Lactobacillus rhamnosus Q7 fermentation liquor, preparation method and application thereof

Abstract

The present application relates to a lactobacillus rhamnosus Q7 fermentation broth, a preparation method and application thereof, and belongs to the technical field of microorganisms. The fermentation broth is obtained by fermenting a substrate of lactobacillus rhamnosus Q7; the lactobacillus rhamnosus (Lactobacillus rhamnosus) Lacticaseibacillus rhamnosus ) Q7 is preserved in the China General Microbiological Culture Collection Center, has a preservation number of CGMCC No. 37563, a preservation date of January 28, 2026, and an address of the preservation agency of No. 3, Xili, Beichen West Road, Chaoyang District, Beijing. The present application further provides a method for preparing the fermentation broth and application of the fermentation broth. By using the lactobacillus rhamnosus Q7 fermentation substrate, the present application can eliminate the drug resistance conflict between raw materials in the substrate, realize the multi-target synergistic effect of improving microcirculation, removing dampness and improving metabolism.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a fermentation broth of Lactobacillus rhamnosus Q7, its preparation method, and its application. Background Technology

[0002] Food-medicine homology ingredients are widely used in health food research and development due to their high safety and suitability for long-term consumption. While existing technologies utilize single or compound food-medicine homology ingredients in health products for purposes such as dampness removal, lipid reduction, and blood circulation improvement, most are simple physical mixtures with several drawbacks: First, the efficacy of the ingredients is dispersed, making it difficult for the components to form a synergistic effect. Some ingredients exhibit conflicting medicinal properties; for example, a simple combination of dampness-removing and yin-nourishing ingredients can inhibit each other's efficacy, resulting in poor overall conditioning effects. Second, food-medicine homology ingredients that have not undergone biotransformation often contain large molecules, leading to low absorption and utilization rates by the human body and insufficient efficacy. Third, existing products have limited functions and cannot simultaneously achieve multi-target synergistic conditioning that improves microcirculation, removes dampness, and enhances metabolism, thus failing to meet the needs of integrated health maintenance.

[0003] For example, patent CN121022636A only uses a single strain to achieve effects such as lowering lipids and blood sugar, without involving key effects such as improving microcirculation and removing dampness. The strain only acts on the glucose and lipid metabolism process and cannot regulate the body holistically and in an integrated manner. Moreover, this technology only applies the strain alone and does not carry out bio-fermentation with food and medicine homologous raw materials. It lacks the mechanism for conversion and enhancement of active ingredients, resulting in limited efficacy and narrow application scenarios.

[0004] The fibrinolytic enzyme lumbrokinase peptide dietary therapy formula disclosed in patent CN121694460A achieves thrombolysis and blood circulation by simply mixing raw materials without undergoing microbial fermentation for component transformation and enhancement. The absorption and utilization rate of macromolecular components is low. At the same time, it does not involve key effects such as removing dampness and improving metabolism, and cannot achieve the synergistic effect of "improving microcirculation + removing dampness + regulating metabolism". Moreover, this formula relies on the direct compounding of raw materials such as earthworm protein and natto powder. There is no synergistic effect or drug harmony among the raw materials, which is prone to defects such as poor absorption, weak effect and incomplete efficacy. Long-term consumption experience is not good and cannot meet the needs of integrated health care.

[0005] Microbial fermentation technology can biotransform medicinal and edible raw materials, decompose macromolecular active ingredients, improve the dissolution rate and human absorption rate of components, and resolve the drug-like interactions between raw materials, thus generating new synergistic effects. Currently, there are no reports on technologies that have enabled medicinal and edible raw materials such as kudzu root, poria cocos, and red adzuki bean to produce the aforementioned multi-functional synergistic effects through specific microbial fermentation. Summary of the Invention

[0006] To address the issue that existing fermented foods do not utilize Lactobacillus rhamnosus fermentation to prepare functional products for improving microcirculation, removing dampness, and enhancing metabolism, this invention provides a Lactobacillus rhamnosus Q7 fermentation broth, its preparation method, and its applications to solve the aforementioned problem.

[0007] In a first aspect, the present invention provides a fermentation broth obtained from a fermentation substrate of *Lactobacillus rhamnosus* Q7; wherein *Lactobacillus rhamnosus* ( Lacticaseibacillus rhamnosus Q7 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 37563, deposited on January 28, 2026. The address of the depository is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The substrate comprises the following components in parts by weight: 12-16 parts of kudzu root, 14-18 parts of poria cocos, 10-14 parts of red adzuki bean, 8-11 parts of lotus leaf, 9-12 parts of polygonatum odoratum, and 20-30 parts of purified water.

[0008] Furthermore, the 16S rDNA sequence of the Lactobacillus rhamnosus Q7 is shown in SEQ ID NO.3.

[0009] In some preferred embodiments, the substrate comprises the following components in parts by weight: 14 parts kudzu root, 16 parts poria cocos, 12 parts red adzuki bean, 9 parts lotus leaf, 10 parts polygonatum odoratum, and 25 parts purified water.

[0010] Secondly, the present invention provides a method for preparing the above-mentioned fermentation broth, comprising the following steps: (1) After mixing the substrate, sterilize it under high pressure at 121℃ for 30 min, and then cool it to 30℃~40℃. (2) Inoculate Lactobacillus rhamnosus Q7 into MRS liquid medium for activation. The inoculation amount is 1%, and the culture is carried out at 37℃ for 18~30h to obtain seed culture solution. (3) Inoculate the seed culture medium into sterile raw materials at an inoculation amount of 1% and culture at 37°C for 20-48 hours to obtain fermentation broth.

[0011] Furthermore, the composition of the MRS liquid culture medium is as follows: peptone 10.0 g / L, beef extract 10.0 g / L, yeast extract 5.0 g / L, glucose 20.0 g / L, Tween 80 1.0 mL / L, dipotassium hydrogen sulfate heptahydrate 2.0 g / L, sodium acetate trihydrate 5.0 g / L, triammonium citrate 2.0 g / L, magnesium sulfate heptahydrate 0.1 g / L, and manganese sulfate tetrahydrate 0.05 g / L.

[0012] Furthermore, after obtaining the fermentation liquid in step (3), the flavor of the fermentation liquid can be adjusted by adding seasonings.

[0013] In some preferred embodiments, the seasoning comprises the following components in parts by weight: 1 to 3 parts honey and 1 to 3 parts apple concentrate.

[0014] Furthermore, the seasoning includes 3 parts honey and 2 parts apple concentrate.

[0015] Furthermore, the bacterial concentration of Lactobacillus rhamnosus Q7 in the fermentation broth is ≥1000 CFU / mL.

[0016] Thirdly, the present invention provides an application of Lactobacillus rhamnosus Q7 fermentation broth in the preparation of products that improve microcirculation.

[0017] Fourthly, this invention provides the application of Lactobacillus rhamnosus Q7 fermentation broth in the preparation of dehumidifying products.

[0018] Fifthly, the present invention provides the application of Lactobacillus rhamnosus Q7 fermentation broth in the preparation of products that enhance metabolism.

[0019] The beneficial effects of this invention are as follows: (1) The fermentation liquid of Lactobacillus rhamnosus Q7 provided by the present invention has a multi-functional synergistic effect. By using Lactobacillus rhamnosus Q7 fermentation substrate, the drug conflict between raw materials in the substrate can be eliminated, and the multi-target synergistic effect of improving microcirculation, removing dampness and improving metabolism can be achieved. The efficacy is far superior to that of simple mixtures of raw materials, and the problem of single product function is solved.

[0020] (2) The fermentation broth of Lactobacillus rhamnosus Q7 provided by this invention has a high absorption and utilization rate. By using Lactobacillus rhamnosus Q7 for fermentation, the large molecular active substances in the substrate raw materials are converted into small molecular substances, which greatly improves the dissolution rate of active ingredients, making them easier for the human body to absorb and ensuring that the efficacy is fully exerted.

[0021] (3) The fermentation liquid of Lactobacillus rhamnosus Q7 provided by the present invention is safe and reliable and suitable for long-term consumption: all raw materials are selected from medicinal and food homologous materials, the formula is mild and does not contain toxic components, no chemical additives are added in the production process, the fermentation process is green and safe, and it can be consumed for a long time.

[0022] (4) The fermentation process of Lactobacillus rhamnosus Q7 provided by the present invention is suitable for mass production and has broad application prospects: the fermentation process conditions are mild, the process parameters are stable and controllable, the operation process is simple, and it is easy to carry out large-scale industrial production. It has good market promotion and application value. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 This is a colony diagram of Lactobacillus rhamnosus Q7.

[0025] Figure 2 This is a Gram staining image of Lactobacillus rhamnosus Q7.

[0026] Figure 3 These are graphs showing the results of calcium dissolution zone experiments for different strains. In the graph, A is the calcium dissolution zone experiment result for *Lactobacillus rhamnosus* Q7, B is the calcium dissolution zone experiment result for *Pediococcus lactis* JYPA-30, and C is the calcium dissolution zone experiment result for *Lactobacillus paracasei* HH-LP58.

[0027] Figure 4 This is a bar graph showing the experimental results of the Lactobacillus rhamnosus Q7 fermentation broth increasing the diameter of blood vessels in zebrafish and improving microcirculation / dampness removal in this embodiment of the invention.

[0028] Figure 5 This is a phenotypic diagram showing the experimental results of the *Lactobacillus rhamnosus* Q7 fermentation broth increasing the blood vessel diameter and improving microcirculation / dampness removal effects in zebrafish, as described in this embodiment of the invention. In the diagram, A represents the blank control group, and B represents the sample treatment group.

[0029] Figure 6 This is a bar graph showing the results of an experiment verifying the metabolic efficacy of Lactobacillus rhamnosus Q7 fermentation broth in increasing the content of adenosine triphosphate (ATP) in zebrafish.

[0030] Figure 7 This is a bar graph showing the experimental results of the verification of the efficacy of Lactobacillus rhamnosus Q7 fermentation broth in increasing the staining area of ​​cardiac blood cells and preventing thrombosis in an embodiment of the present invention.

[0031] Figure 8 This is a phenotypic diagram (magnification 40x) of the experimental results verifying the efficacy of Lactobacillus rhamnosus Q7 fermentation broth in increasing the staining area of ​​cardiac blood cells and preventing thrombosis in an embodiment of the present invention. In the figure, A is the blank control group, B is the model control group, C is the positive control group, and D is the sample treatment group. Detailed Implementation

[0032] To enable those skilled in the art to better understand the technical solutions of this invention, the technical solutions of the embodiments of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of this invention.

[0033] The components of the various culture media used in the following examples are as follows: MRS solid plate culture medium: peptone 10.0 g / L, beef extract 10.0 g / L, yeast extract 5.0 g / L, glucose 20.0 g / L, Tween 80 1.0 mL / L, dipotassium hydrogen sulfate heptahydrate 2.0 g / L, sodium acetate trihydrate 5.0 g / L, triammonium citrate 2.0 g / L, magnesium sulfate heptahydrate 0.1 g / L, manganese sulfate tetrahydrate 0.05 g / L, agar 15.0 g / L.

[0034] MRS liquid culture medium: peptone 10.0 g / L, beef extract 10.0 g / L, yeast extract 5.0 g / L, glucose 20.0 g / L, Tween 80 1.0 mL / L, dipotassium hydrogen sulfate heptahydrate 2.0 g / L, sodium acetate trihydrate 5.0 g / L, triammonium citrate 2.0 g / L, magnesium sulfate heptahydrate 0.1 g / L, manganese sulfate tetrahydrate 0.05 g / L.

[0035] Example 1 Isolation, screening and identification of Lactobacillus rhamnosus Q7 1. Sampling: Fermented yogurt collected in Xining City, Qinghai Province in June 2025.

[0036] 2. Separation: Take 1g of fermented yogurt collected in step (1), perform a tenfold serial dilution of the sample, take 100μL of each gradient and spread it evenly on MRS solid plate medium, place it in a carbon dioxide incubator at 37 ℃ and incubate for 1~2 days until obvious colonies grow on the plate, randomly select a number of colonies with different characteristics for purification treatment, and then perform strain identification.

[0037] 3. Identification (1) Identification of colony morphology When strain Q7 was inoculated onto MRS solid medium and incubated at 37°C for 24 hours, single colonies of strain Q7 were observed on the MRS medium to be round, white, raised, with a smooth, moist surface and neat edges. The colonies of strain Q7 were as follows: Figure 1 As shown. Under an optical microscope, the strain is short rod-shaped (0.8~1.0μm × 2.0~4.0μm), distributed singly or in pairs, non-motile, non-spore-forming, Gram-positive, appearing blue-purple or purple. Optical microscope images are shown below. Figure 2 As shown.

[0038] (2) Identification Single colonies of strain Q7 were streaked onto NA plates and incubated at 35°C for 12 hours. The incubated NA plates were then sent to Sangon Biotech (Shanghai) Co., Ltd. for strain identification.

[0039] The upstream primer was 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO.1); The downstream primer was 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO.2).

[0040] The 16S rDNA sequence of strain Q7 is shown in SEQ ID NO.3: The strain with the highest similarity to the NCBI database was Lactobacillus rhamnosus (Lactobacillus casei). Lacticaseibacillus rhamnosus Therefore, strain Q7 was identified as *Lactobacillus rhamnosus*. Lacticaseibacillus rhamnosus Lactobacillus rhamnosus Q7 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 37563, deposited on January 28, 2026. The address of the depository is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0041] Example 2 Identification of the acid-producing capacity of lactic acid bacteria (1) Prepare an MRS plate containing 2% calcium carbonate.

[0042] (2) Lactobacillus rhamnosus Q7, Pediococcus lactis JYPA-30, and Lactobacillus paracasei HH-LP58 were activated respectively. Single colonies of suitable size were picked from MRS plates and inoculated into MRS broth at 37°C for 18-24 hours. Pediococcus lactis and Lactobacillus paracasei were purchased from Minsheng Zhongke Jiayi Biotechnology Co., Ltd.

[0043] (3) Take 1 mL of bacterial culture and perform serial dilution, then take 10 mL of the culture. -7 and 10 -8 1 mL of each dilution solution was spread onto MRS plates containing calcium carbonate and incubated at 37°C for 24–48 h. The acid-producing capacity of the lactic acid bacteria was determined by observing the presence and size of the calcium-dissolving zone. The results are as follows: Figure 3 As shown: according to Figure 3 The results show that *Lactobacillus rhamnosus* Q7, *Pediococcus lactis* JYPA-30, and *Lactobacillus paracasei* HH-LP58 all have acid-producing capabilities.

[0044] Example 3 Hydrophobicity test (1) Preparation of bacterial suspension The strains of Lactobacillus rhamnosus Q7, Pediococcus lactis, and Lactobacillus paracasei were activated, and single colonies of suitable size were picked from MRS plates and inoculated into MRS liquid medium and cultured at 37°C for 18-24 hours.

[0045] (2) Two-phase reaction OD of bacterial solution 640 After adjusting to 0.8±0.05 (denoted as A0), take 3 mL of bacterial culture and mix with 1 mL of n-hexadecane, vortex to emulsify thoroughly for 2 minutes, and let stand at 37℃ for 30 minutes until the two phases completely separate. Take the lower aqueous phase to measure OD. 640 , denoted as A t .

[0046] Hydrophobicity index HPBI (%) = ( 100% (3) The experimental results are shown in Table 1: Table 1 - Results of hydrophobicity test

[0047] Separates with an HPBI greater than 60% were arbitrarily classified as highly hydrophobic, strains with an HPBI between 30% and 60% were classified as moderately hydrophobic, and strains with an HPBI less than 30% were classified as lowly hydrophobic. High hydrophobicity was considered an indicator of good adhesion. Experimental results show that the *Lactobacillus rhamnosus* Q7 strain screened in this experiment possesses strong adhesion, good colonization, and high probiotic potential, making it suitable for further fermentation of medicinal and edible herbal medicines.

[0048] Example 4 Lactic acid bacteria simulated gastrointestinal fluid tolerance test (1) Preparation of simulated gastric juice: 125 mmol / L NaCl, 7 mmol / L KCl, 45 mmol / L NaHCO3 and 3 g / L pepsin, adjust the pH to 2.5 with hydrochloric acid to prepare simulated gastric juice, filter it with a 0.22 μm sterile filter membrane, and use it immediately after preparation.

[0049] (2) Preparation of simulated intestinal fluid: 45 mmol / L NaCl, 1 g / L trypsin, 3 g / L ox bile salt, adjust pH to 8.0 with sodium hydroxide to prepare simulated intestinal fluid, filter with 0.22 μm sterile filter membrane, and use immediately after preparation.

[0050] (3) The effective viable number of the strains after three consecutive generations of activation were determined by activating Lactobacillus rhamnosus Q7, Pietrococcus lactis and Lactobacillus paracasei respectively (each generation activation time was 18h).

[0051] (4) Prepare a live bacteria count of 10 8 The bacterial culture with CFU / mL was centrifuged at 8000 G for 10 min, the supernatant was discarded, and the culture was resuspended in simulated gastric fluid at a 1:1 ratio. After incubation at 37℃ for 3 h, viable bacteria were counted on plates.

[0052] (5) Centrifuge the bacterial solution after treatment with simulated gastric fluid at 8000 G for 10 min, discard the supernatant, resuspend it in an equal volume of simulated intestinal fluid, and incubate at 37℃ for 4 h before counting viable bacteria on a plate.

[0053] The survival rate of each strain after tolerance to gastrointestinal fluid was calculated according to the following formula, and the gastrointestinal adaptability of each strain was analyzed. The results are shown in Table 2.

[0054] Survival rate calculation formula = |Number of viable bacteria after stress (CFU / mL) / Initial number of viable bacteria (CFU / mL) × 100% Table 2 - Survival rates of strains after tolerating gastrointestinal fluid

[0055] As shown in Table 2, Lactobacillus rhamnosus Q7 has a survival rate of over 10% in gastrointestinal fluids compared to the other two strains, which meets the characteristics of probiotics and is suitable for further fermentation of medicinal and edible herbs.

[0056] Example 5 Preparation of Lactobacillus rhamnosus Q7 fermentation broth The fermentation substrate comprises the following components by weight: 25 parts purified water, 14 parts kudzu root, 16 parts poria cocos, 12 parts red adzuki beans, 9 parts lotus leaves, and 10 parts Solomon's seal rhizome. The seasoning comprises the following components by weight: 3 parts honey and 2 parts apple concentrate.

[0057] The preparation process is as follows: (1) Mix the components of the fermentation substrate to obtain a mixed raw material.

[0058] (2) Sterilize the raw materials under the following conditions: high pressure sterilization at 121°C for 30 min, and then cool to 40°C.

[0059] (3) Inoculate Lactobacillus rhamnosus Q7 into MRS liquid medium for activation. The inoculation amount is 1%, and the culture is carried out at 37°C for 18 hours to obtain seed culture solution.

[0060] (4) Inoculate the seed culture medium into sterile raw materials at an inoculation amount of 1% and culture at 37°C for 22 hours to obtain fermentation broth.

[0061] (5) After the fermentation liquid is mixed with seasonings, the fermentation liquid is obtained.

[0062] Example 6 Preparation of Lactobacillus rhamnosus Q7 fermentation broth The fermentation substrate comprises the following components by weight: 30 parts purified water, 12 parts kudzu root, 14 parts poria cocos, 10 parts red adzuki beans, 8 parts lotus leaves, and 9 parts polygonatum odoratum. The seasoning comprises the following components by weight: 1 part honey and 1 part apple concentrate.

[0063] The preparation process is as follows: (1) Mix the components of the fermentation substrate to obtain a mixed raw material.

[0064] (2) Sterilize the raw materials under the following conditions: high pressure sterilization at 121°C for 30 min, and then cool to 40°C.

[0065] (3) Inoculate Lactobacillus rhamnosus Q7 into MRS liquid medium for activation. The inoculation amount is 1%, and the culture is carried out at 37°C for 18 hours to obtain seed culture solution.

[0066] (4) Inoculate the seed culture medium into sterile raw materials at an inoculation amount of 1% and culture at 37°C for 22 hours to obtain fermentation broth.

[0067] (5) After the fermentation liquid is mixed with seasonings, the fermentation liquid is obtained.

[0068] Example 7 Preparation of Lactobacillus rhamnosus Q7 fermentation broth The fermentation substrate comprises the following components by weight: 20 parts purified water, 16 parts kudzu root, 18 parts poria cocos, 14 parts red adzuki bean, 11 parts lotus leaf, and 12 parts Solomon's seal rhizome. The seasoning comprises the following components by weight: 2 parts honey and 3 parts apple concentrate.

[0069] The preparation process is as follows: (1) Mix the components of the fermentation substrate to obtain a mixed raw material.

[0070] (2) Sterilize the raw materials under the following conditions: high pressure sterilization at 121°C for 30 min, and then cool to 40°C.

[0071] (3) Inoculate Lactobacillus rhamnosus Q7 into MRS liquid medium for activation. The inoculation amount is 1%, and the culture is carried out at 37°C for 18 hours to obtain seed culture solution.

[0072] (4) Inoculate the seed culture medium into sterile raw materials at an inoculation amount of 1% and culture at 37°C for 22 hours to obtain fermentation broth.

[0073] (5) After the fermentation liquid is mixed with seasonings, the fermentation liquid is obtained.

[0074] Example 8 Zebrafish Experiment - Improvement Rate of Blood Vessel Diameter in Zebrafish 1. Measurement of Safety Test Concentration (MTC) Transgenic zebrafish with vascular fluorescence, 3 days post-fertilization (3dpf), were randomly selected and placed into 24-well plates, with 10 zebrafish treated in each well. Samples were administered in water at concentrations of 2%, 1%, and 0.5%, with a blank control group included; the volume per well was 1 mL. One day after treatment, the MTC of the samples in zebrafish was measured.

[0075] 2. Efficacy Evaluation The zebrafish were divided into two groups: a blank control group and a sample treatment group. The blank control group received no treatment, while the sample treatment group received the fermentation broth prepared in Example 5. After culturing for a period of time, both groups of zebrafish were observed and photographed using a fluorescence microscope. The images were analyzed using software, and the data analysis results of the two groups were compared.

[0076] 3. Results of safe concentration measurement There was no significant difference between the 1% concentration sample treatment group and the blank control group (P < 0.01), therefore 1% concentration is the maximum safe concentration.

[0077] 4. Efficacy test results The vascular improvement activity of the fermentation broth prepared in Example 5 was evaluated using a zebrafish model. The improvement rate was calculated using the formula: |(mean value of test group - mean value of blank group) / mean value of blank group × 100%|. The experimental results are as follows: Figure 4 and Figure 5 As shown.

[0078] Depend on Figure 4 and Figure 5 The test results showed that the blood vessel diameter of zebrafish in the blank control group was 24.50±2.40 mm; after treatment with the fermentation broth prepared in Example 5, the blood vessel diameter of zebrafish was 30.92±5.28 mm, which was 26.20% higher than that of the blank control group. The differences were statistically significant (P<0.01), indicating that the fermentation broth prepared in Example 5 has excellent and stable vasodilatory activity. The fermentation broth prepared in Example 5 can significantly promote vasodilation in zebrafish, demonstrating a clear vascular improvement effect, and proving the advantages and application potential of Lactobacillus rhamnosus Q7 fermentation broth in the development of vascular health-related products.

[0079] Example 9 Zebrafish Experiment - Zebrafish Adenosine Triphosphate (ATP) Content (mmol / L) Test 1. Measurement of Safety Test Concentration (MTC) Wild-type AB strain zebrafish, 5 days post-fertilization (5 dpf), were randomly selected and encapsulated in 6-well plates, with 30 zebrafish treated in each well. Water-soluble administration was performed on the samples at concentrations of 2%, 1%, and 0.5%, with a blank control group included; the volume per well was 3 mL. One day after treatment, the MTC of the zebrafish samples was measured.

[0080] 2. Efficacy Evaluation The zebrafish were divided into three groups: a blank control group and a sample treatment group. The test substance stock solution was diluted with buffer water to prepare a series of appropriate concentration gradient solutions, with a dilution factor of no less than 10 times, and these solutions were kept for later use. The blank control group received no treatment, while the sample treatment group received the sample dilution solution. After a period of time, the ATP content was measured using an ELISA kit.

[0081] 3. Results of safe concentration measurement There was no significant difference between the 1% concentration sample treatment group and the blank control group (P < 0.001), therefore 1% concentration is the maximum safe concentration.

[0082] 4. Efficacy test results The metabolic efficacy of the product of this invention was evaluated using a zebrafish model. The improvement rate was calculated using the formula: |(Average value of test group - Average value of blank group) / Average value of blank group × 100%|.

[0083] Depend on Figure 6 The test results show that the metabolic efficacy of the product of this invention was evaluated using a zebrafish model. The experimental results show that the ATP content of zebrafish in the blank control group was 4070.13±24.69 mmol / L; after treatment with the fermented liquid prepared in Example 5, the ATP content of zebrafish was 4680.95±65.50 mmol / L, an increase of 15.00% compared to the blank control group, with both differences being statistically significant (P<0.001). These experimental data indicate that the fermented liquid prepared in Example 5 can significantly increase the ATP level in zebrafish, demonstrating a clear effect on improving metabolism, and proving the advantages and application potential of this invention in the development of products related to body energy metabolism.

[0084] Example 10 Zebrafish Experiment - Staining area (pixels) of blood cells in zebrafish heart 1. Measurement of Safety Test Concentration (MTC) Wild-type AB strain zebrafish, 5 days post-fertilization (5 dpf), were randomly selected and encapsulated in 24-well plates, with 10 zebrafish treated in each well. Water-soluble administration was performed on the samples at concentrations of 2%, 1%, and 0.5%, with a blank control group included; the volume per well was 3 mL. Two days after treatment, the MTC of the zebrafish samples was measured.

[0085] 2. Efficacy Evaluation The zebrafish were divided into four groups: a blank control group, a model control group, a positive control group, and a sample treatment group. The blank control group received no treatment. The model control group, positive control group, and sample treatment group all received an equal amount of epinephrine hydrochloride. The positive control group and sample treatment group received aspirin and the fermentation broth prepared in Example 5, respectively, in addition to epinephrine hydrochloride. After a period of cultivation, the staining area of ​​hemocytes in the hearts of the zebrafish from different groups was analyzed under a microscope.

[0086] 3. Results of safe concentration measurement There was no significant difference between the 1% concentration sample treatment group and the blank control group (p < 0.01), therefore 1% concentration is the maximum safe concentration.

[0087] 4. Efficacy test results The antithrombotic activity of the compositions of the present invention was evaluated using a zebrafish thrombosis model. The improvement rate was calculated using the formula: |(mean value of the test group - mean value of the blank group) / mean value of the blank group × 100%|.

[0088] Depend on Figure 7 and Figure 8 The test results showed that the staining area of ​​zebrafish heart hemocytocytes in the blank control group was 3880±2142 pixels, while that in the model control group was 2289±743 pixels, indicating that the thrombosis model was successfully constructed. After treatment with the positive control group, the staining area was 3106±656 pixels, representing an improvement rate of 35.69% compared to the model control group, with a highly statistically significant difference (P<0.01). After treatment with the fermentation broth prepared in Example 5, the staining areas of zebrafish heart hemocytocytes were 3380±320 pixels and 47.66%, respectively, with highly statistically significant differences (P<0.001), and there was no statistically significant difference between the two examples (P>0.05), indicating that the fermentation broth prepared in Example 5 has excellent and stable antithrombotic activity. The experimental data above show that the fermentation broth prepared in Example 5 can significantly improve cardiac blood flow in a zebrafish thrombosis model, has a clear antithrombotic effect, and its effect is significantly better than the existing control formula, proving the advantages and application potential of Lactobacillus rhamnosus Q7 fermentation broth in thrombosis prevention and related health product development.

[0089] Although the present invention has been described in detail with reference to the accompanying drawings and preferred embodiments, the present invention is not limited thereto. Various equivalent modifications or substitutions can be made to the embodiments of the present invention by those skilled in the art without departing from the spirit and essence of the invention, and such modifications or substitutions should all be within the scope of the present invention. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should also be covered within the protection scope of the present invention.

Claims

1. A fermentation broth, characterized in that, Obtained from Lactobacillus rhamnosus Q7 fermentation substrate; said Lactobacillus rhamnosus ( Lacticaseibacillus rhamnosus Q7 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 37563, deposited on January 28, 2026. The address of the depository is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The substrate comprises the following components in parts by weight: 12-16 parts of kudzu root, 14-18 parts of poria cocos, 10-14 parts of red adzuki bean, 8-11 parts of lotus leaf, 9-12 parts of polygonatum odoratum, and 20-30 parts of purified water.

2. The fermentation broth as described in claim 1, characterized in that, The substrate comprises the following components by weight: 14 parts kudzu root, 16 parts poria cocos, 12 parts red adzuki bean, 9 parts lotus leaf, 10 parts polygonatum odoratum, and 25 parts purified water.

3. A method for preparing the fermentation broth as described in claim 1, characterized in that, Includes the following steps: (1) After mixing the substrate, sterilize it under high pressure at 121℃ for 30 min, and then cool it to 30℃~40℃. (2) Inoculate Lactobacillus rhamnosus Q7 into MRS liquid medium for activation. The inoculation amount is 1%, and the culture is carried out at 37℃ for 18~30h to obtain seed culture solution. (3) Inoculate the seed culture medium into sterile raw materials at an inoculation amount of 1% and culture at 37°C for 20-48 hours to obtain fermentation broth.

4. The method as described in claim 3, characterized in that, The composition of the MRS liquid culture medium is as follows: peptone 10.0 g / L, beef extract 10.0 g / L, yeast extract 5.0 g / L, glucose 20.0 g / L, Tween 80 1.0 mL / L, dipotassium hydrogen sulfate heptahydrate 2.0 g / L, sodium acetate trihydrate 5.0 g / L, triammonium citrate 2.0 g / L, magnesium sulfate heptahydrate 0.1 g / L, and manganese sulfate tetrahydrate 0.05 g / L.

5. The method as described in claim 3, characterized in that, After obtaining the fermentation liquid in step (3), seasonings are added. The seasonings include the following components by weight: 1-3 parts honey and 1-3 parts apple concentrate.

6. The method as described in claim 3, characterized in that, The concentration of Lactobacillus rhamnosus Q7 in the fermentation broth is ≥1000 CFU / mL.

7. The application of the fermentation broth as described in claim 1 in the preparation of products that improve microcirculation.

8. The application of the fermentation broth as described in claim 1 in the preparation of dehumidifying products.

9. The use of the fermentation broth as described in claim 1 in the preparation of products that enhance metabolism.

Images