGAC-3' (SEQ ID NO: 45) in DNA form or 5'-GUUUUGGCCACUGACUGAC-3' (SEQ ID NO: 46) in RNA form.

[0110] In some embodiments, the RNA capable of forming a loop structure comprises 4 to 50 nucleotides. In some embodiments, the RNA capable of forming a loop structure comprises 13 nucleotides. In some embodiments, the number of nucleotides in the RNA capable of forming a loop is 4 to 50 nucleotides or any integer between them. In some embodiments, 0-50% of the loop may be complementary to another portion of the loop. As used herein, the term "loop structure" is a sequence that connects two complementary strands of a nucleic acid. In some embodiments, 1-3 nucleotides of the loop structure are adjacent to the complementary strand of the nucleic acid and may be complementary to 1-3 nucleotides of the distal portion of the loop structure. For example, the three nucleotides at the 5' end of the loop structure may be complementary to the three nucleotides at the 3' end of the loop structure.

[0111] In some embodiments, the nucleic acid encoding the miRNA disclosed herein comprises a heterologous miRNA scaffold. In some embodiments, the use of the heterologous miRNA scaffold is for regulating miRNA expression; for example, increasing or decreasing miRNA expression. Any miRNA scaffold known in the art can be used. In some embodiments, the miRNA scaffold is derived from the miR-155 scaffold (see, for example, Lagos-Quintana, M. et al. (2002) Curr. Biol. [Current Biology] 12:735-9; and Invitrogen™ BLOCK-iT™ Pol II miR RNA interference expression vector kit, from Life Technologies, Thermo Fisher Scientific, Waltham, MA).

[0112] In some embodiments, the miRNA is selected from Table 1.

[0113] In some embodiments, the first strand comprises a nucleic acid sequence having more than one of about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with any guide sequence. In some embodiments, the first strand comprises a nucleic acid sequence having more than one of about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with any guide sequence, but maintaining the CpG motif. In some embodiments, the second strand comprises a nucleic acid sequence having more than one of about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the corresponding follower sequence. In some embodiments, the second strand comprises a nucleic acid sequence having more than one of about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the corresponding follower sequence, but maintaining the CpG motif. Table 1 IV. miRNA Expression Constructs and Vectors

[0114] This disclosure provides expression constructs, vectors, and viral particles for expressing the miRNA molecules described herein.

[0115] In some embodiments, the nucleic acid encoding the artificial miRNA disclosed herein comprises a heterologous miRNA scaffold. In some embodiments, the use of the heterologous miRNA scaffold is for regulating miRNA expression; for example, increasing or decreasing miRNA expression. Any miRNA scaffold known in the art can be used. In some embodiments, the miRNA scaffold is derived from the miR-155 scaffold (see, for example, Lagos-Quintana, M. et al. (2002) Curr. Biol. [Current Biology] 12:735-9; and Invitrogen™ BLOCK-iT™ Pol II miR RNA interference expression vector kit, from Life Technologies, Thermo Fisher Scientific, Waltham, MA). In some embodiments, the nucleic acid encoding the miRNA disclosed herein comprises a miRNA scaffold. In some embodiments, the miRNA scaffold comprises the sequence ctggaggcttgctgaaggctgtatgctgcaggacacaaggcctgttactagcactcacatggaacaaatggc (SEQ ID NO: 47), wherein the miRNA is inserted between bolded gc residues.

[0116] In some embodiments, the miRNA in the scaffold contains a sequence ctggaggcttgctgaaggctgtatgctg tacgatctaatatcgctcgttttggccactgac tgacgagcgatatgatcgtacga caggacacaaggcctgttactagcactcacatggaacaaatggc (SEQ ID NO: 48), where underlined plain text represents 5'-flank, italic text represents the guiding sequence, bold text represents the loop, underlined italic text represents the non-guiding sequence, and plain text represents 3'-flank.

[0117] In some embodiments, the miRNA targets RNA encoding a polypeptide associated with tau proteinopathy. In some embodiments, the polypeptide is tau.

[0118] In some embodiments, the transgene (e.g., the miRNA disclosed herein) is operatively linked to a promoter. Exemplary promoters include, but are not limited to, the cytomegalovirus (CMV) immediate early promoter, RSV LTR, MoMLV LTR, phosphoglycerate kinase-1 (PGK) promoter, simian virus 40 (SV40) promoter and CK6 promoter, thyroxine transporter promoter (TTR), TK promoter, tetracycline-responsive promoter (TRE), HBV promoter, hAAT promoter, LSP promoter, chimeric liver-specific promoter (LSP), E2F promoter, telomerase (hTERT) promoter; cytomegalovirus enhancer / chicken β-actin / rabbit β-globin promoter (CAG promoter; Niwa et al., Gene [Gene], 1991, 108(2):193-9) and elongation factor 1-α promoter (EFl-α) promoter (Kim et al., Gene [Gene], 1990, 91(2):217-23 and Guo et al., Gene Ther. [Gene Therapy], 1996, 3(9):802-10). In some embodiments, the promoter comprises a human β-glucuronidase promoter or a cytomegalovirus enhancer linked to a chicken β-actin (CBA) promoter. The promoter may be a constitutive promoter, an inducible promoter, or a repressive promoter. In some embodiments, this disclosure provides a recombinant vector comprising a nucleic acid encoding a heterologous transgene of the present disclosure operatively linked to a CBA promoter. Exemplary promoters and descriptions can be found, for example, in U.S. Pre-Publication Publication 20140335054. In some embodiments, the promoter is a CBA promoter, a minimal CBA promoter, a CMV promoter, or a GUSB promoter. In some embodiments, the promoter is an hEF1a promoter.

[0119] Examples of constitutive promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with an RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with a CMV enhancer) [see, for example, Boshart et al., Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the 13-actin promoter, the glycerol phosphokinase (PGK) promoter, and the EFi promoter [Invitrogen].

[0120] Inducible promoters allow for the regulation of gene expression and can be modulated by the presence of exogenously supplied compounds, environmental factors (such as temperature), or specific physiological states, such as the acute phase, a specific differentiation state of the cell, or only in replicating cells. Inducible promoters and inducible systems are available from a variety of commercial sources, including but not limited to Ingenium, Clontech, and Ariad. Many other systems have been described and can be readily selected by those skilled in the art. Examples of inducible promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline repressor system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline inducible system (Gossen et al., Science, 268:1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol. [Current Views in Chemical Biology]), 2:512-518 (1998)), the RU486 inducible promoter system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)), and the rapamycin inducible promoter system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Other types of inducible promoters available in this context are promoters regulated by specific physiological states, such as temperature, acute phase, specific differentiation state of the cell, or only in replicating cells.

[0121] In another embodiment, a natural promoter or fragment thereof for transgene expression will be used. A natural promoter may be preferred when it is desired that transgene expression mimics natural expression. A natural promoter can be used when transgene expression must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to a specific transcriptional stimuli. In another embodiment, other natural expression control elements (such as enhancer elements, polyadenylation sites, or Kozak concordant sequences) may also be used to mimic natural expression.

[0122] In some embodiments, regulatory sequences confer tissue-specific gene expression capabilities. In some cases, tissue-specific regulatory sequences bind to tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to, the following tissue-specific promoters: neuron promoters, such as neuron-specific enolase (NSE) promoters (Andersen et al., Cell. Mol. Neurobiol, 13:503-15 (1993)), neurofilament light chain gene promoters (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and neuron-specific vgf gene promoters (Piccioli et al., Neuron, 15:373-84 (1995)). In some embodiments, the tissue-specific promoter is a promoter selected from the following genes: neuronal nucleus (NeuN), glial fibrillary acidic protein (GFAP), adenomatous colonic polyp (APC), and ionized calcium-binding adaptor molecule 1 (Iba-1). Other suitable tissue-specific promoters will be apparent to those skilled in the art. In some embodiments, the promoter is the chicken β-actin promoter.

[0123] In some embodiments, the promoter expresses a heterologous nucleic acid in cells of the CNS. Therefore, in some embodiments, the therapeutic peptides or therapeutic nucleic acids disclosed herein can be used to treat tau proteinosis. In some embodiments, the promoter expresses a heterologous nucleic acid in brain cells. Brain cells can refer to any brain cells known in the art, including but not limited to neurons (such as sensory neurons, motor neurons, interneurons, dopaminergic neurons, medium-sized spinous neurons, cholinergic neurons, GABAergic neurons, pyramidal neurons, etc.), glial cells (such as microglia, macroglia, astrocytes, oligodendrocytes, ependymal cells, radial glial cells, etc.), brain parenchymal cells, microglia, ependymal cells, and / or Purkinje cells. In some embodiments, the promoter expresses a heterologous nucleic acid in neurons and / or glial cells. In some embodiments, neurons are medium-sized spinous neurons of the caudate nucleus, medium-sized spinous neurons of the putamen, neurons of cortical layer IV, and / or neurons of cortical layer V.

[0124] Various promoters for expressing transcripts (e.g., heterologous transgenes) in CNS cells, brain cells, neurons, and glial cells are known in the art and described herein. Such promoters may contain either a control sequence typically associated with the selected gene or a heterologous control sequence. Typically, useful heterologous control sequences include those derived from sequences encoding mammalian or viral genes. Examples include, but are not limited to, the SV40 early promoter, the mouse mammary tumor virus LTR promoter, the adenovirus major late promoter (Ad MLP), the herpes simplex virus (HSV) promoter, cytomegalovirus (CMV) promoters (such as the CMV immediate early promoter region (CMVIE)), Rous sarcoma virus (RSV) promoters, synthetic promoters, heterozygous promoters, etc. Alternatively, sequences derived from non-viral genes (such as the mouse metallothionein gene) may also be used. Such promoter sequences are commercially available, for example, from Stratagene (San Diego, California). CNS-specific promoters and inducible promoters may be used. Examples of CNS-specific promoters include, but are not limited to, those isolated from CNS-specific genes such as myelin basic protein (MBP), glial fibrillary acidic protein (GFAP), and neuron-specific enolase (NSE). Examples of inducible promoters include, in particular, ecdysone, tetracycline, metallothionein, and hypoxia-responsive DNA elements.

[0125] This disclosure contemplates the use of recombinant viral genomes to introduce or package one or more nucleic acid sequences encoding artificial miRNAs as described herein into AAV viral particles. The recombinant viral genome may include any elements used to establish miRNA expression, such as promoters, heteronucleotides, ITRs, ribosome-binding elements, terminators, enhancers, selection markers, introns, polyA signals, and / or origins of replication. In some embodiments, the rAAV vector comprises one or more of enhancers, splice donor / acceptor pairs, matrix attachment sites, or polyadenylation signals.

[0126] In some embodiments, an effective amount of rAAV particles containing a vector encoding an artificial miRNA is applied at or near the application site (e.g., the striatum and / or cortex) or further away from the application site to transduce cells (e.g., CNS cells, brain cells, neurons, and / or glial cells). In some embodiments, more than one of about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 100% of neurons are transduced. In some embodiments, about 5% to about 100%, about 10% to about 50%, about 10% to about 30%, about 25% to about 75%, about 25% to about 50%, or about 30% to about 50% of neurons are transduced. Methods for identifying neurons transduced by recombinant viral particles expressing miRNA are known in the art; for example, expression can be detected using immunohistochemistry, RNA detection (e.g., qPCR, RNA blotting, RNA-seq, in situ hybridization, etc.) or the use of co-expressed markers (such as enhanced green fluorescent protein).

[0127] In some respects, this disclosure provides viral particles containing a recombinant self-complementary genome (e.g., a self-complementary rAAV vector). AAV viral particles having a self-complementary vector genome and methods using a self-complementary AAV genome are described in the following literature: U.S. Patent Nos. 6,596,535; 7,125,717; 7,465,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z. et al., (2003) Gene Ther [Gene Therapy] 10:2105-2111, each incorporated herein by reference in its entirety. rAAV containing a self-complementary genome will rapidly form a double-stranded DNA molecule using its partially complementary sequences (e.g., complementary coding and non-coding strands of a heterologous nucleic acid). In some embodiments, the vector comprises a first nucleic acid sequence encoding a heterologous nucleic acid and a second nucleic acid sequence encoding a complement of that nucleic acid, wherein the first nucleic acid sequence may form intra-strand base pairs with the second nucleic acid sequence along most or all of its length.

[0128] In some embodiments, a first heteronucleotide sequence encoding a miRNA and a second heteronucleotide sequence encoding a complement of that miRNA are linked by a mutated ITR (e.g., a right-hand ITR). In some embodiments, the ITR comprises the polynucleotide sequence 5'-CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCC GGGCGACCAAAGGTCGCCCACGCCCGGGCTTTGCCCGGGCG - 3' (SEQ ID NO: 49). The mutated ITR contains a deletion of the D region containing the terminal dissociation sequence. Therefore, during the replication of the AAV viral genome, the rep protein will not cleave the viral genome at the mutated ITR, and thus, a recombinant viral genome comprising the following in 5' to 3' order will be packaged in the viral capsid: AAV ITR, a first heteronucleotide sequence containing the regulatory sequence, the mutated AAV ITR, a second heteronucleotide sequence oriented opposite to the first heteronucleotide, and a third AAV ITR. V. Viral particles and methods of generating viral particles

[0129] This disclosure provides, in particular, recombinant viral particles comprising nucleic acids encoding the artificial miRNA disclosed herein, and methods for using them to treat diseases or disorders in mammals (e.g., tau proteinosis). Virus particles

[0130] This disclosure provides viral particles comprising miRNA molecules as disclosed herein. In some embodiments, this disclosure provides viral particles for delivering miRNA molecules as disclosed herein. For example, this disclosure provides a method for delivering miRNA using recombinant viral particles to treat diseases or disorders in mammals; for example, rAAV particles containing miRNA to treat tau proteinosis. In some embodiments, the recombinant viral particle is a recombinant AAV particle. In some embodiments, the viral particle is a recombinant AAV particle containing nucleic acid comprising a sequence of an artificial miRNA of this disclosure flanked by one or two ITRs. The nucleic acid is capsidated in the AAV particle. The AAV particle also contains a capsid protein. In some embodiments, the nucleic acid comprises one or more target coding sequences (e.g., nucleic acid of the miRNA of this disclosure) and control sequences (including transcription start and stop sequences) operably linked in the transcriptional direction, thereby forming an expression construct. The expression construct is flanked by at least one functional AAV ITR sequence at the 5' and 3' ends. A “functional AAV ITR sequence” means an ITR sequence that functions as intended for the rescue, replication, and packaging of AAV virions. See Davidson et al., PNAS, 2000, 97(7):3428-32; Passini et al., J. Virol, 2003, 77(12):7034-40; and Pechan et al., Gene Ther, 2009, 16:10-16, all of which are incorporated herein by reference in their full text. In order to practice some aspects of this disclosure, the recombinant vector contains at least all the AAV sequences necessary for capsidation and the physical structure for rAAV infection. The AAV ITR used in the vectors of this disclosure does not need to have a wild-type nucleotide sequence (e.g., as described in Kotin, Hum. Gene Ther., 1994, 5:793-801) and can be altered by nucleotide insertion, deletion, or substitution, or the AAV ITR may be derived from any of several AAV serotypes. More than 40 AAV serotypes are currently known, and new serotypes and variants of existing serotypes continue to be identified. See Gao et al., PNAS, 2002, 99(18): 11854-6; Gao et al., PNAS, 2003, 100(10): 6081-6; and Bossis et al., J. Virol, 2003, 77(12): 6799-810. Any use of AAV serotypes is considered to be within the scope of this disclosure.In some embodiments, the rAAV vector is a vector derived from an AAV serotype, including but not limited to AAV ITRs such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV capsid serotypes. In some embodiments, the nucleic acid in the AAV contains the following ITRs: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV capsid serotypes. In some embodiments, the nucleic acid in the AAV further encodes a miRNA as described herein. In some embodiments, the rAAV particle comprises an AAV1, an AAV2HBKO capsid (e.g., as described in WO 2015168666), an AAV9 capsid, a PHP.B capsid, a PHP.eB capsid, or an Olig001 capsid.

[0131] For example, the nucleic acid in an AAV may contain at least one ITR of any AAV serotype considered herein, and may further encode a miRNA comprising a first strand and a second strand, wherein a) the first and second strands form a double helix; b) the first strand contains a guiding region; and c) the second strand contains a non-guiding region, wherein the non-guiding region contains a two-nucleotide deletion at bases 9 and 10 to create a protrusion in the guiding strand. In some embodiments, the vector may include a filler nucleic acid. In some embodiments, the filler nucleic acid may encode a green fluorescent protein. In some embodiments, the filler nucleic acid may be located between the promoter and the nucleic acid encoding the miRNA. In some embodiments, the filler nucleic acid is an A1AT filler nucleic acid.

[0132] Different AAV serotypes are used to optimize the transduction of specific target cells or to target specific cell types within specific target tissues (e.g., diseased tissues). rAAV particles may contain viral proteins and viral nucleic acids of the same or mixed serotypes. For example, in some embodiments, rAAV particles may contain an AAV1 capsid protein and at least one AAV2 ITR, or they may contain an AAV2 capsid protein and at least one AAV1 ITR. Any combination of AAV serotypes for generating rAAV particles is provided herein, as each combination is explicitly stated herein. In some embodiments, this disclosure provides rAAV particles containing an AAV1 capsid and a rAAV vector of this disclosure flanked by at least one AAV2 ITR (e.g., an expression construct containing nucleic acid encoding a miRNA of this disclosure). In some embodiments, this disclosure provides rAAV particles containing an AAV2 capsid. In some embodiments, the rAAV particle comprises an AAV1, an AAV2HBKO caption (e.g., as described in WO 2015168666), an AAV9 caption, a PHP.B caption, a PHP.eB caption, or an Olig001 caption.

[0133] In some respects, this disclosure provides viral particles containing recombinant self-complementary genomes. AAV viral particles with self-complementary genomes and methods for using self-complementary AAV genomes are described in the following literature: U.S. Patent Nos. 6,596,535; 7,125,717; 7,465,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z. et al., (2003) Gene Ther [Gene Therapy] 10:2105-2111, each incorporated herein by reference in its entirety. rAAV containing self-complementary genomes will rapidly form double-stranded DNA molecules using its partially complementary sequences (e.g., complementary coding and non-coding strands of the transgene). In some embodiments, this disclosure provides an AAV viral particle comprising an AAV genome, wherein the rAAV genome comprises a first heteropolynucleotide sequence (e.g., the miRNA disclosed herein) and a second heteropolynucleotide sequence (e.g., the antisense strand of the miRNA disclosed herein), wherein the first heteropolynucleotide sequence may form intrastrand base pairs with the second polynucleotide sequence along most or all of its length. In some embodiments, the first and second heteropolynucleotide sequences are linked by a sequence that promotes intrastrand base pairing (e.g., a hairpin DNA structure). Hairpin structures are known in the art, for example, in miRNA or siRNA molecules. In some embodiments, the first and second heteropolynucleotide sequences are linked by a mutated ITR (e.g., a right-hand ITR). In some embodiments, the ITR comprises the polynucleotide sequence 5'-ttggccactccctctctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct–3' (SEQ ID NO: 50). The mutated ITR contains a deletion of the D region containing the terminal dissociation sequence. Therefore, during the replication of the AAV viral genome, the rep protein will not cleave the viral genome at the mutated ITR, and thus, the recombinant viral genome comprising the following in 5' to 3' order will be packaged in the viral capsid: AAVITR, a first heteropolynucleotide sequence containing the regulatory sequence, the mutated AAV ITR, a second heteropolynucleotide in the opposite orientation to the first heteropolynucleotide, and a third AAV ITR.In some embodiments, this disclosure provides an AAV viral particle comprising a recombinant viral genome comprising: a functional AAV2 ITR, a first polynucleotide sequence encoding the miRNA disclosed herein, a mutated AAV2 ITR comprising a deletion of the D region and lacking a functional terminal dissociation sequence, a second polynucleotide sequence comprising a complementary sequence of the first polynucleotide sequence encoding the miRNA disclosed herein, and the functional AAV2 ITR. Production of viral particles

[0134] rAAV particles can be generated using methods known in the art. See, for example, U.S. Patent Nos. 6,566,118; 6,989,264; and 6,995,006. In practicing this disclosure, host cells used for generating rAAV particles include mammalian cells, insect cells, plant cells, microorganisms, and yeast. The host cell can also be a packaging cell in which the AAV rep and cap genes are stably maintained; or a production cell in which the AAV vector genome is stably maintained. Exemplary packaging and production cells are derived from 293 cells, A549 cells, or HeLa cells. The AAV vector is purified and formulated using standard techniques known in the art.

[0135] Methods known in the art for producing rAAV vectors include, but are not limited to, transfection, stable cell line production, and infectious hybrid virus production systems, including adenovirus-AAV hybrids, herpesvirus-AAV hybrids (Conway, JE et al., (1997) J. Virology 71(11):8780-8789), and baculovirus-AAV hybrids. rAAV production cultures for producing rAAV viral particles require the following: 1) suitable host cells, including, in the case of baculovirus production systems, human cell lines such as HeLa, A549, or 293 cells, or insect cell lines such as SF-9; 2) suitable helper viral functions, provided by wild-type or mutant adenoviruses (e.g., temperature-sensitive adenoviruses), herpesviruses, baculoviruses, or plasmid constructs providing helper functions; 3) AAV rep and cap genes and gene products; 4) nucleic acids flanking at least one AAV ITR sequence (e.g., therapeutic nucleic acids); and 5) suitable culture media and culture medium components supporting rAAV production. In some embodiments, the AAV rep and cap gene products can be derived from any AAV serotype. Generally, but not necessarily, the AAV rep gene product has the same serotype as the ITR of the rAAV vector genome, provided that the rep gene product can function to replicate and package the rAAV genome. Suitable culture media known in the art can be used to generate rAAV vectors. These media include, but are not limited to, media produced by Hyclone Laboratories and JRH, including modified Eagle Medium (MEM), Durbeco Modified Eagle Medium (DMEM); custom formulations, such as those described in U.S. Patent No. 6,566,118; and Sf-900 II SFM medium as described in U.S. Patent No. 6,723,551, each of which is incorporated herein by reference in its entirety, particularly relating to custom culture medium formulations used in the generation of recombinant AAV vectors. In some embodiments, the AAV helper function is provided by adenovirus or HSV. In some embodiments, the AAV helper function is provided by baculovirus, and the host cell is an insect cell (e.g., Spodoptera frugiperda (Sf9) cells).

[0136] In some embodiments, rAAV particles can be generated via a triple transfection method, such as the exemplary triple transfection method provided below. In short, a plasmid containing the rep gene and capsid gene can be transfected (e.g., using the calcium phosphate method) together with a helper adenovirus plasmid into a cell line (e.g., HEK-293 cells), and the virus can be collected and optionally purified. Therefore, in some embodiments, rAAV particles are generated by triple transfecting a host cell with nucleic acid encoding the rAAV vector, nucleic acid encoding AAV rep and cap, and nucleic acid encoding AAV helper virus function, wherein transfecting the nucleic acid into the host cell produces host cells capable of producing rAAV particles.

[0137] In some embodiments, rAAV particles can be produced by a production cell line method, such as the exemplary production cell line method provided below (see also references in Martin et al., (2013) Human Gene Therapy Methods 24:253-269). Briefly, a cell line (e.g., HeLa cell line) can be stably transfected with a plasmid containing the rep gene, capsid gene, and promoter heterologous nucleic acid sequence. Cell lines can be screened to select a lead clone for rAAV production, which can then be amplified in a production bioreactor and infected with an adenovirus (e.g., wild-type adenovirus) as an assistant to initiate rAAV production. The virus can then be harvested, the adenovirus can be inactivated (e.g., by heating) and / or removed, and the rAAV particles can be purified. Thus, in some embodiments, rAAV particles are produced by a production cell line comprising one or more of the following: nucleic acids encoding an rAAV vector, nucleic acids encoding AAV rep and cap, and nucleic acids encoding AAV helper virus functions.

[0138] In some aspects, methods for generating any rAAV particles as disclosed herein are provided, the method comprising (a) culturing a host cell under conditions for generating rAAV particles, wherein the host cell contains (i) one or more AAV packaging genes, wherein each of the AAV packaging genes encodes an AAV replication and / or capsidation protein; (ii) an rAAV protovector containing a nucleic acid encoding a miRNA as disclosed herein, flanked by at least one AAV ITR; and (iii) an AAV helper function; and (b) recovering the rAAV particles generated by the host cell. In some embodiments, the at least one AAV ITR is selected from the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV capsid serum ITR, etc. In some embodiments, the capsidated protein is selected from the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 (e.g., wild-type AAV6 capsid or variant AAV6 capsid such as ShH10, as described in U.S. Pre-Publication Publication 2012 / 0164106), AAV7, AAV8, AAVrh8, AAVrh8R, AAV9 (e.g., wild-type AAV9 capsid, or modified AAV9 capsid as described in U.S. Pre-Publication Publication 2013 / 0323226), AAV10, AAVrh10, AAV11, AAV12, tyrosine capsid mutants, heparin-binding capsid mutants, AAV2R471A capsid, AAVAAV2 / 2-7m8 capsid, AAV... DJ costumes (e.g., AAV-DJ / 8 costume, AAV-DJ / 9 costume, or any other costume described in U.S. Pre-Grant Publication 2012 / 0066783), AAV2 N587A costume, AAV2 E548A costume, AAV2 N708A costume, AAV V708K costume, goat AAV costume, AAV1 / AAV2 chimeric costume, bovine AAV costume, mouse AAV costume, rAAV2 / HBoV1 costume, or AAV costumes as described in U.S. Patent No. 8,283,151 or International Publication No. WO / 2003 / 042397. In some embodiments, the AAV costume is the AAV2HBKO costume as described in WO 2015168666. In some embodiments, the AAV costume is the AAV9 costume. In some embodiments, the AAV costume is the PHP.B, PHP.eB, or Olig001 costume. In some embodiments, the mutant capsid protein retains the ability to form an AAV capsid.In some embodiments, the capsid protein is an AAV5 tyrosine mutant capsid protein. In another embodiment, the rAAV particle comprises a capsid protein from an AAV serotype derived from clade AF. In some embodiments, the rAAV particle comprises an AAV1 capsid and a recombinant genome containing an AAV2 ITR and nucleic acid encoding the miRNA disclosed herein. In yet another embodiment, the rAAV particle is purified. As used herein, the term "purified" includes a formulation of rAAV particles free from at least some other components that may also be present in the rAAV particle naturally present or where it was originally prepared. Thus, for example, purification techniques can be used to prepare isolated rAAV particles, enriching them from source mixtures such as culture lysates or production culture supernatants. Enrichment can be measured in a variety of ways, such as by the proportion of DNase-resistant particles (DRP) or genome copies (gc) present in solution or by infectivity, or it can be measured relative to a second potential interfering substance present in the source mixture, such as contaminants, including production culture contaminants or process contaminants, including helper viruses, culture medium components, etc.

[0139] Many methods for generating adenovirus vector particles are known in the art. For example, for internally disrupted adenovirus vectors, the adenovirus vector genome and the helper adenovirus genome can be transfected into a packaging cell line (e.g., the 293 cell line). In some embodiments, the helper adenovirus genome may contain recombination sites flanking its packaging signal, and both genomes can be transfected into a packaging cell line expressing recombinases (e.g., using the Cre / loxP system), such that the target adenovirus vector is packaged more efficiently than the helper adenovirus (see, for example, Alba, R. et al. (2005) Gene Ther. 12 Supplement 1:S18-27). Adenovirus vectors can be harvested and purified using standard methods, such as those described herein.

[0140] Many methods for generating lentiviral vector particles are known in the art. For example, for third-generation lentiviral vectors, a vector containing the target lentiviral genome with the gag and pol genes can be co-transfected with a vector containing the rev gene into a packaging cell line (e.g., the 293 cell line). The target lentiviral genome also contains a chimeric LTR that promotes transcription in the absence of Tat (see Dull, T. et al. (1998) J. Virol. [Journal of Virology] 72:8463-71). Lentiviral vectors can be harvested and purified using the methods described herein (e.g., Segura MM et al., (2013) Expert Opinion on Biology Ther. [Expert Opinion on Biology] 13(7):987-1011).

[0141] Many methods for generating HSV particles are known in the art. HSV vectors can be harvested and purified using standard methods, such as those described herein. For example, for replication-defective HSV vectors, the target HSV genome lacking all immediate early (IE) genes can be transfected into complementary cell lines that provide genes required for virus production, such as ICP4, ICP27, and ICP0 (see, for example, Samaniego, LA et al. (1998) J. Virol. [Journal of Virology] 72:3307-20). HSV vectors can be harvested and purified using methods described (e.g., Goins, WF et al., (2014) Herpes Simplex Virus Methods in Molecular Biology [Herpes Simplex Virus Methods in Molecular Biology] 1144:63-79).

[0142] This document also provides pharmaceutical compositions comprising recombinant viral particles and a pharmaceutically acceptable carrier, the recombinant viral particles containing a transgene encoding the miRNA disclosed herein. These pharmaceutical compositions are suitable for any of the administration methods described herein. Pharmaceutical compositions comprising recombinant viral particles encoding a nucleic acid encoding the miRNA disclosed herein can be introduced into the brain. For example, recombinant viral particles containing a nucleic acid encoding the miRNA disclosed herein can be administered intrastriatally. Any recombinant viral particles disclosed herein, including rAAV, adenovirus, lentivirus, and HSV particles, can be used.

[0143] In some embodiments, a pharmaceutical composition comprising recombinant viral particles and a pharmaceutically acceptable carrier is suitable for administration to humans, wherein the recombinant viral particles comprise a transgene encoding the miRNA disclosed herein. Such carriers are well known in the art (see, for example, Remington's Pharmaceutical Sciences, 15th edition, pp. 1035-1038 and 1570-1580). In some embodiments, a pharmaceutical composition comprising rAAV as described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, a pharmaceutical composition comprising recombinant lentiviral particles as described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, a pharmaceutical composition comprising recombinant adenovirus particles as described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, a pharmaceutical composition comprising recombinant HSV particles as described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration).

[0144] Pharmaceutically acceptable carriers of this type can be sterile liquids, such as water and oils, including those of petroleum, animal, plant, or synthetic origin, such as peanut oil, soybean oil, and mineral oil. Saline solutions, as well as aqueous solutions of dextran, polyethylene glycol (PEG), and glycerol, can also be used as liquid carriers, particularly for injectable solutions. Pharmaceutical compositions may further contain additional components such as preservatives, buffers, tonics, antioxidants and stabilizers, nonionic wetting or clarifying agents, thickeners, etc. The pharmaceutical compositions described herein can be packaged in single-unit doses or in multiple-dose formulations. These compositions are typically formulated as sterile and substantially isotonic solutions. VI. Treatment methods

[0145] Certain aspects of this disclosure relate to methods for treating tau protein disorders in individuals in need by reducing tau protein levels. In some embodiments, the invention provides a method for treating tau protein disorders by administering an effective amount of an expression cassette (e.g., an expression cassette delivered in rAAV particles) for expressing the artificial miRNA disclosed herein. Examples of tau protein disorders include, but are not limited to, supranuclear palsy, Alzheimer's disease, corticobasal degeneration, chronic traumatic encephalopathy, Pick's disease, and post-encephalitis Parkinson's syndrome.

[0146] Expression cassettes for expressing artificial miRNAs (e.g., expression cassettes delivered in rAAV particles) can be administered via various routes. In some embodiments, the administration includes direct spinal injection and / or intracerebral administration. In some embodiments, the administration is performed at sites selected from: the brain, medulla oblongata, pons, cerebellum, intracranial cavity, pericerebral meninges, dura mater, arachnoid mater, pia mater, cerebrospinal fluid (CSF) in the pericerebral subarachnoid space, deep cerebellar nuclei, cerebral ventricular system, subarachnoid space, striatum, cortex, septum, thalamus, hypothalamus, and brain parenchyma. In some embodiments, the administration includes intraventricular injection into at least one lateral ventricle. In some embodiments, the administration includes intrathecal injection in the cervical, thoracic, and / or lumbar regions. In some embodiments, the administration includes intrastriatal injection. In some embodiments, the administration includes intrathalamic injection.

[0147] In some embodiments, administration to the central nervous system may include an intraparenchymal route. In some embodiments, an intraparenchymal route may include the thalamus, striatum, or hippocampus. In some embodiments, administration to the central nervous system may include an intracerebrospinal fluid (CSF) route. In some embodiments, an intracerebrospinal fluid (CSF) route may include within the ventricles, cerebellomedullary cistern, or intrathecal. In some embodiments, administration to the central nervous system may include a peripheral route. In some embodiments, a peripheral route may include an intravenous route. In some embodiments, administration to the central nervous system may include an experimental route. In some embodiments, an experimental route may include an intranasal route.

[0148] In some embodiments, the route of administration (ROA) may include an intracerebrospinal fluid (CSF) ROA. In some embodiments, an intracerebrospinal fluid (CSF) ROA may include an intraventricular (ICV), intracerebellomedullary cistern (ICM), or intrathecal (IT) ROA.

[0149] An effective amount of rAAV (in particle form in some embodiments) is administered according to the treatment goal. For example, where a low transduction percentage can achieve the desired therapeutic effect, the treatment goal is typically met or exceeded. In some cases, this transduction level can be achieved by transducing: only about 1% to 5% of target cells of the desired tissue type, at least about 20% of cells of the desired tissue type in some embodiments, at least about 50% in some embodiments, at least about 80% in some embodiments, at least about 95% in some embodiments, and at least about 99% of cells of the desired tissue type in some embodiments. The rAAV composition can be administered by one or more administrations, which may be administered during the same procedure or at intervals of days, weeks, months, or years. One or more of any of the administration routes described herein may be used. In some embodiments, multiple carriers may be used to treat humans.

[0150] In some embodiments of the foregoing aspects, rAAV is administered by direct injection into the spinal cord, intrathecal injection, or intracisional injection. In some embodiments, rAAV is administered to more than one location in the spinal cord or cerebellomedullary cistern. In some embodiments, rAAV is administered to more than one location in the spinal cord. In some embodiments, rAAV is administered to one or more of the lumbar, thoracic, and cervical subarachnoid spaces of the spinal cord. In some embodiments, rAAV is administered to the cerebellomedullary cistern.

[0151] In some embodiments, the present invention provides a method for treating a person suffering from tau proteinosis by administering an effective amount of a pharmaceutical composition comprising a recombinant viral vector encoding an artificial miRNA disclosed herein. In some embodiments, the pharmaceutical composition comprises one or more pharmaceutically acceptable excipients.

[0152] In some embodiments, these methods include administering an effective amount of a pharmaceutical composition to an individual with tau proteinosis, the pharmaceutical composition comprising a recombinant viral vector encoding an artificial miRNA polypeptide disclosed herein. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 12 6 × 10 12 7 × 10 12 8 × 10 12 9 × 10 12 10 × 10 12 11 × 10 12 15 × 10 12 20 × 10 12 25 × 10 12 30 × 10 12 Or 50 × 10 12 Any one of the following: genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is approximately 5 × 10⁻⁶. 12 Up to 6 × 10 12 6 × 10 12 Up to 7 × 10 12 7 × 10 12 Up to 8 × 10 12 8 × 10 12 Up to 9 × 10 12 9 × 10 12 Up to 10 × 10 12 10 × 10 12 Up to 11 × 10 12 11 × 10 12Up to 15 × 10 12 15 × 10 12 Up to 20 × 10 12 20 × 10 12 Up to 25 × 10 12 25 × 10 12 Up to 30 × 10 12 30 × 10 12 Up to 50 × 10 12 Or 50 × 10 12 Up to 100 × 10 12 Any one of the following: genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is approximately 5 × 10⁻⁶. 12 Up to 10 × 10 12 10 × 10 12 Up to 25 × 10 12 Or 25 × 10 12 Up to 50 × 10 12 Any one of the following: genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 9 6 × 10 9 7 × 10 9 8 × 10 9 9 × 10 9 10 × 10 9 11 × 10 9 15 × 10 9 20 × 10 9 25 × 10 9 30 × 10 9 Or 50 × 10 9 Any one of the following: transduction units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is approximately 5 × 10⁻⁶. 9 Up to 6 × 10 9 6 × 10 9 Up to 7 × 10 9 7 × 10 9 Up to 8 × 10 9 8 × 10 9 Up to 9 × 10 9 9 × 10 9 Up to 10 × 10 9 10 × 10 9 Up to 11 × 10 9 11 × 10 9Up to 15 × 10 9 15 × 10 9 Up to 20 × 10 9 20 × 10 9 Up to 25 × 10 9 25 × 10 9 Up to 30 × 10 9 30 × 10 9 Up to 50 × 10 9 Or 50 × 10 9 Up to 100 × 10 9 Any of the following: transduction units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is approximately 5 × 10⁻⁶. 9 Up to 10 × 10 9 10 × 10 9 Up to 15 × 10 9 15 × 10 9 Up to 25 × 10 9 Or 25 × 10 9 Up to 50 × 10 9 Any one of the following: transduction units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 10 6 × 10 10 7 × 10 10 8 × 10 10 9 × 10 10 10 × 10 10 11 × 10 10 15 × 10 10 20 × 10 10 25 × 10 10 30 × 10 10 40 × 10 10 Or 50 × 10 10 Any of the following: infection units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 10 Up to 6 × 10 10 6 × 10 10 Up to 7 × 10 10 7 × 10 10 Up to 8 × 10 10 8 × 10 10 Up to 9 × 10 10 9 × 10 10 Up to 10 × 10 1010 × 10 10 Up to 11 × 10 10 11 × 10 10 Up to 15 × 10 10 15 × 10 10 Up to 20 × 10 10 20 × 10 10 Up to 25 × 10 10 25 × 10 10 Up to 30 × 10 10 30 × 10 10 Up to 40 × 10 10 40 × 10 10 Up to 50 × 10 10 Or 50 × 10 10 Up to 100 × 10 10 Any of the following: infection units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 10 Up to 10 × 10 10 10 × 10 10 Up to 15 × 10 10 15 × 10 10 Up to 25 × 10 10 Or 25 × 10 10 Up to 50 × 10 10 Any of the infection units / mL. In some embodiments, the viral particles are rAAV particles.

[0153] In some embodiments, the dose of viral particles administered to an individual is at least about 1 × 10⁻⁶. 8 From approximately 6 × 10 13 Any one of the following: genome copies / kg body weight. In some embodiments, the dose of viral particles administered to an individual is approximately 1 × 10⁻⁶. 8 From approximately 6 × 10 13 Any one of the following: genome copies / kg body weight. In some embodiments, the dose of viral particles administered to an individual is approximately 1 × 10⁻⁶. 10 2 × 10 10 3 × 10 10 4 × 10 10 5 × 10 10 6 × 10 10 7 × 10 10 8 × 10 10 9 × 10 10 1 × 10 11 2 × 1011 3 × 10 11 4 × 10 11 5 × 10 11 6 × 10 11 7 × 10 11 8 × 10 11 9 × 10 11 1 × 10 12 2 × 10 12 13 × 10 12 4 × 10 12 5 × 10 12 6 × 10 12 7 × 10 12 8 × 10 12 9 × 10 12 Or 1 × 10 13 Any one of the following: genome copies / kg body weight.

[0154] In some embodiments, the total amount of viral particles administered to an individual is at least about 1 × 10⁻⁶. 9 From approximately 1 × 10 14 Any one of the genome copies. In some embodiments, the total amount of viral particles administered to an individual is approximately 1 × 10⁻⁶. 9 From approximately 1 × 10 14 Any one of the genome copies. In some embodiments, the total amount of viral particles administered to an individual is approximately 1 × 10⁻⁶. 11 2 × 10 11 3 × 10 11 4 × 10 11 5 × 10 11 6 × 10 11 7 × 10 11 8 × 10 11 9 × 10 11 1 × 10 12 2 × 10 12 3 × 10 12 4 × 10 12 5 × 10 12 6 × 10 12 7 × 10 12 8 × 10 12 9 × 10 12 1 × 10 13 2 × 10 13 13 × 10 13 4 × 1013 5 × 10 13 6 × 10 13 7 × 10 13 8 × 10 13 9 × 10 13 Or 1 × 10 14 Any one of the genome copies.

[0155] In some embodiments, the persistence of MAPT knockdown can be measured using Tau22 mice. In some embodiments, Tau22 mice can be used to evaluate the effects of tau reduction on aggregate formation and / or related neurodegeneration. In some embodiments, Tau01 and Tau12 can also be administered to non-human primates to confirm tau knockdown and / or evaluate fluid biomarkers of target binding in large animal models.

[0156] In some embodiments, computer-designed tools can be used to identify artificial miRNA (amiRNA) sequences that may contain low off-target potential, cross-species homology, or a combination thereof. In some embodiments, the MAPT knockdown efficiency of sequences can be tested in vitro using U2OS cells, wherein U2OS cells stably express 4R human tau. In some embodiments, tau protein can be quantified by ELISA. In some embodiments, tau protein can be quantified by ELISA three days after transfection. In some embodiments, progenitor candidates can be cloned into an AAV vector to evaluate MAPT knockdown and / or efficacy readouts in a Tau22 mouse model of tau proteinopathy. In some embodiments, mice can be overexpressed with 1N4R human tau having two FTD-related mutations that drive progressive neuronal accumulation of tau aggregates and / or subsequent neurodegeneration. VII. Products and Reagent Kits

[0157] Kits or articles for use in the methods described herein are also provided. In each respect, the kits contain the compositions described herein in suitable packaging (e.g., recombinant viral particles of this disclosure, such as rAAV particles, containing nucleic acids encoding the miRNAs disclosed herein). Suitable packaging for the compositions described herein (such as striatal compositions) is known in the art and includes, for example, vials (e.g., sealed vials), containers, ampoules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), etc. These articles may be further sterilized and / or sealed.

[0158] This disclosure also provides kits comprising the compositions described herein, and may further include one or more instructions regarding methods of using the compositions, as described herein. The kits described herein may further include other materials deemed commercially and user-appropriate, including additional buffers, diluents, filters, needles, syringes, and packaging inserts with instructions for performing any of the methods described herein. For example, in some embodiments, the kit comprises: a composition comprising a recombinant viral particle encoding a transgenic miRNA of the disclosed herein, the composition being used to deliver at least 1 × 10⁻⁶ 1 / 2 ... 9 Delivery of a genome copy to the brain of a mammal such as those described herein (e.g., via striatal administration) to a primate; a pharmaceutically acceptable carrier suitable for injection into the brain of a primate; and one or more of the following: a buffer, a diluent, a filter, a needle, a syringe, and a packaging insert having instructions for performing injection into the brain of a primate (e.g., via striatal administration). In some embodiments, the kit includes instructions for treating neurodegenerative synucleinopathy with the recombinant viral particles described herein. In some embodiments, the kit includes instructions for using the recombinant viral particles described herein according to any of the methods described herein. Example

[0159] This disclosure will be more fully understood by referring to the examples below. However, these examples should not be construed as limiting the scope of this disclosure. It should be understood that the examples and embodiments described herein are for illustrative purposes only, and various modifications or changes made based on these examples and embodiments will be conceived by those skilled in the art and should be included within the spirit and scope of this application and the appended claims. General Method Plasmid, ITR vector and AAV generation

[0160] MAPT or control artificial miRNAs were expressed in vitro as hairpins embedded in mir155 under the control of the human CMV enhancer / EF1α promoter. Sequences were designed to match regions homologous only to human / NHP MAPT. The control artificial miRNA encodes a non-targeted artificial miRNA sequence designed for minimal seed-mediated off-target gene repression. To generate a recombinant AAV serotype vector encoding the artificial miRNA, the artificial miRNA cassette was cloned into a plasmid containing an AAV2 inverted terminal repeat (ITR) under the control of the human cytomegalovirus enhancer / chicken β-actin (CBA) promoter. To generate AAVs, HEK293 cells were transfected with three plasmids (containing ITR, AAV rep / cap, and Ad helper) in a 1:1:1 ratio using PEI (polyethyleneimine). The Ad helper plasmid (pHelper) was obtained from Xstrata Genetics / Agilent Technologies (Santa Clara, CA). AAV was purified by cesium chloride ultracentrifugation, and the virus was titrated against the polyA sequence using qPCR. U2OS cell culture and transfection

[0161] U2OS cells stably expressing human 1N4R tau with G272V and P301S mutations were maintained in DMEM + 10% FCS containing 100 μg / mL hygromycin B (Ingenieur 10687010). Artificial miRNA plasmid DNA was transfected using Lipofectamine 3000 (Lifetechnologies) according to the manufacturer's instructions. Three days later, cells were lysed in 1% Triton X-100 (Sigma) in PBS containing a mixture of protease inhibitors (Roche) for anti-tau ELISA assay. Human tau (HT7 antibody) sandwich ELISA

[0162] Immulon IIHB 96-well plates (Thermo Scientific) were coated overnight at room temperature with 2 μg / mL mouse anti-human tau (HT7 clone, Thermo Scientific MN10008) in PBS. The plates were then washed, blocked in PBS + 0.1% Tween 20 (PBST) + 1.5% BSA, and incubated with cell lysates. The wells were washed in PBST and incubated with rabbit anti-Tau (DAKO A0027) for 1.5 hours, followed by washing in PBST and incubation with HRP-conjugated donkey anti-rabbit (Jackson Immuno 711-035-152). The plates were washed in PBST, developed with TMB substrate (SeraCare), quenched with 0.5 M H2SO4, and tau levels were quantified by absorbance at 450 nm using a Spectramax M5 plate reader (Molecular Devices). Values ​​were normalized relative to control artificial miRNA-treated samples to assess relative tau knockdown. Animal use and care

[0163] All procedures were performed according to protocols approved by Sanofi's Institutional Animal Care and Use Committee (IACUC) and in accordance with the guidelines set forth in the NIH Laboratory Animal Care and Use Guidelines. Adult Thy-Tau22 mice (Schindowski et al., 2006) were grouped and housed separately, except in stereotactic surgery studies where they were housed individually to allow for proper recovery. Mice were kept in a 12-hour light / dark cycle with free access to food and water. Each animal was identified with a unique ear tag. Stereotactic injection using AAV-artificial miRNA vector

[0164] Surgery was performed according to Sanofi's IACUC-approved procedure. Mice were anesthetized with isoflurane exposure and fixed in a stereotactic frame (Stoelting) under continuous isoflurane perfusion. The scalp was shaved and incised along the midline to locate the anterior fontanelle. A small burr hole was drilled above the desired location in the brain. The Hamilton syringe was mounted on the micro-controlled stereotactic frame (Stoelting), and the needle was slowly lowered to the appropriate depth. For striatal injection, 3E10 vector genomes were injected into each of two injection sites at coordinates AP +0.5, DV -3.0, and ML + / -2.2. For hippocampal injection, 7.5E9 vector genomes were injected into each of two injection sites at coordinates AP -2.5, DV -2.0, and ML + / -1.5. During each surgery, the virus was injected at a rate of 0.5 µL / min. The needle was left in place for two minutes to prevent backflow of the vector through the needle diameter before being slowly withdrawn from the brain. Mice were kept warm and observed continuously after surgery until recovery. Four weeks after injection, mice were euthanized by anesthesia with >150 mg / kg sodium pentobarbital. After the overdose, mice were kept warm until cardiac perfusion with ice-cold PBS. Striatal tissue processing and MAPT mRNA quantification: by RT-qPCR

[0165] Following perfusion, the striatum from Tau22 mice was dissected, rapidly frozen in liquid nitrogen, and stored at -80°C. Tissue beads were homogenized for 3 minutes at 4°C in TRIzol reagent (Ingenieur) using TissueLyser II (QIAGEN), followed by aqueous phase separation according to the manufacturer's instructions. RNA was isolated from the aqueous phase using the miRNeasy mini kit (QIAGEN) with on-column DNase treatment using an RNase-free DNase kit (QIAGEN), according to the manufacturer's instructions. RNA concentration and purity were assessed by measuring absorbance at A260 / 280 on a NanoDrop spectrophotometer (Thermo Scientific). mRNA expression was quantified by qPCR on a Quantstudio 6 (Applied Biosystems) using TaqMan Fast Virus 1-Step Premix (Applied Biosystems) and pre-validated TaqMan probes (Applied Biosystems) targeting human MAPT (Hs00902194_m1) and mouse Ppia (Mm 02342430_g1). Samples were run in triplicate on the same plate, with 100 nanograms of RNA input in each well. The relative levels of human MAPT mRNA in MAPT-treated animals were quantified using the 2^ΔΔCt method compared to control miRNA-treated animals, with Ppia expression as a housekeeping control, using VIAA7 software (VIAA7, Applied Biosystems). striatal tissue homogenate after treatment with AAV.SAN006-artificial miRNA

[0166] Following perfusion, the striatum from Tau22 mice was dissected, rapidly frozen in liquid nitrogen, and stored at -80°C. Tissue beads were homogenized for 3 minutes at 30 Hz in 1X Tris-EDTA (TE) buffer (Fisher BP2475500) at 4°C using TissueLyser II (Qiager), aliquoted, and stored at -80°C until further use. Quantification of human MAPT mRNA in the striatum by RT-dPCR

[0167] The TE homogenate was thawed on ice and QIAZOL lysis reagent (Qiagen) was added, followed by phase separation according to the manufacturer's instructions. RNA was isolated from the aqueous phase using the miRNeasy 96 mini kit (Qiagen) on a QIAcube HT. RNA concentration and purity were assessed by measuring absorbance at A260 / 280 on a NanoDrop spectrophotometer (Thermo Scientific). mRNA expression was quantified by reverse transcriptase digital PCR using the QIAcuity One-Step Viral RT-PCR Kit (Qiagen) and probes targeting human MAPT (Hs00902194_m1; Applied Biosystems) and mouse Hprt1 (Mm.PT.58.29815602; IDT). Reactions were performed using the QIAcuity 8 digital PCR system (Qiagen). MAPT mRNA was quantified using the QIAcuity software suite (Qiagen) with Hprt1 expression as a home control, and the expression in animals treated with MAPT artificial miRNA was normalized relative to that in animals treated with control artificial miRNA. Hippocampal tau protein detection: immunofluorescence

[0168] Following perfusion, the brain was removed and bisected along the midline, termed hemispheres. For each mouse, one hemisphere was post-fixed in 10% neutral buffered formalin (NBF) and embedded in paraffin for immunofluorescence. 5 µm thick sagittal sections of brain tissue were cut using a microtome and mounted directly onto slides. The sections were immunostained with the indicated antibody using an automated slide staining system (BOND RX, Leica). Briefly, all steps were performed at room temperature after antigen retrieval for 10 minutes in citrate buffer (ER1, Leica). Sections were blocked with 5% goat serum for 30 minutes, incubated with primary antibody for 1.5 hours, and then incubated with Alexafluor secondary antibody for 1 hour, with three washes between steps. The antibody was diluted in PBST (PBS + 0.5% Tween-20). The slides were mounted in a culture medium containing DAPI (ProLong Gold anti-fade with DAPI, Life Sciences). The following primary antibodies were used: human tau (clone Tau13, Covance) and NeuN (Millipore ABN78).

[0169] Images were acquired at 20x magnification (Plan-Apochromat 20x / 0.8) using a Zeiss AzioZ1 epifluorescence microscope. For demonstration purposes, the images were imported into Adobe Photoshop (2019) for cropping and false coloring to RGB. small RNA sequencing

[0170] As described above, striatal RNA was isolated from Tau22 animals. Small RNA (< 200 bp) libraries were prepared and sequenced using the NEBNext small RNA library preparation kit from Illumina. The raw data were filtered and aligned with the Mouse.B38 genome using the miRbase.R22 gene model, with custom genomes added to each artificial miRNA processing vector. Mismatches were not allowed between reads and reference sequences, and a custom Python script was used to output the aligned mature miRNA sequences and counts. Retroorbital injection using AAV-PHP.eB-artificial miRNA vector

[0171] Injection was performed according to the Sanofi IACUC-approved procedure. Adult mice were anesthetized with isoflurane exposure, and 40 µL of virus containing the 3.9E11 vector genome was injected into each retroorbital sinus, for a total dose of 7.8E11 vector genome per animal. Four weeks post-injection, mice were euthanized by an overdose with >150 mg / kg sodium pentobarbital. Following the overdose, mice were kept warm until cardiac perfusion with ice-cold PBS. Homogenous brain tissue

[0172] Following perfusion, the hindbrains from Tau22 mice were dissected, rapidly frozen in liquid nitrogen, and stored at -80°C. Tissue beads were homogenized for 3 minutes at 30 Hz in 1X Tris-EDTA (TE) buffer (Fisher BP2475500) at 4°C using TissueLyser II (Qiagen). The homogenized beads were then aliquoted and stored at -80°C until further use. Quantification of human MAPT mRNA in the hindbrain using ddPCR

[0173] TE homogenate was thawed on ice and QIAZOL lysis reagent (Qiagen) was added, followed by phase separation according to the manufacturer's instructions. RNA was isolated from the aqueous phase using the miRNeasy 96 Advanced Mini Kit (Qiagen) on a QIAcube HT with on-column DNase treatment using an RNase-free DNase kit (Qiagen). RNA concentration and purity were assessed by measuring absorbance at A260 / 280 on a NanoDrop spectrophotometer (Thermo Scientific). mRNA expression was quantified by reverse transcriptase droplet digital PCR using the Bio-Rad 1-Step RT-ddPCR Advanced Probe Kit and probes targeting human MAPT (Hs00902194_m1; Applied Biosystems) and mouse Hprt1 (Mm.PT.58.29815602; IDT). Reactions were performed using a QX200 AutoDG microdroplet digital PCR system and a C1000 Touch 96-well thermal cycler (Bio-Rad Laboratories). MAPT mRNA was quantified using Quantasoft analytical software (Bio-Rad Laboratories) with Hprt1 expression as a home control, and the expression in animals treated with MAPT artificial miRNA was normalized relative to that in animals treated with control artificial miRNA. Quantification of human tau protein in the hindbrain using ELISA

[0174] Thaw the TE homogenate on ice and add 2x RIPA lysis buffer (Boston BioProducts) to a final concentration of 1x, with 1x Halt protease inhibitor mixture (Thermo Scientific). Incubate the sample on ice for 30 min and centrifuge at 14,000 RCF for 15 min at 4°C. Quantify the soluble protein concentration in the supernatant using the DC Protein Assay Kit (Bio-Rad Laboratories) according to the manufacturer's instructions, and dilute the RIPA soluble fraction to a final concentration of 100 pg / mL. Quantify total human tau using an ELISA (Ingenium Technology KHB0041) on a Flexstation 3 plate reader (Megol Molecular Instruments) according to the manufacturer's instructions, and normalize the values ​​relative to total protein content. pTau Immunohistochemistry

[0175] Mouse hemispheres were dissected and fixed overnight in 10% neutral buffered formalin, followed by paraffin embedding. Sagittal sections were cut to a thickness of 5 µm and immunohistochemically analyzed on a LeicaBondRx (Leica Biosystems) using an AT8 antibody (Ingenieur MN1020) that recognizes phosphorylated tau (Ser202, Thr205). Slides were then placed on coverslips and imaged using a 20x objective on an Aperio AT2 scanner (Leica Biosystems). Pixel-based thresholding analysis of the images was performed using Harmony software to assess weak, moderate, and strong AT8+ signals. Simoa Measurement by Quantrics

[0176] Blood samples were collected in K2EDTA tubes before drug administration and at autopsy time points, centrifuged at 12,000 RPM for 10 minutes at 4°C, and plasma was collected from the supernatant. At the terminal time point, cerebrospinal fluid (CSF) was collected via cerebellomedullary cistern puncture, and terminal tissue homogenates were prepared as described above. The concentration of tau in the tissue homogenates and neurofilament light chains (NfL) in CSF and plasma were measured using an ultrasensitive single-molecule array on a Simoa HD-X analyzer (Quanttrics). The concentration of pTau181 in the tissue homogenates was measured using an ultrasensitive single-molecule array on a Simoa HD-X analyzer (Quanttrics). Example 1: Artificial miRNA sequences reduce tau expression in human cells

[0177] Artificial miRNA (mRNA) sequences targeting human MAPT mRNA were designed. A total of 22 sequences were selected based on the following criteria: 1) their low off-target potential calculated using siSPOTR (Boudreau et al., 2013); 2) avoidance of known pathogenic MAPT mutations and high-frequency single nucleotide polymorphisms (SNPs); and 3) high sequence homology between humans and non-human primates to facilitate translation. The sequences were each embedded in a mouse miR155 scaffold and cloned into mammalian expression plasmids driven by a constitutive polymerase II promoter. To screen these candidates for tau knockdown, the plasmids were transfected into human osteosarcoma cells of the 1N4R isomorph stably expressing MAPT mRNA with G272V and P301S mutations. After three days, the cells were lysed and tau protein was quantified by human tau ELISA. Compared to samples already transfected with artificial miRNA control plasmids (referred to as "controls"), ten artificial miRNA sequences were identified as significantly reducing tau protein expression by more than 50%. Figure 1 For more detailed information, please see the following general examples: “Plasmids, ITR Vectors and AAV Generation”, “U2OS Cell Culture and Transfection”, and “Human Tau (HT7 Antibody) Sandwich ELISA”. Example 2: Intraparenchymal injection of AAV followed by artificial miRNA sequence reduced tau expression in a mouse model of tau proteinopathy.

[0178] Two artificial miRNA sequences, Tau01 and Tau12, were evaluated in the Tau22 mouse model (see Table 1). Tau22 animals overexpress human 1N4R tau isomorphs with two mutations, G272V and P301S, under the neuron-specific Thy1.2 promoter. These animals exhibit progressive accumulation of phosphorylated tau isomorphs and fibrillary aggregates, accompanied by associated neurological degeneration, glial proliferation, and behavioral deficits (Schindowski et al., 2006). The AAVrh.10-artificial miRNA vector encoding candidate artificial miRNAs was administered intraparenchymally to the striatum of two-month-old Tau22 transgenic mice. One month later, as measured by qPCR, human MAPT mRNA was significantly reduced by more than 50% in the striatum of animals treated with Tau01 and Tau12 (…). Figure 2A Tau protein was measured by ELISA using a human tau-specific HT7 antibody. Tau01 and Tau12 significantly reduced tau protein expression by 25% and 45%, respectively. Figure 2B In a separate study, the AAVrh.10-artificial miRNA vector was injected into the hippocampus of Tau22 mice, and hippocampal sections were immunostained for human tau one month later. Both Tau01 and Tau12 significantly reduced human tau expression in the dentate gyrus of the hippocampus, a region that undergoes progressive tau accumulation in the Tau22 mouse model. Figure 3 The capsid AAV.SAN006 was also evaluated in this mouse model, and intrastriatal administration of Tau01 significantly reduced human MAPT expression in the striatum of Tau22 by more than 50%. Animals treated with Tau12 showed a trend toward 40% knockdown. Figure 4For more detailed information, please see the following general examples: “Plasmids, ITR Vectors, and AAV Generation,” “Human Tau (HT7 Antibody) Sandwich ELISA,” “Animal Use and Care,” “Stereotactic Injection with AAV-amiRNA Vector,” “Striatal Tissue Processing and MAPT mRNA Quantification: By RT-qPCR,” “Striatal Tissue Homogenization after AAV.SAN006-amiRNA Treatment,” “Striatal Human MAPT mRNA Quantification by RT-dPCR,” and “Hippocampal Tau Protein Detection: Immunofluorescence.” Example 3: Artificial miRNA sequences exhibit accurate strand bias and 5' processing in vivo.

[0179] Each artificial miRNA was expressed as a precursor miRNA hairpin loop, which was machined by an endogenous RNAi system to generate a mature 21-nucleotide double-stranded structure. The antisense guide strand of this double-stranded structure was preferentially loaded into the RNA-induced silencing complex (RISC) to mediate the degradation of the target mRNA, while the lagging strand was excluded and degraded in the cytosol. Appropriate 5' cleavage of the artificial miRNA guide sequence defines the seed sequence and is crucial for mid-target transcriptional silencing. Small RNA sequencing was used to evaluate in vivo guide and lagging strand processing based on known metrics that contribute to the mid-target and off-target activities of the artificial miRNA. As described above, the AAV-rh.10-artificial miRNA vector was injected into the striatum of Tau22 animals, and total striatal RNA was isolated four weeks post-injection. Small RNA libraries were prepared and sequenced to quantify the expression levels of the guide and lagging strands and the fidelity of strand cleavage at the 5' and 3' ends. For both Tau01 and Tau12, the guide strand containing the antisense seed sequence targeting MAPT was highly enriched compared to its corresponding lagging strand, accounting for an average of over 99% of the total artificial miRNA sequences expressed from the AAV-rh.10 vector. Figure 5A Furthermore, for each artificial miRNA, the precision of 5' processing of the guide strand exceeds 99%. Figure 5B These results demonstrate that the strand bias of Tau01 and Tau12 is highly accurate, and that the 5' cleavage of the artificial miRNA sequence preserves the designed seed sequence for targeting MAPT. For more details, please see the following general examples: “Plasmids, ITR Vectors, and AAV Generation,” “Animal Use and Care,” “Stereotactic Injection with AAV-amiRNA Vectors,” and “Small RNA Sequencing.” Example 4: Intravenous injection of AAV-PHP.eB followed by artificial miRNA sequence reduced tau expression in a mouse model of tau proteinopathy.

[0180] Clinical translation of tau-reducing therapies will require extensive CNS transduction and target reduction following adequate expression of artificial miRNAs. AAV serotype PHP.eB can cross the blood-brain barrier after intravenous injection to generate extensive CNS transduction in C57 / Bl6 mice (Chan et al., 2017). The AAV-PHP.eB vector encoding artificial miRNA was injected into the posterior orbital sinus of Tau22 mice to evaluate tau reduction in the hindbrain—a region severely affected by tau proteinopathy, including progressive supranuclear palsy. One month later, MAPT knockdown in hindbrain tissue containing the cerebellum and brainstem was analyzed at both mRNA and protein levels. As measured by ddPCR, Tau01 and Tau12 significantly reduced human MAPT mRNA expression by 92% and 59%, respectively. Figure 6A As measured by ELISA, Tau01 and Tau12 reduced human tau protein in the hindbrain by 53% and 32%, respectively. Figure 6B For more detailed information, please see the following general examples: “Plasmids, ITR Vectors and AAV Generation”, “Animal Use and Care”, “Postorbital Injection with AAV-PHP.eB-amiRNA Vector”, “Hippobrain Tissue Homogenization”, “Hippobrain Human MAPT mRNA Quantification by ddPCR”, and “Hippobrain Human Tau Protein Quantification by ELISA”. Example 5: Artificial miRNA sequences reduce phosphotau protein symptoms in a late-stage intervention efficacy paradigm

[0181] The progressive accumulation of phosphorylated tau (pTau) aggregates is a defining characteristic of tau proteinopathy re-enacted in the Tau22 disease model. To further evaluate the efficacy of Tau01 and Tau12 artificial miRNAs, the AAV-PHP.eB vector was administered intravenously to six-month-old Tau22 mice, at which point significant pTau aggregates were generated in this model. Three months post-injection, tissue homogenates from the hindbrain and spinal cord were analyzed using a Simoa assay (Quanttrics, Inc.) to measure total human tau protein and tau phosphorylated at epitope 181 (pTau181). Both low- and high-dose AAV-PHP.eB-Tau01 significantly reduced total tau and pTau181 in the hindbrain and spinal cord, with reductions of more than 50% in both analytes observed in each tissue in the high-dose Tau01 group. High-dose AAV-PHP.eB-Tau12 resulted in a significant reduction in total tau in both the hindbrain and spinal cord, and a significant reduction in pTau181 was observed in the spinal cord. Figures 7A-7BThe tau protein symptom was also assessed in situ from tissues of animals in the high-dose group using immunohistochemistry with pTau antibody AT8. In the control animals, characteristic staining patterns representing tau neurofibrillary tangles were observed in both the cortex and hindbrain. Figure 8A To quantify various levels of pTau symptoms, low, medium, and high AT8 intensity thresholds were set using pixel-based detection in each target region. Figure 8B In the cortex, a significant reduction in AT8-positive area was observed at low, medium, and high thresholds when treated with both Tau01 and Tau12. Figure 8C In the hindbrain, compared with control animals, a significant reduction in AT8+ area at the middle and high thresholds was observed in the high-dose Tau01 group. Figure 8D For more detailed information, please see the following general examples: “Plasmids, ITR Vectors and AAV Generation”, “Animal Use and Care”, “Postorbital Injection with AAV-PHP.eB-amiRNA Vector”, “Hippoencephalomatous Tissue Homogenization”, “pTau Immunohistochemistry”, and “Quanttrics Simoa Assay”. Example 6: Artificial miRNA sequences reduce neurofilament light chains (NfL), a biomarker of neurodegenerative diseases, in a late-stage intervention efficacy paradigm.

[0182] The Tau22 mouse model showed a progressive increase in neurofilament light chains (NfL) in plasma and cerebrospinal fluid (CSF). Neurofilament light chains are neurodegenerative biomarkers associated with disease progression in patients with primary tau proteinosis (Brureau, 2017; Rojas et al., 2018). To determine whether artificial miRNA-mediated tau reduction also affects neurodegeneration, NfL in CSF and plasma was measured using the Quanttrics Simoa assay. In control animals, prior to the study at 6 months of age ( Figure 9A -Left) and End ( Figure 9A (Right) An increase in plasma NfL was detected between 9 months of age. At each dose, a significant reduction in NfL was observed in plasma containing both Tau01 and Tau12 compared to the control. A significant 86% reduction in CSF NfL was also observed at the final time point at the low-dose Tau01 level compared to the control. Figure 9B For more detailed information, please see the following general examples: “Plasmids, ITR Vectors, and AAV Generation,” “Animal Use and Care,” “Postorbital Injection with AAV-PHP.eB-amiRNA Vector,” and “Quanttrics Simoa Assay.” Example 7: AAV-RNAi-mediated reduction of MAPT for the treatment of progressive supranuclear palsy method

[0183] In this example, computer-aided design tools were used to identify artificial miRNA (amiRNA) sequences with low off-target potential and interspecies homology. The MAPT knockdown efficiency of the sequence was tested in vitro using U2OS cells stably expressing 4R human tau, and tau protein was quantified by ELISA three days post-transfection. Progenitor candidates were cloned into AAV vectors to evaluate MAPT knockdown and efficacy readouts in a Tau22 mouse model of tau proteinopathy. These mice overexpressed 1N4R human tau with two FTD-related mutations that drive progressive neuronal accumulation of tau aggregates and subsequent neurodegeneration. result

[0184] Several amiRNA candidates significantly reduced human tau protein expression in vitro. Three months after expression in Tau22 mice, the lead amiRNA Tau01 significantly reduced MAPT mRNA expression. Furthermore, Tau01 decreased the levels of pathologically phosphorylated tau in the cortex, hindbrain, and spinal cord. The levels of neurofilament light chains, a biomarker of axonal injury, in cerebrospinal fluid and plasma were also significantly reduced, indicating that the reduction in total tau achieved via AAV-driven RNAi can significantly influence neurodegeneration. in conclusion

[0185] These results support the use of these AAV-amiRNA vectors for sustained reduction of pathogenic human tau. With recognized therapeutic targets and well-defined lead agent identification pathways, this invention aims to develop transformative therapies for patients with destructive neurodegenerative tau protein diseases such as PSP. Other sequence lists Target peptide amino acid sequence KGGGFHG (SEQ ID NO: 57) Flanking the target peptide-amino acid sequence of the linker AAAKGGGFHGAS (SEQ ID NO: 58) SAN0006 capsid amino acid sequence (complete structural protein) Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser 1 5 10 15 Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro 20 25 30 Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro 35 40 45 Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro 50 55 60 Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp 65 70 75 80 Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala 85 90 95 Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly 100 105 110 Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro 115 120 125 Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg 130 135 140 Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly 145 150 155 160 Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr 165 170 175 Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro 180 185 190 Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly 195 200 205 Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser 210 215 220 Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile 225 230 235 240 Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu 245 250 255 Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn 260 265 270 Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg 275 280 285 Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn 290 295 300 Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile 305 310 315 320 Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn 325 330 335 Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu 340 345 350 Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro 355 360 365 Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp 370 375 380 Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe 385 390 395 400 Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu 405 410 415 Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu 420 425 430 Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser 435 440 445 Lys Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser 450 455 460 Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro 465 470 475 480 Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn 485 490 495 Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn 500 505 510 Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys 515 520 525 Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly 530 535 540 Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile 545 550 555 560 Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser 565 570 575 Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ala Ala Ala Lys 580 585 590 Gly Gly Gly Phe His Gly Ala Ser Ala Gln Ala Gln Thr Gly Trp Val 595 600 605 Gln Asn Gln Gly Ile Leu Pro Gly Met Val Trp Gln Asp Arg Asp Val 610 615 620 Tyr Leu Gln Gly Pro Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn 625 630 635 640 Phe His Pro Ser Pro Leu Met Gly Gly Phe Gly Met Lys His Pro Pro 645 650 655 Pro Gln Ile Leu Ile Lys Asn Thr Pro Val Pro Ala Asp Pro Pro Thr 660 665 670 Ala Phe Asn Lys Asp Lys Leu Asn Ser Phe Ile Thr Gln Tyr Ser Thr 675 680 685 Gly Gln Val Ser Val Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser 690 695 700 Lys Arg Trp Asn Pro Glu Ile Gln Tyr Thr Ser Asn Tyr Tyr Lys Ser 705 710 715 720 Asn Asn Val Glu Phe Ala Val Asn Thr Glu Gly Val Tyr Ser Glu Pro 725 730 735 Arg Pro Ile Gly Thr Arg Tyr Leu Thr Arg Asn Leu (SEQ ID NO:59) 740 745。

Claims

1. An artificial microRNA comprising a first strand and a second strand, wherein... (a) The first chain and the second chain form a double chain; (b) The first strand contains a guide region containing the following nucleotide sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 or SEQ ID NO: 22; and (c) The second strand contains a non-guided region containing a nucleotide sequence that is partially complementary to the nucleotide sequence of the guided region.

2. The artificial microRNA of claim 1, wherein the guidance region comprises the sequence of SEQ ID NO:

1.

3. The artificial microRNA of claim 1, wherein the guiding region comprises the sequence of SEQ ID NO:

12.

4. The artificial microRNA of claim 1, wherein the guidance region comprises (a) The sequence of SEQ ID NO: 1, and the non-guided region contains the sequence of SEQ ID NO: 23; (b) The sequence of SEQ ID NO: 2, and the non-guided region contains the sequence of SEQ ID NO: 24; (c) The sequence of SEQ ID NO: 3, and the non-guided region contains the sequence of SEQ ID NO: 25; (d) The sequence of SEQ ID NO: 4, and the non-guided region contains the sequence of SEQ ID NO: 26; (e) The sequence of SEQ ID NO: 5, and the non-guided region contains the sequence of SEQ ID NO: 27; (f) The sequence of SEQ ID NO: 6, and the non-guided region contains the sequence of SEQ ID NO: 28; (g) The sequence of SEQ ID NO: 7, and the non-guided region contains the sequence of SEQ ID NO: 29; (h) The sequence of SEQ ID NO: 8, and the non-guided region contains the sequence of SEQ ID NO: 30; (i) The sequence of SEQ ID NO: 9, and the non-guided region contains the sequence of SEQ ID NO: 31; (j) The sequence of SEQ ID NO: 10, and the non-guided region contains the sequence of SEQ ID NO: 32; (k) The sequence of SEQ ID NO: 11, and the non-guided region contains the sequence of SEQ ID NO: 33; (l) The sequence of SEQ ID NO: 12, and the non-guided region contains the sequence of SEQ ID NO: 34; (m) The sequence of SEQ ID NO: 13, and the non-guided region contains the sequence of SEQ ID NO: 35; (n) The sequence of SEQ ID NO: 14, and the non-guided region contains the sequence of SEQ ID NO: 36; (o) The sequence of SEQ ID NO: 15, and the non-guided region contains the sequence of SEQ ID NO: 37; (p) The sequence of SEQ ID NO: 16, and the non-guided region contains the sequence of SEQ ID NO: 38; (q) The sequence of SEQ ID NO: 17, and the non-guided region contains the sequence of SEQ ID NO: 39; (r) The sequence of SEQ ID NO: 18, and the non-guided region contains the sequence of SEQ ID NO: 40; (s) the sequence of SEQ ID NO: 19, and the non-guided region contains the sequence of SEQ ID NO: 41; (t) The sequence of SEQ ID NO: 20, and the non-guided region contains the sequence of SEQ ID NO: 42; (u) The sequence of SEQ ID NO: 21, and the non-guided region contains the sequence of SEQ ID NO: 43; or (v) The sequence of SEQ ID NO: 22, and the non-guided region contains the sequence of SEQ ID NO:

44.

5. The artificial microRNA of claim 4, wherein the guiding region comprises the sequence of SEQ ID NO: 1, and the non-guiding region comprises the sequence of SEQ ID NO:

23.

6. The artificial microRNA of claim 4, wherein the guiding region comprises the sequence of SEQ ID NO: 12, and the non-guiding region comprises the sequence of SEQ ID NO:

34.

7. The artificial microRNA according to any one of claims 1-6, wherein the artificial microRNA targets tau mRNA.

8. The artificial microRNA of claim 7, wherein the binding of the guidance region to the coding sequence of the tau mRNA reduces the expression of the protein tau.

9. An expression construct comprising a nucleic acid encoding an artificial microRNA as described in any one of claims 1-8.

10. The expression construct of claim 9, wherein the nucleic acid encoding the microRNA is operatively linked to a promoter.

11. The expression construct of claim 9 or claim 10, wherein the nucleic acid encoding the artificial microRNA is cloned into a miRNA scaffold, wherein the transcription of the expression construct forms a stem-loop structure.

12. A vector comprising the expression construct as described in any one of claims 9-11.

13. The carrier of claim 12, wherein the carrier is an rAAV carrier.

14. A viral particle comprising the vector as described in claim 12, wherein the viral particle is an AAV particle capsidating the rAAV vector.

15. The viral particle of claim 14, wherein the viral particle comprises a modified AAV9 capsid protein.

16. A method of treating or preventing tau proteinosis in a patient in need, the method comprising administering to the patient a composition comprising a microRNA comprising a guide strand and a follower strand for binding tau mRNA, wherein the guide strand comprises the nucleotide sequence of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 or SEQ ID NO:

22.

17. The method of claim 16, wherein the tau protein disease is progressive supranuclear paralysis (PSP).

18. The method of claim 17, wherein the tau protein disease is Alzheimer's disease (AD).

19. A method for reducing tau expression in a patient with tau proteinopathy, the method comprising administering to the patient a composition comprising a microRNA comprising a guide strand and a follower strand for binding tau mRNA, wherein the guide strand comprises the following nucleotide sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21 or SEQ ID NO: 22.

Images