Use of a substance inhibiting uchl3 gene in the preparation of a drug for treating triple-negative breast cancer

By designing shRNAs that specifically reduce UCHL3 gene expression and inhibit the UCHL3/NONO/MAOA signaling regulatory axis, the problem of lacking effective therapeutic targets for triple-negative breast cancer was solved, achieving effective inhibition and treatment of TNBC.

CN122424201APending Publication Date: 2026-07-21HAINAN MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HAINAN MEDICAL UNIV
Filing Date
2026-05-20
Publication Date
2026-07-21

AI Technical Summary

Technical Problem

Current technologies lack effective therapeutic targets and strategies for triple-negative breast cancer, and UCHL3, as a potential key molecular target, has not yet been fully utilized.

Method used

By designing shRNAs that specifically reduce UCHL3 gene expression, and introducing them into TNBC cells using lentiviruses or plasmid vectors, the UCHL3/NONO/MAOA signaling regulatory axis is inhibited, thereby suppressing the occurrence and development of TNBC.

Benefits of technology

It effectively inhibits the growth, migration, and invasion of TNBC cells, delays the growth of breast tumors in animals, and provides a new therapeutic target for the treatment of triple-negative breast cancer, showing broad application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122424201A_ABST
    Figure CN122424201A_ABST
Patent Text Reader

Abstract

The present application belongs to the field of biotechnology, and particularly relates to application of a substance for inhibiting UCHL3 gene in preparation of a drug for treating triple-negative breast cancer. More particularly, the present application provides a shRNA for UCHL3 and its use in preventing and / or treating triple-negative breast cancer. Experimental results show that the shRNA for reducing the expression amount of UCHL3 gene can inhibit the growth of TNBC transplanted tumor, proving that UCHL3 can be used as a potential target for treating TNBC patients, and providing a new therapeutic target for treating triple-negative breast cancer, and having a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, and more specifically, this invention relates to the application of substances that inhibit the UCHL3 gene in the preparation of drugs for treating triple-negative breast cancer. Background Technology

[0002] Breast cancer is the most common malignant tumor among women and the second leading cause of cancer-related deaths worldwide. Published reports show that there were 287,850 new cases of breast cancer in 2022, with deaths accounting for 15% of new breast cancer cases. Among all breast cancer subtypes, triple-negative breast cancer (TNBC) accounts for approximately 15% to 20% of all breast cancer cases, and has the worst prognosis and overall survival (OS).

[0003] Transurethral necrotic neoplasia (TNBC) is highly heterogeneous, with negative expression of ER, PR, and HER2, thus lacking clear therapeutic targets. Patients cannot benefit from endocrine therapy or HER2-targeted therapy. Compared to other subtypes, TNBC exhibits low differentiation, high invasiveness, high relapse rate, and poor overall prognosis, posing a significant challenge to clinical treatment for a long time. Currently, treatment still relies on a combined surgical and chemotherapy regimen, and the survival prognosis for most patients is not ideal. Therefore, elucidating the molecular mechanisms of TNBC development and progression, and identifying new key molecular targets, is of significant theoretical and practical value for establishing more effective treatment strategies and improving the clinical outcomes of TNBC patients.

[0004] UCHL3, a key member of the ubiquitin C-terminal hydrolase family, is a functional enzyme with deubiquitination activity that plays a pro-cancer role in various tumors. Studies have confirmed that high expression of UCHL3 in tumor-associated neoplasia (TNBC) is associated with poor prognosis. Currently, there are no publicly reported drugs or compositions targeting UCHL3 for the treatment of TNBC, indicating a significant clinical need. Summary of the Invention

[0005] (a) Technical problems to be solved

[0006] To address the shortcomings of existing technologies, this invention aims to systematically reveal a previously unreported UCHL3 / NONO / MAOA signaling regulatory axis. UCHL3 stabilizes NONO through deubiquitination, thereby transcribedly activating MAOA and ultimately driving the malignant progression of TNBC. Targeting UCHL3 can effectively reverse the UCHL3 / NONO / MAOA signaling regulatory axis, thereby inhibiting the occurrence and development of TNBC. This patent not only provides a new theoretical perspective for understanding the pathogenesis of TNBC, but more importantly, it identifies UCHL3 as a novel therapeutic target with translational potential, laying a solid foundation for developing precise targeting strategies for TNBC. This addresses the current lack of effective therapeutic targets and strategies for triple-negative breast cancer.

[0007] (II) Technical Solution

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides the use of a substance that inhibits the expression of the UCHL3 gene in the preparation of a drug for treating triple-negative breast cancer.

[0010] Furthermore, the substance that inhibits UCHL3 gene expression is a substance that uses specific shRNA of the UCHL3 gene to reduce the expression level of the UCHL3 gene.

[0011] Furthermore, the substance that uses specific shRNA of the UCHL3 gene to reduce the expression level of the UCHL3 gene is an shRNA that can specifically reduce the expression level of the UCHL3 gene, or an expression cassette that can express the shRNA, or a recombinant vector containing the expression cassette, or a cell line containing the recombinant vector.

[0012] Further, the shRNA comprises:

[0013] sh-UCHL3#1, its sequence is: 5′-CCCTGATGAACTAAGATTTAA-3′;

[0014] sh-UCHL3#2, its sequence is: 5′-GTCTTACTTCTCTTTCCTATT-3′.

[0015] Furthermore, the vector is a viral vector or a plasmid, specifically a lentivirus, and the plasmid is the pLKO.1 puro vector and the pLVX-IRES-ZsGreen1-UCHL3 vector.

[0016] The cancer cell type of the triple-negative breast cancer is MDA-MB-231 or BT-549.

[0017] This invention also provides the application of the above-mentioned shRNA in the preparation of reagents for inhibiting NONO or MAOA gene expression. Specifically, by inhibiting UCHL3, the NONO / MAOA signaling axis can be downregulated, thereby exerting an anti-TNBC effect.

[0018] In the above applications, the treatment and / or prevention of triple-negative breast cancer can be manifested in reducing the viability of breast tumor cells and / or delaying the growth of breast tumors in animals. The animal can be a mammal, specifically a human or a mouse. In one embodiment of the invention, the mouse is a female immunodeficient mouse (BALB / c nude). The animal model involved is a tumor xenograft model.

[0019] (III) Beneficial Effects

[0020] The beneficial effects of this invention are:

[0021] This invention selects the UCHL3 gene as a target to design an shRNA that specifically reduces UCHL3 gene expression. Lowering UCHL3 expression through this shRNA inhibits the growth of TNBC xenografts, demonstrating that UCHL3 can serve as a potential therapeutic target for TNBC patients. Furthermore, UCHL3 exerts its oncogenic effect by stabilizing NONO protein and upregulating MAOA expression; its oncogenic function depends on the NONO / MAOA axis. Inhibiting UCHL3 can exert an anti-TNBC effect by downregulating the NONO / MAOA signaling axis, providing a new therapeutic target for triple-negative breast cancer treatment with broad application prospects. Attached Figure Description

[0022] Figure 1 To detect the expression level of UCHL3 in TNBC tissues and cell lines. (AB) Western blotting and RT-qPCR were used to detect the expression levels of UCHL3 protein and mRNA in TNBC tissues and adjacent normal tissues (6 pairs). (CD) Western blotting and RT-qPCR were used to analyze the expression levels of UCHL3 protein and mRNA in each TNBC cell line. (E) Immunohistochemical (IHC) analysis further confirmed that UCHL3 was significantly upregulated in TNBC tissues. All results were obtained through at least three independent experiments, where *** indicates p<0.001, and **** indicates p<0.0001.

[0023] Figure 2To verify the UCHL3 knockdown efficiency in TNBC in Example 1, (AB) Western blotting and RT-qPCR were used to detect the UCHL3 knockdown efficiency. Two shRNAs designed for UCHL3 (sh-UCHL3#1, sh-UCHL3#2) and an empty vector (pLKO.1) were transfected into MDA-MB-231 and BT-549 cells using lentiviral vectors. All results were verified through at least three independent experiments, where *** indicates p<0.001, and **** indicates p<0.0001.

[0024] Figure 3 In Example 1, the CCK-8 assay was used to examine the growth of MDA-MB-231-shUCHL3#1 and MDA-MB-231-shUCHL3#2, and BT-549-shUCHL3#1 and BT-549-shUCHL3#2, respectively. All assays were performed using at least three independent experiments, where ** indicates p < 0.01, *** p < 0.001, and **** p < 0.0001.

[0025] Figure 4 To verify in Example 1 that UCHL3 knockdown can inhibit the proliferation, migration, and invasion of TNBC, the following assays were performed: (A) Clonogenesis assay: Proliferation was detected in MDA-MB-231-shUCHL3#1 and MDA-MB-231-shUCHL3#2, and BT-549-shUCHL3#1 and BT-549-shUCHL3#2. Representative images are shown on the left, and quantitative analysis is shown on the right. (B) EdU assay: Proliferation was detected in MDA-MB-231-shUCHL3#1 and MDA-MB-231-shUCHL3#2, and BT-549-shUCHL3#1 and BT-549-shUCHL3#2. Representative images are shown on the left, and quantitative analysis of EdU-positive cells is shown on the right. (C) Scratch assays were performed to detect proliferation in MDA-MB-231-shUCHL3#1 and MDA-MB-231-shUCHL3#2, and BT-549-shUCHL3#1 and BT-549-shUCHL3#2, respectively. Representative images are shown on the left, and quantitative analysis is shown on the right. All results were obtained through at least three independent experiments, where ** indicates p < 0.01, *** p < 0.001, and **** p < 0.0001.

[0026] Figure 5In Example 1, the Transwell assay was used to detect the migration and invasion capabilities of MDA-MB-231-shUCHL3#1 and MDA-MB-231-shUCHL3#2, and BT-549-shUCHL3#1 and BT-549-shUCHL3#2, respectively. The left side shows representative images, and the right side shows the quantitative analysis. All results were obtained through at least three independent experiments, where ** indicates p < 0.01, *** p < 0.001, and **** p < 0.0001.

[0027] Figure 6 Example 1 verified that knockdown of UCHL3 reduced the tumorigenicity of TNBC in BALB / c nude mice. (A) MDA-MB-231 cells were stably transfected with lentiviral vectors containing empty vector (pLKO.1) or sh-UCHL3, and the transfected cells were subcutaneously injected into BALB / c nude mice. (B) Tumor volume was measured for the first time on day 10, and then every 5 days thereafter, and growth curves were plotted. (C) Tumor weight analysis. Data are expressed as mean ± standard deviation, n=5, where *** indicates p<0.001, and t-tests were used.

[0028] Figure 7 For the identification of UCHL3 interacting proteins in Example 2. (A) UCHL3 interacting proteins were identified using Co-IP / MS. (B) Mass spectrometry analysis shows the protein sequence list identified in MDA-MB-231 cells. (C) Mass spectrometry analysis shows the NONO peptide segment pulled down by the UCHL3 antibody in MDA-MB-231 cells.

[0029] Figure 8 To verify the interaction between UCHL3 and NONO in the immunoprecipitation experiment of Example 2, immunoprecipitation experiments were performed using anti-UCHL3 antibody and anti-NONO antibody, respectively, followed by immunoblotting analysis of the precipitated complexes.

[0030] Figure 9 To verify the significant upregulation of NONO expression in TNBC tissues in Example 2. Representative IHC images of NONO in TNBC tumor tissues and corresponding normal tissues are shown, with the immunohistochemical score on the right. ** indicates p < 0.01.

[0031] Figure 10 In Example 2, knocking down UCHL3 did not significantly change NONO mRNA expression levels (A), but significantly reduced protein expression levels (B). All results were obtained through at least three independent experiments, where ns indicates no statistical significance.

[0032] Figure 11In Example 2, knockdown of UCHL3 significantly enhanced NONO protein ubiquitination. Conversely, overexpression of UCHL3 had the opposite effect. The effect of UCHL3 knockdown (A) on NONO ubiquitination was examined by transfecting MDA-MB-231 and BT-549 cells with the specified construct. NONO ubiquitination experiments were performed with UCHL3 overexpression (B).

[0033] Figure 12 In Example 2, knockdown of UCHL3 under CHX treatment resulted in decreased NONO protein stability. sh-NC or sh-UCHL3 was transfected into MDA-MB-231 and BT-549 cells, and treated with CHX (50 μg / mL) 24 hours later. Immunoblot analysis was performed on the cells using anti-UCHL3 and anti-NONO antibodies. All results were obtained through at least three independent experiments, where * indicates p < 0.05.

[0034] Figure 13 To enhance NONO protein stability through UCHL3 overexpression as described in Example 2, empty vector or HA-UCHL3 plasmid was transfected into MDA-MB-231 and BT-549 cells. After 24 hours, cells were treated with CHX (50 μg / mL) for a specified time. Finally, Western blot analysis was performed using anti-UCHL3 and anti-NONO antibodies. All results were obtained through at least three independent experiments, where ** indicates p < 0.01.

[0035] Figure 14 For screening downstream target molecules of NONO in Example 2. (A) Venn diagram shows the candidate genes screened by intersecting the RNA-seq data of UCHL3 knockdown and the ChIP-seq data of NONO. (BC) After NONO knockdown, the mRNA and protein levels of MAOA were detected by RT-qPCR and WB. All results were obtained through at least three independent experiments, where * indicates p<0.05, **p<0.001, and ***p<0.001.

[0036] Figure 15 To investigate the effect of NONO overexpression on MAOA mRNA and protein expression levels in Example 2. (AB) After NONO overexpression, MAOA mRNA and protein levels were detected by RT-qPCR and WB. All results were obtained through at least three independent experiments, where **** indicates p < 0.0001.

[0037] Figure 16Example 2 investigated the binding ability of NONO to the MAOA promoter region and the effect of UCHL3 knockdown on its enrichment level. (A) NONO significantly enriched the MAOA promoter sequence; (B) UCHL3 knockdown inhibited the binding of NONO to the MAOA promoter. All results were obtained through at least three independent experiments, where ** indicates p < 0.01 and *** indicates p < 0.001.

[0038] Figure 17 Example 2 illustrates the dual-luciferase reporter gene assay used to analyze the regulation of MAOA promoter activity by NONO. (A) Dual-luciferase reporter gene assay to detect MAOA promoter activity and its regulation by NONO protein. (B) Dual-luciferase reporter gene assay to detect the effect of NONO on the activity of wild-type and mutant MAOA promoters. All assays were performed using at least three independent experiments, where ns indicates no statistical significance, **p<0.01, ***p<0.001.

[0039] Figure 18 To verify in Example 3 that NONO overexpression can reverse the changes in protein and mRNA levels induced by UCHL3 knockdown, the protein and mRNA expression levels of NONO and MAOA were detected by Western blotting (A) and RT-qPCR (B) after UCHL3 knockdown, NONO overexpression, and simultaneous UCHL3 knockdown and NONO overexpression. All results were obtained through at least three independent experiments, where **** indicates p < 0.0001.

[0040] Figure 19 To verify the effect of NONO overexpression on reversible UCHL3 knockdown on cell proliferation in Example 3, cell growth curves were detected in MDA-MB-231 and BT-549 cells after UCHL3 knockdown, NONO overexpression, and simultaneous UCHL3 knockdown and NONO overexpression, respectively, using a CCK-8 assay. All results were obtained through at least three independent experiments, where ** indicates p < 0.01.

[0041] Figure 20 To verify the effect of NONO overexpression on reversible UCHL3 knockdown on cell proliferation in Example 3, EdU assays were used to detect cell proliferation in MDA-MB-231 and BT-549 cells after UCHL3 knockdown, NONO overexpression, and simultaneous UCHL3 knockdown and NONO overexpression. The left side shows representative images, and the right side shows quantitative analysis of EdU-positive cells. All results were obtained through at least three independent experiments, where * indicates p < 0.05 and ** p < 0.01.

[0042] Figure 21To verify the effect of NONO overexpression on reversible UCHL3 knockdown on cell proliferation in Example 3, colony formation assays were performed to examine cell proliferation in MDA-MB-231 and BT-549 cells after UCHL3 knockdown, NONO overexpression, and simultaneous UCHL3 knockdown and NONO overexpression. The left side shows representative images, and the right side shows quantitative analysis. All results were obtained through at least three independent experiments, where * indicates p < 0.05 and ** p < 0.01.

[0043] Figure 22 To verify the effect of NONO overexpression and reversible UCHL3 knockdown on migration in Example 3, scratch assays were used to examine cell migration in MDA-MB-231(A) and BT-549(B) cells after UCHL3 knockdown, NONO overexpression, and simultaneous UCHL3 knockdown and NONO overexpression. The left side shows representative images, and the right side shows quantitative analysis. All results were obtained through at least three independent experiments, where * indicates p < 0.05.

[0044] Figure 23 To verify the effect of NONO overexpression on reversible UCHL3 knockdown on migration and invasion in Example 3, Transwell assays were used to examine the migration and invasion abilities of MDA-MB-231(A) and BT-549(B) cells after UCHL3 knockdown, NONO overexpression, and simultaneous UCHL3 knockdown and NONO overexpression. The left side shows representative images, and the right side shows quantitative analysis. All results were obtained through at least three independent experiments, where ** indicates p < 0.01, *** p < 0.001, and **** p < 0.0001.

[0045] Figure 24 To investigate the effect of NONO overexpression and reversible knockdown of UCHL3 on tumor proliferation in mice in Example 3. (A) MDA-MB-231 cells were stably transfected with lentiviral vectors containing empty vector, sh-UCHL3, NONO, and sh-UCHL3+NONO, respectively. The transfected cells were then subcutaneously injected into BALB / c nude mice. (B) Tumor volume was measured for the first time on day 10, and then every 5 days thereafter, and growth curves were plotted. (C) Tumor weight analysis. Data are expressed as mean ± standard deviation, n=5, ** indicates P<0.01, ***P<0.001, and t-test was used. Detailed Implementation

[0046] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0047] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0048] In this invention, UCHL3 is the protein encoded by the UCHL3 gene (NCBI ID: 7347, updated November 25, 2025).

[0049] In this invention, sh-UCHL3#1 and UCHL3-shRNA#1 are different representations of the same shRNA sequence, and sh-UCHL3#2 and UCHL3-shRNA#2 are also different representations of the same shRNA sequence.

[0050] In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5′ terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA / RNA.

[0051] The MDA-MB-231 and BT-549 in the following examples are described in the literature Targeting PSMD14 combined with arachidonic acid induces synthetic lethality via FADS1 m6A modification in triple-negative breast cancer (Figure 1 on page 9), which is available to the public from the applicant. These biological materials are only used to replicate the relevant experiments of this invention and should not be used for other purposes. MDA-MB-231 and BT-549 are tumor cells isolated from tumor tissues of different TNBC breast cancer patients, and they also possess the ability to self-renew, proliferate indefinitely, and induce tumorigenesis.

[0052] sh-UCHL3#1, sh-UCHL3#2, and plasmids overexpressing UCHL3 and NONO were all synthesized by GenePharma (China).

[0053] UCHL3 (12384-1-AP, 1:1000, Proteintech),

[0054] NONO (A11344, 1:1000, ABclonal),

[0055] MAOA (A11597, 1:1000, ABclonal),

[0056] β-actin (8457S, 1:1000, CST),

[0057] Ki67 (27309-1-AP, 1:200, Proteintech).

[0058] Secondary antibodies: Rabbit secondary antibody AffiniPure Goat Anti-Rabbit IgG (H+L), Jackson Immuno Research (catalog number 111-005-003); Mouse secondary antibody AffiniPure Goat Anti-Mouse IgG (H+L), Jackson Immuno Research (catalog number 115-005-003).

[0059] Proteasome inhibitor (MG132M7449, Sigma-Aldrich), silver staining kit (P0017S, Beyotime).

[0060] Example 1: Knocking down UCHL3 gene expression can inhibit TNBC progression.

[0061] (a) Detection of UCHL3 expression in TNBC

[0062] (1) Collect cancer and adjacent normal specimens from 6 pairs of TNBC patients

[0063] (2) Western blot analysis was performed to detect the expression level of UCHL3 in cancer and adjacent normal specimens from TNBC patients. Figure 1 -A),

[0064] The primary antibodies used were UCHL3 antibody and β-actin antibody, and the secondary antibody was AffiniPure Goat Anti-Rabbit (or Anti-Mouse) IgG (H+L).

[0065] (3) RT-qPCR assay was used to detect the expression level of UCHL3 in cancer and adjacent normal specimens from TNBC patients. Figure 1 -B)

[0066] (4) Western blot analysis was used to detect the expression level of UCHL3 in TNBC cells. Figure 1 -C), the primary antibodies used were UCHL3 antibody (12384-1-AP, 1:1000, Proteintech) and β-actin antibody (8457S, 1:1000, CST), and the secondary antibody was AffiniPure Goat Anti-Rabbit (or Anti-Mouse) IgG (H+L).

[0067] (5) RT-qPCR assay was used to detect the expression level of UCHL3 in TNBC cells. Figure 1 -D)

[0068] (6) IHC detection of UCHL3 expression levels in cancer and adjacent normal specimens from TNBC patients ( Figure 1 -E).

[0069] (ii) UCHL3 gene knockdown

[0070] The UCHL3 gene was knocked down using pLKO.1 puro-shUCHL3. This knockdown was induced in MDA-MB-231 and BT-549 cells, respectively. The specific steps are as follows:

[0071] (1) Constructing the pLKO.1 puro-shUCHL3 plasmid

[0072] 1) Design and synthesis of UCHL3 shRNA primer sequences: Based on the shRNA sequences provided by the Public TRC Portal and Sigma website, specific UCHL3 shRNA interference sequences targeting the UCHL3 gene and validated for the pLKO.1-puro (Addgene, catalog number #21915) vector were selected. The designed UCHL3 shRNA sequences were sent to Invitrogen for synthesis. The primer sequences are shown in Table 1.

[0073] Table 1. UCHL3 shRNA primer sequences

[0074] sh-UCHL3#1 CCCTGATGAACTAAGATTTAA sh-UCHL3#2 GTCTTACTTCTCTTTCCTATT

[0075] 2) Annealing of UCHL3 shRNA primers: The synthesized primers were diluted with water to a final concentration of 10 μmol / L, and then annealed. The annealing system is shown in Table 2.

[0076] Table 2. UCHL3 shRNA annealing system

[0077] Element Volume / μL upstream primer F 5 Downstream primer R 5 0.5 mol / L NaCl 6 <![CDATA[dd H2O]]> 24 Total volume 40

[0078] The mixed annealing system was heated in a 95°C water bath for 10 minutes, then the water bath was turned off and the temperature was allowed to slowly drop to room temperature. The annealed product was stored in a refrigerator at 4°C.

[0079] 3) Digestion of the pLKO.1-puro empty vector. The pLKO.1-puro vector backbone was obtained by double digestion with EcoRI and Age I.

[0080] 4) Ligation. The pLKO.1-puro vector skeleton obtained in step (3) and the three sets of annealed products obtained in step (2) are ligated. The recombinant vectors with the correct sequences are recorded as pLKO.1 puro-shUCHL3#1 and pLKO.1 puro-shUCHL3#2.

[0081] (2) Virus packaging

[0082] 24 h in advance, 1.5 × 10⁵ HEK-293T cells were seeded in 10 cm culture dishes. Lentiviral packaging plasmids psPAX2 (5 μg) and pCI-VSVG (5 μg), along with two successfully constructed pLKO.1 puro-shUCHL3 plasmids, were transfected into HEK-293T cells using the calcium phosphate transfection method. The cells were then incubated in an incubator, and fluorescence was observed after approximately 48 h. Based on the fluorescence, the viral supernatant was collected in a biosafety cabinet, centrifuged at 3000 rpm for 3 min, and filtered through a 0.45 μm filter. The filtered viruses (labeled sh-UCHL3#1 and sh-UCHL3#2, respectively, and the control group as shNC virus) were collected and stored at -80℃.

[0083] (3) Verify the knockdown / knockout effect after infection and screening.

[0084] For six-well plate preparation, stably transfected TNBC (MDA-MB-231 or BT-549) should be seeded and incubated for 24 h. Add 1 ml of the appropriate virus suspension and 1 μL of polybrene to each well and incubate. After 24 h, change the medium and incubate again. Observe daily under a fluorescence microscope (generally noticeable after 48 h). Select cells using puromycin (1:1000) based on fluorescence activity. Continuous culture, continuous drug screening, and routine digestion and passage are performed until a stable transfected cell line is obtained (verified by RT-qPCR and Western blot at the mRNA and protein levels).

[0085] The transfected cells were designated as MDA-MB-231-shUCHL3#1 and BT-549-shUCHL3#1, MDA-MB-231-shUCHL3#2 and BT-549-shUCHL3#2, while the control group cells were designated as MDA-MB-231-shNC and BT-549-shNC. Western blotting was used to detect the expression levels of UCHL3 in MDA-MB-231-shUCHL3#1, BT-549-shUCHL3#1, MDA-MB-231-shUCHL3#2, BT-549-shUCHL3#2, and MB-231-shNC and BT-549-shNC, respectively. Figure 2 -A), the experimental results showed that the expression level of UCHL3 in MDA-MB-231-shUCHL3#1, BT-549-shUCHL3#1, MDA-MB-231-shUCHL3#2, and BT-549-shUCHL3#2 was significantly lower than that in MB-231-shNC and BT-549-shNC. The primary antibodies used were UCHL3 antibody and β-actin antibody, and the secondary antibody was AffiniPure Goat Anti-Rabbit (or Anti-Mouse) IgG (H+L).

[0086] RT-qPCR was used to detect the expression levels of UCHL3 in MDA-MB-231-shUCHL3#1 and BT-549-shUCHL3#1, MDA-MB-231-shUCHL3#2 and BT-549-shUCHL3#2, as well as in MB-231-shNC and BT-549-shNC. Figure 2 -B)

[0087] After knocking down UCHL3, the results were obtained through CCK-8 experiments ( Figure 3 ), settlement formation experiment ( Figure 4 -A) and EdU experiment ( Figure 4 -B) The effect on cell proliferation and colony formation was assessed. Results showed that, compared to the control group, UCHL3 knockdown significantly inhibited the proliferation and colony formation of TNBC cells. Scratch assay ( Figure 4 -C) and Transwell experiment ( Figure 5 Further, it was shown that knockdown of UCHL3 significantly reduced the migration and invasion capabilities of TNBC cells.

[0088] (III) In vivo UCHL3 gene knockdown therapy for TNBC

[0089] Female immunodeficient mice: Balb / c nude (Beijing Vital River Laboratory Animal Technology Co., Ltd.), 4 weeks old, weighing 150-170 grams.

[0090] (1) Tumor xenotransplantation model

[0091] Ten mice were randomly divided into two groups: ① sh-NC group: MDA-MB-231 cells (1×10⁻⁶) infected with sh-NC lentivirus were used. 7 ① Subcutaneous injection into nude mice. ② sh-UCHL3 group: MDA-MB-231 cells (1×10⁻⁶) infected with sh-UCHL3 lentivirus were injected subcutaneously into nude mice. 7 The tumor was subcutaneously injected into nude mice. After treatment according to the above grouping, the tumor volume was measured for the first time on day 10, and then measured every 5 days thereafter, and a growth curve was plotted. The subcutaneous tumor volume was calculated using the formula: (length × width) 2 After 2.5 weeks, the mice were euthanized, the tumors were removed, and the mice were weighed.

[0092] (2) Results Analysis

[0093] Analysis of the results in (1) revealed that, compared to subcutaneous tumors of MDA-MB-231 cells infected with sh-NC lentivirus, subcutaneous tumors of MDA-MB-231 cells infected with sh-UCHL3 lentivirus showed a significant reduction in tumor volume and weight at 5 weeks. Figure 6 ).

[0094] The above results suggest that downregulation of UCHL3 expression inhibits TNBC cell growth, while overexpression of UCHL3 inhibits TNBC cell growth. UCHL3 may be a potential target for the treatment of TNBC patients.

[0095] Example 2: UCHL3 enhances NONO protein stability through deubiquitination modification, and NONO transcriptionally activates MAOA expression levels.

[0096] (a) Screening of UCHL3 interacting proteins using co-immunoprecipitation-mass spectrometry (Co-IP / MS) Figure 7 -A). Mass spectrometry peptide identification results showed that among the identified interacting proteins, the most reliable candidate molecule was NONO protein (-A). Figure 7 -B, C). Subsequently, Co-IP experiments verified the binding between UCHL3 and NONO (…B, C). Figure 8 Immunohistochemistry ( Figure 9 The results showed high expression of NONO in TNBC tissues. These results suggest that UCHL3 may influence TNBC progression through its interaction with NONO.

[0097] (II) Knockdown of UCHL3 significantly reduced NONO expression. RT-qPCR was used to detect the expression levels of NONO mRNA and protein in MDA-MB-231-shUCHL3#1, BT-549-shUCHL3#1, MDA-MB-231-shUCHL3#2, BT-549-shUCHL3#2, and MB-231-shNC and BT-549-shNC. No significant change was observed in mRNA expression levels. Figure 10 -A), while protein expression levels were significantly reduced ( Figure 10 -B).

[0098] (iii) UCHL3 regulates MAOA expression by stabilizing NONO protein.

[0099] (1) Co-IP experiment

[0100] Sample lysis: Wash samples (MDA-MB-231 and BT-549 breast cancer cells) three times with pre-cooled PBS buffer. Add protease inhibitor (100:1) to IP lysis buffer before use and lyse on ice for 30 min.

[0101] Cell collection and centrifugation: Use a 200 μl pipette tip to scrape off cells (scrape horizontally first, then obliquely, and collect them at the bottom), collect the cells into a 1.5 mL EP tube, and centrifuge in a low-temperature centrifuge (4℃, 12000 rpm) for 15 min.

[0102] Supernatant preparation and aliquoting: Aspirate the supernatant into a new 1.5 mL EP tube (allocate the supernatant to the Input group: IgG group: IP group in a ratio of 1:4.5:4.5).

[0103] Input sample preparation: Add 5*loading buffer:loading buffer:protein supernatant = 4:1 to the input group, boil at 95℃ for 5 min and then store at -20℃.

[0104] Immunoprecipitation reaction: 1.5 μg of IgG antibody and 1.5 μg of IP antibody were added to the tubes labeled IgG and IP, respectively. After sealing with sealing glue, the tubes were incubated overnight at 4°C on a shaker.

[0105] Magnetic bead capture and binding: The next day, prepare two new 1.5 mL EP tubes, add 1 mL PBS and 20 μl magnetic beads to each tube, shake well and place on a magnetic rack, remove the PBS washing solution, repeat twice, and then add the overnight antigen-antibody complex to the corresponding labeled EP tube, mix well and place in a shaker at 4°C for 4 h.

[0106] Magnetic bead washing and elution: After washing the magnetic beads 3-6 times using the above method, remove the supernatant, add 20 μl of 2× loading buffer, boil at 95℃ for 5 min, and then store at -20℃ for subsequent Western blot experiments.

[0107] (2) MG132+CHX treatment experiment:

[0108] ① MDA-MB-231 and BT-549 cells were transfected with the specified plasmid (with or without the proteasome inhibitor MG132, dosage: 20 μM, treatment time: 8 hours), and then Western blot analysis was performed on UCHL3 and NONO cells.

[0109] ② Transfect sh-NC or sh-UCHL3 into MDA-MB-231 and BT-549 cells, and treat with CHX (50 μg / mL) 24 hours later. Then perform Western blot analysis on the cells using anti-UCHL3 and anti-NONO antibodies.

[0110] Screening and validation of candidate target genes: To investigate the specific regulatory role of NONO in TNBC, RNA-seq analysis was performed in UCHL3 knockdown cells, and combined with NONO ChIP-seq data, 23 genes were screened by Venn diagram intersection. Finally, the top 5 candidate genes were selected. After knocking down NONO in MDA-MB-231 and BT-549 cells, the changes in mRNA and protein levels of the candidate genes were detected by RT-qPCR and WB experiments.

[0111] NONO shRNA primer sequence:

[0112] Primers Nucleotide sequence (5'–3') NONO-shRNA#1 CAGGCGAAGTCTTCATTCATA NONO-shRNA#2 GCAGGCGAAGTCTTCATTCAT

[0113] (3) Chromatin immunoprecipitation (ChIP): NONO directly binds to the MAOA promoter and activates its transcription.

[0114] Cell preparation: MDA-MB-231 and BT-549 cells were passaged and seeded in 10 cm⁻¹ cells. 2The cells were cultured in dishes until confluenced, at which point the original culture medium was removed. Formaldehyde solution was added to the cell samples to a final concentration of 1%. The samples were incubated at 37°C for 10 min to achieve protein cross-linking and fixation. Subsequently, glycine solution was added to a final concentration of 125 mmol / L, and the samples were allowed to stand at room temperature for 5 min to quench the activity of residual formaldehyde.

[0115] Cell lysis: Discard the culture medium from the culture dish and gently wash the cells three times with pre-chilled PBS to remove residual serum and culture medium components. Centrifuge at 4°C, 2000 rpm for 5 min. Carefully discard the supernatant, add an appropriate amount of pre-chilled IP lysis buffer to the cell pellet, and lyse on ice for 30 min, gently vortexing occasionally. Subsequently, sonicate the lysate under ice bath conditions.

[0116] Purification: The mixed lysis buffer was centrifuged at 12,000 rpm for 10 min at 4°C, and the supernatant was carefully aspirated. 50 μl of the supernatant was used as Input 1, and 5× protein loading buffer was added. After boiling, it was used for Western blot to verify the presence of the target protein in the sample. Another 50 μl of the supernatant was used as Input 2, and proteinase K and NaCl were added. The mixture was incubated overnight at 55°C with shaking for subsequent DNA purification. The next day, the DNA concentration of Input 2 was measured, and the DNA fragment size and sonication efficiency were assessed by agarose gel electrophoresis. After confirming the Input results, 100 μl of the remaining supernatant was taken, and 20 μl of proteinase inhibitor, 60 μl of pre-blocked Protein A / G Agarose-Salmon Sperm DNA slurry, and 900 μl of ChIP dilution buffer were added sequentially. The mixture was incubated at 4°C for 1 h for pre-cleaning to remove non-specific bindings. After standing for 10 minutes, centrifuge at 4°C and 5000 rpm for 5 minutes, and collect the supernatant for subsequent specific antibody immunoprecipitation.

[0117] Antibody incubation: Aliquot the pre-cleaned supernatant into two new centrifuge tubes. Add 1 μg of specific IP antibody against the target protein to one tube and add an equal amount of control IgG from the same species to the other tube. Seal the tubes with sealing film and incubate overnight in a 4°C cooler or on a centrifuge with gentle inversion.

[0118] Precipitation washing: Add 200 μl of pre-blocked Protein A / G Agarose-Salmon Sperm DNA slurry to each centrifuge tube containing the antibody-chromatin complex, and incubate gently at 4°C for 2 h to allow the beads to fully capture the immune complex. Then centrifuge at 4°C, 4000 rpm for 1 min and carefully discard the supernatant. Next, wash the beads and complex sequentially with a series of wash buffers. After washing, add 200 μl of freshly prepared ChIP elution buffer to each bead pellet, followed by 8 μl of NaCl and 20 μl of proteinase K. Vortex gently to mix, and incubate overnight at 55°C with shaking.

[0119] Sample recovery: Add 200 μl of genomic DNA binding buffer to the tube containing the DNA fragment, vortex to mix, and incubate at 70°C for 10 min. Then add 200 μl of anhydrous ethanol and vortex vigorously for 15 s to ensure thorough mixing and a homogeneous phase. Immediately transfer the entire mixture to a DNA purification adsorption column (placed in a collection tube) and centrifuge at 12000 rpm for 30 s at 4°C. Add 500 μl of desalting solution (GD buffer), 700 μl of wash buffer (PW buffer), and 500 μl of wash buffer (PW buffer) sequentially to the adsorption column, centrifuging at 12000 rpm for 30 s after each addition, and discarding the waste liquid in the collection tube to gradually remove impurities, salts, and residual ethanol. Place the adsorption column back into the collection tube and centrifuge at 12000 rpm for 2 min at room temperature to completely remove residual wash solution. Discard the collection tube and leave the adsorption column uncapped in a well-ventilated area at room temperature for 10 minutes to allow the adsorption membrane to dry completely, facilitating efficient DNA elution. Place the dried adsorption column into a new 1.5 mL nuclease-free centrifuge tube, and add 50 μl of preheated TE elution buffer (65°C) to the center of the adsorption membrane. Incubate at room temperature for 5 minutes to allow the buffer to fully wet the membrane. Then centrifuge at 12,000 rpm for 2 minutes at room temperature. Repeat this step and transfer the solution to a centrifuge tube. Finally, analyze the precipitated DNA using RT-PCR.

[0120] (4) Dual-luciferase experiment:

[0121] HEK-293T cells were co-transfected with the MAOA promoter luciferase reporter plasmid and the NONO overexpression plasmid. The culture medium was discarded 24 h after transfection, and the cells were washed three times with PBS.

[0122] Discard the PBS, add 50 μl of 1×PLB to each well, and vortex.

[0123] Add 10 μl of cell lysis supernatant to each well of a 96-well microplate, followed by 30 μl of luciferase assay reagent II (LARII). Gently pipette and mix several times. After standing for 2 seconds, immediately detect the luciferase activity using a fluorescence / chemiluminescence microplate reader and record the relative light units (RLU) reading for each well.

[0124] Subsequently, an equal volume of Stop & Glo reagent was added to each well, gently mixed, and allowed to stand for 2 seconds. The activity was then detected again using a microplate reader, and the relative light unit reading (RLU2) of the *Rhizophora stylosa* luciferase activity was recorded. Finally, the activity of the firefly luciferase reporter gene was normalized by calculating the ratio of RLU1 to RLU2.

[0125] (5) Results Analysis:

[0126] Analysis of the results in (1) revealed that knockdown of UCHL3 significantly enhanced NONO ubiquitination levels. Figure 11 ).

[0127] Analysis of the results in (2) revealed that silencing UCHL3 could induce NONO degradation via the ubiquitination-proteasome pathway, significantly shortening the half-life of NONO protein, while UCHL3 overexpression enhanced the protein stability of NONO. Figure 12 , 13 ).

[0128] Analysis of the results in (3) revealed that RNA-seq analysis was performed in UCHL3 knockdown cells, and combined with NONO's ChIP-seq data, 23 genes were screened out by Venn diagram intersection. Figure 14 -A), and finally select the top 5 candidate genes ( Figure 14 In MDA-MB-231 and BT-549 cells, NONO was knocked down (-B). RT-qPCR and Western blotting were used to detect changes in the mRNA and protein levels of candidate genes. The results showed that the mRNA and protein levels of MAOA were most significantly downregulated with NONO knockdown. Overexpression of UCHL3 yielded the opposite results. Figure 14 -C). UCHL3 was knocked down in MDA-MB-231 and BT-549 cells, and the result was obtained using RT-qPCR ( Figure 15 -A) and WB experiment ( Figure 15 -B) Detection of changes in candidate gene mRNA and protein levels revealed that MAOA mRNA and protein levels were most significantly downregulated with UCHL3 knockdown. Overexpression of UCHL3 yielded the opposite result.

[0129] Analysis of the results in (4) revealed that NONO significantly enriches the MAOA promoter sequence ( Figure 16 -A), and UCHL3 knockdown can inhibit the binding of NONO to the MAOA promoter ( Figure 16 -B).

[0130] Analysis of the results in (5) revealed that the dual-luciferase reporter gene assay showed that NONO significantly enhanced the transcriptional activity of the MAOA promoter. Figure 17 -A), but has no significant activating effect on the MAOA promoter with a mutated binding site ( Figure 17 -B).

[0131] The above results suggest that UCHL3 regulates MAOA expression by stabilizing NONO protein.

[0132] Example 3: The cancer-promoting effect of UCHL3 depends on the NONO / MAOA axis

[0133] 3.1 Rescue Experiment

[0134] (1) Cell preparation: In the MDA-MB-231 cell line, the following four groups were set up: ① Negative control (shNC+Vector): stably transfected using a lentiviral vector containing an empty vector. ② UCHL3 knockdown group (shUCHL3): MDA-MB-231 cells were knocked down using pLKO.1puro-shUCHL3. ③ Downstream target NONO overexpression group (NONO): stably transfected using a lentiviral vector containing NONO. ④ UCHL3 knockdown combined with NONO overexpression group (shUCHL3+NONO): stably transfected using a lentiviral vector containing sh-UCHL3+NONO.

[0135] (2) Western blot of four groups of cells ( Figure 16 -A) and RT-qPCR ( Figure 16 -B) The test results showed that overexpression of NONO under UCHL3 knockdown conditions could significantly restore the protein and mRNA expression levels of MAOA.

[0136] (3) In vitro functional experiments showed that overexpression of NONO could reverse the inhibition of proliferation, migration, and invasion caused by UCHL3 knockdown. Figure 19-23 ).

[0137] 3.2 In vivo experiments confirmed that NONO mediates the cancer-promoting effect of UCHL3.

[0138] Tumor xenotransplantation model:

[0139] Female immunodeficient mice: Balb / c nude (Beijing Vital River Laboratory Animal Technology Co., Ltd.), 4 weeks old, weighing 150-170 grams.

[0140] Twenty mice were randomly divided into four groups, and the cells from step 3.1 (1×10⁻⁶) were... 7 Subcutaneous injection into nude mice:

[0141] ① Negative control (shNC+Vector): The transfected cells were stably transfected into BALB / c nude mice using an empty lentiviral vector.

[0142] ②UCHL3 knockdown group (shUCHL3): The transfected cells were stably transfected into BALB / c nude mice using a lentiviral vector containing sh-UCHL3.

[0143] ③ Downstream target NONO overexpression group (NONO): The transfected cells were stably transfected using a lentiviral vector containing NONO and then subcutaneously injected into BALB / c nude mice.

[0144] ④ UCHL3 knockdown combined with NONO overexpression group (shUCHL3+NONO): The transfected cells were stably transfected using a lentiviral vector containing sh-UCHL3+NONO and then subcutaneously injected into BALB / c nude mice.

[0145] Tumor volume was measured for the first time on day 10, and then every 5 days thereafter, and growth curves were plotted. Tumor weight analysis ( Figure 24 ).

[0146] In vivo tumorigenesis experiments showed that overexpression of NONO could partially rescue tumor growth inhibition caused by UCHL3 knockdown, demonstrating that UCHL3 promotes TNBC progression through the NONO / MAOA axis.

[0147] The experimental data in the above examples demonstrate that shRNA that reduces UCHL3 gene expression can inhibit the growth of TNBC xenografts, proving that UCHL3 can serve as a potential therapeutic target for TNBC patients. UCHL3 exerts its oncogenic effect by stabilizing NONO protein and upregulating MAOA expression; its oncogenic function depends on the NONO / MAOA axis. Inhibiting UCHL3 can exert an anti-TNBC effect by downregulating the NONO / MAOA signaling axis, providing a new therapeutic target for the treatment of triple-negative breast cancer and showing broad application prospects.

[0148] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some basic features can be applied within the scope of the following appended claims.

[0149] Finally, it should be noted that the above embodiments are only for illustrating the present invention and not for limiting the scope of protection of the present invention. Furthermore, after reading the technical content of this invention, those skilled in the art can make various modifications, alterations, or variations to the present invention, and all such equivalent forms also fall within the scope of protection claimed in this application.

Claims

1. Application of substances that inhibit UCHL3 gene expression in the preparation of drugs for treating triple-negative breast cancer.

2. The application according to claim 1, characterized in that, The substance that inhibits UCHL3 gene expression is a substance that uses specific shRNA of the UCHL3 gene to reduce the expression level of the UCHL3 gene.

3. The application according to claim 2, characterized in that, The substance that uses a specific shRNA of the UCHL3 gene to reduce the expression level of the UCHL3 gene is an shRNA that can specifically reduce the expression level of the UCHL3 gene, or an expression cassette that can express the shRNA, or a recombinant vector containing the expression cassette, or a cell line containing the recombinant vector.

4. The application according to claim 3, characterized in that, The shRNA includes: sh-UCHL3#1, whose sequence is: 5′-CCCTGATGAACTAAGATTTAA-3′; sh-UCHL3#2, its sequence is: 5′-GTCTTACTTCTCTTTCCTATT-3′.

5. The application according to claim 3, characterized in that, The vector is a viral vector or a plasmid, specifically a lentivirus, and the plasmid is the pLKO.1 puro vector and the pLVX-IRES-ZsGreen1-UCHL3 vector.

6. The application according to claim 1, characterized in that, The cancer cell type of the triple-negative breast cancer is MDA-MB-231 or BT-549.

7. The use of the shRNA according to claim 4 in the preparation of reagents for inhibiting NONO or MAOA gene expression.