Marker nfatc2 for lumbar intervertebral disc aging and protrusion and application thereof in treating lumbar intervertebral disc aging and protrusion
By reducing or inhibiting the NFAT1 protein or knocking out the NFATC2 gene, the lack of research on morphological and molecular changes in the aging and protrusion of the intervertebral disc has been addressed, the self-renewal capacity of the nucleus pulposus precursor cells has been enhanced, and a new treatment strategy has been provided.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF ZOOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2026-01-19
- Publication Date
- 2026-07-21
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine, specifically relating to markers of lumbar disc aging and herniation. NFATC2 Its application in the treatment of lumbar disc aging and herniation. Background Technology
[0002] The intervertebral disc, also known as the lumbar intervertebral disc, primarily manifests as lower back pain, radiating pain in the lower limbs, numbness, and weakness. A common condition is lumbar disc herniation, which is often caused by strain and degeneration in the lumbar region, leading to the protrusion of the nucleus pulposus and compression of surrounding nerve tissue. Lower back pain is a disease with a high disability rate, significantly impacting quality of life and creating a severe socioeconomic and medical burden. Lumbar disc aging and herniation are closely related to the occurrence of lower back pain. During the aging process of the intervertebral discs, morphological and functional degeneration often accompanies other diseases, such as lumbar disc herniation, which greatly affects quality of life and causes a heavy economic burden. Although researchers have observed changes such as extracellular matrix degradation and increased inflammation during lumbar disc degeneration, and extensive research has been conducted on how to intervene in lumbar disc degeneration... However, current research on lumbar disc degeneration often follows Pfirrmann's classification of the degree of degeneration, which fails to distinguish the morphological changes of disc aging and herniation, and even less considers the molecular and cellular changes in these two processes. Therefore, comparing the similarities and differences in morphological and molecular changes occurring during aging and disc herniation is crucial for identifying more effective intervention targets.
[0003] The human intervertebral disc consists of three parts from the inside out: the nucleus pulposus, the annulus fibrosus, and the cartilaginous endplate. The nucleus pulposus, rich in water and containing abundant extracellular matrix and various important cell types, plays a crucial functional role, including nucleus pulposus progenitor cells, which are vital for tissue self-renewal and damage repair. While numerous studies have explored the molecular mechanisms of intervertebral disc herniation and degeneration, these studies have not compared the changes and differences between aging and herniation processes, nor have they investigated how different cell types (such as nucleus pulposus progenitor cells and nucleus pulposus cells) are affected by aging and disease in human intervertebral disc tissue, or whether there are common dominant regulatory pathways. These questions remain to be further investigated.
[0004] Because the response of lumbar disc nucleus pulposus cells to age-related stresses is highly heterogeneous, plastic, and dynamic, single-cell resolution studies hold promise for revealing the complex physiological and pathological changes during aging and disc herniation. While rapidly developing single-cell nuclear RNA sequencing (snRNA-seq) technology has become a powerful tool for studying the transcriptome of human lumbar disc nucleus pulposus, to date, the limited number of published papers have primarily focused on developmental stages or degenerated discs according to the Pfirrmann classification. Furthermore, most single-cell studies have focused on identifying different cell populations and related functions, without identifying potential downstream intervention targets. This has resulted in a lack of systematic mapping of the molecular atlas of human lumbar disc aging and herniation. Summary of the Invention
[0005] The technical problem to be solved by this invention is how to treat lumbar disc aging and herniation.
[0006] To solve the above-mentioned technical problems, the present invention first provides any of the following applications: A1) The application of substances that reduce the content and / or activity of NFAT1 protein in delaying or assisting in delaying aging; A2) The application of substances that reduce the content and / or activity of NFAT1 protein in the preparation of products that delay or assist in delaying aging; A3) Inhibition NFATC2 Gene expression or knockout NFATC2 The application of genetic material in delaying or assisting in delaying aging; A4) Inhibition NFATC2 Gene expression or knockout NFATC2 The application of genetic material in the preparation of products that delay or assist in delaying aging.
[0007] In the above applications, the delay in aging can refer to delaying the aging of the body, tissues, or cells; Alternatively, the tissue or cells may be intervertebral disc tissue or cells.
[0008] Specifically, the intervertebral disc tissue may be nucleus pulposus tissue. The intervertebral disc cells may be nucleus pulposus cells, such as nucleus pulposus precursor cells.
[0009] This invention also provides any of the following applications: B1) The use of substances that reduce the content and / or activity of NFAT1 protein in the treatment or adjuvant treatment of intervertebral disc herniation; B2) The use of substances that reduce the content and / or activity of NFAT1 protein in the preparation of products for the treatment or adjunctive treatment of intervertebral disc herniation; B3) Inhibition NFATC2 Gene expression or knockout NFATC2The application of genetic material in the treatment or adjuvant treatment of intervertebral disc herniation; B4) Inhibition NFATC2 Gene expression or knockout NFATC2 The application of genetic material in the preparation of products for the treatment or adjuvant treatment of intervertebral disc herniation; B5) The use of substances that reduce NFAT1 protein content and / or activity in the treatment or adjuvant treatment of intervertebral disc degeneration; B6) The use of substances that reduce the content and / or activity of NFAT1 protein in the preparation of products for the treatment or adjuvant treatment of intervertebral disc degeneration; B7) Inhibition NFATC2 Gene expression or knockout NFATC2 The application of genetic material in the treatment or adjuvant treatment of intervertebral disc degeneration; B8) Inhibition NFATC2 Gene expression or knockout NFATC2 The application of genetic material in the preparation of products for the treatment or adjuvant treatment of intervertebral disc degeneration.
[0010] In the above applications, the intervertebral disc may be a lumbar intervertebral disc.
[0011] The present invention also provides a product containing (or having an active ingredient thereof) a substance that reduces the content and / or activity of NFAT1 protein, or inhibits... NFATC2 Gene expression or knockout NFATC2 Genetic material.
[0012] The above products can be used to delay aging (such as intervertebral disc aging), or to treat intervertebral disc herniation, or to treat intervertebral disc degeneration.
[0013] In the above text, the substance that reduces the content and / or activity of NFAT1 protein can be a substance that specifically recognizes NFAT1 protein, such as an NFAT1 antibody. The inhibition... NFATC2 Gene expression or knockout NFATC2 Genetic material can be reduced using methods such as RNA interference (RNAi). NFATC2 Specific recognition used for gene expression NFATC2 Gene reagents, such as specific binding NFATC2 Small RNAs of genes or their mRNAs can also be used to... NFATC2 Gene-edited substances (such as specific recognition) NFATC2 (The sgRNA of the gene). NFATC2 Gene editing can be performed using the CRISPR / Cas9 system.
[0014] The present invention also provides any of the following applications of NFAT1 protein or substances that increase the content or activity of said NFAT1 protein: C1) Constructing a model of senescent cells; C2) Products for constructing senescent cell models; C3) Screening or assisting in the screening of drugs that delay aging; C4) Products for preparing or assisting in the screening of drugs that delay aging; C5) Screening or assisting in the screening of drugs that delay intervertebral disc aging; C6) Products for preparing or assisting in the screening of drugs that delay intervertebral disc aging; C7) Screening or assisting in the screening of drugs for the treatment of intervertebral disc herniation; C8) Products for preparing or assisting in the screening of drugs for the treatment of intervertebral disc herniation.
[0015] In the above applications, the delay in aging can refer to delaying the aging of the body, tissues, or cells; Alternatively, the cells may be intervertebral disc cells.
[0016] Specifically, the intervertebral disc tissue may be nucleus pulposus tissue. The intervertebral disc cells may be nucleus pulposus cells, such as nucleus pulposus precursor cells.
[0017] The present invention also provides a product containing (or having an active ingredient thereof) NFAT1 protein or a substance that increases the content or activity of said NFAT1 protein.
[0018] The above products can be used to construct aging cell models, screen drugs to delay aging, screen drugs to delay intervertebral disc aging, and treat intervertebral disc herniation.
[0019] In the above text, the substance that increases the content or activity of the NFAT1 protein can be a biological material related to the NFAT1 protein, or a substance that acts on the upstream and downstream genes of the coding gene of the NFAT1 protein or on the upstream and downstream segments of the coding gene of the NFAT1 protein in the genome, thereby increasing the expression level of the coding gene of the NFAT1 protein. The biological material can be any one of the following B1) to B4): B1) The nucleic acid molecule encoding the NFAT1 protein; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).
[0020] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.
[0021] In the preceding text, B2) describes an expression cassette containing nucleic acid molecules, which refers to DNA capable of expressing the proteins described above in host cells. The expression cassette may also include single-stranded or double-stranded nucleic acid molecules containing all the regulatory sequences necessary for the expression of any of the aforementioned proteins. The regulatory sequences, under compatible conditions, guide the coding sequence to express any of the aforementioned proteins in suitable host cells. The regulatory sequences include, but are not limited to, leader sequences, polyadenylated sequences, propeptide sequences, promoters, signal sequences, and transcription terminators. At a minimum, the regulatory sequences must include a promoter and termination signals for transcription and translation. To introduce specific restriction enzyme sites into the vector for linking the regulatory sequences to the coding region of the nucleic acid sequence encoding the protein, a adapter-equipped regulatory sequence may be provided. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence that can be recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains a transcriptional regulatory sequence mediating protein expression. The promoter may be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutated, truncated, and heterozygous promoters, and may be derived from genes encoding extracellular or intracellular proteins that are homologous or heterologous to those of the host cell. The regulatory sequence can also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell and thus terminate transcription. The termination sequence is operatively attached to the 3' end of the nucleic acid sequence encoding the protein. Any terminator that can function in the selected host cell can be used in this invention. The regulatory sequence can also be a suitable leader sequence, i.e., an untranslated region of mRNA that is crucial for translation in the host cell. The leader sequence is operatively attached to the 5' end of the nucleic acid sequence encoding the protein. Any leader sequence that can function in the selected host cell can be used in this invention. The regulatory sequence can also be a signal peptide coding region, which encodes an amino acid sequence attached to the amino terminus of a protein that guides the encoded protein into the cellular secretory pathway. Signal peptide coding regions that guide the expressed protein into the secretory pathway of the host cell can be used in this invention. Adding a regulatory sequence that can regulate protein expression according to the growth status of the host cell may also be necessary. Examples of regulatory systems are those that respond to chemical or physical stimuli (including in the presence of regulatory compounds), thereby turning gene expression on or off. Other examples of regulatory sequences are those that can amplify genes. In these examples, the nucleic acid sequence encoding the protein should be operatively linked to the regulatory sequence.
[0022] This invention also provides a substance or detector for detecting NFAT1 protein content. NFATC2 Any of the following applications of substances that affect gene expression levels: D1) Detection or auxiliary detection of the aging level of an organism, tissue, or cell; D2) Prepare products for detecting or assisting in the detection of aging levels in the body, tissues, or cells; D3) Screening or auxiliary screening of patients with aging of the body, tissues, or cells; D4) Prepare products for screening or assisting in screening patients with aging of the body, tissues or cells; D5) Diagnosis or auxiliary diagnosis of intervertebral disc herniation; D6) Prepare products for the diagnosis or auxiliary diagnosis of intervertebral disc herniation; D7) Screening or auxiliary screening for patients with intervertebral disc herniation; D8) Prepare products for screening or assisting in the screening of patients with intervertebral disc herniation.
[0023] D9) Diagnosis or auxiliary diagnosis of intervertebral disc degeneration; D10) Products for the diagnosis or auxiliary diagnosis of intervertebral disc degeneration; D11) Screening or auxiliary screening for patients with intervertebral disc degeneration; D12) Products for screening or assisting in the screening of patients with intervertebral disc degeneration.
[0024] In the above applications, the substance or detector used to detect NFAT1 protein content... NFATC2 Substances that specifically recognize NFAT1 protein (such as antibodies against NFAT1 protein) or specifically recognize... NFATC2 Genetic material (such as NFATC2 Gene-specific primers).
[0025] in, NFATC2 The gene (NM_173091.4, 02-AUG-2024) encodes the NFAT1 protein (NP_775114.1, 02-AUG-2024).
[0026] In this invention, the intervertebral disc may be a lumbar intervertebral disc.
[0027] This invention analyzed nucleus pulposus tissue samples from individuals of different ages and those diagnosed with lumbar disc herniation. By combining histological staining and single-nuclear RNA sequencing analysis, it identified phenotypic and molecular changes associated with nucleus pulposus aging and herniation. It was found that cellular senescence and depletion of nucleus pulposus precursor cells play a central role in both processes. Furthermore, this invention also found that increased expression of senescence-associated NFAT1 significantly promotes senescence of NPPCs and promotes lumbar disc senescence and herniation. The expression of the NFAT1 coding gene... NFATC2Knockout enhances cell self-renewal and monoclonal proliferation capabilities, reduces cell senescence, and improves the chondrogenic differentiation capacity of nucleus pulposus precursor cells. This invention provides new insights into lumbar intervertebral disc aging and its related pathology, which will contribute to the development of new treatment strategies targeting the root causes of lumbar disc herniation and aging.
[0028] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description
[0029] Figure 1 Phenotypic changes in the nucleus pulposus tissue in the elderly and in lumbar disc herniation.
[0030] (A) Schematic diagram of the experimental design for senescence and prominent cellular and molecular regulatory networks in human nucleus pulposus tissue.
[0031] (B) H&E staining of human nucleus pulposus tissue sections from the young, old, and young prominence groups. Scale bar, 100 μm.
[0032] (C) Masson staining of human nucleus pulposus tissue sections from the young, old, and young prominence groups. The left image is a representative image, with scale bars at 50 μm and 25 μm (magnified images). The right image is a statistical chart of collagen-positive areas.
[0033] (D) Immunohistochemical staining of type II collagen in human nucleus pulposus tissue sections from the young, old, and young prominence groups. The left image is a representative image, scale bars at 100 μm and 25 μm (magnified images). The right image is a statistical graph of the staining intensity of type II collagen.
[0034] (E) Immunohistochemical staining of Aggrecan in human nucleus pulposus tissue sections from the young, old, and young prominence groups. The left image is a representative image, scale bars at 100 μm and 25 μm (magnified images). The right image is a statistical graph of Aggrecan staining intensity.
[0035] (F) Immunohistochemical staining of MMP9 in human nucleus pulposus tissue sections from the young, old, and young prominence groups. The left image is a representative image, with scale bars at 100 μm and 25 μm (magnified images). The right image is a statistical graph of MMP9 staining intensity.
[0036] (G) SA-β-Gal staining of human nucleus pulposus tissue sections from the young, old, and young prominence groups. The left image is a representative image, scale bar, 25 μm and 25 μm (magnified image). The right image is a statistical graph of the SA-β-Gal positive area.
[0037] (H) Immunohistochemical staining of HERV-K-env in human nucleus pulposus tissue sections from the young, older, and young prominence groups. The left image is representative, with scale bars at 100 μm and 25 μm (magnified images). The right image shows a statistical chart of the proportion of HERV-K-env positive cells in each field of view. Arrows indicate HERV-K-env positive cells.
[0038] (I) Immunohistochemical staining of IL-1β in human nucleus pulposus tissue sections from the young, old, and young prominence groups. The left image is a representative view, with scale bars at 100 μm and 25 μm (magnified images). The right image is a statistical graph showing the proportion of IL-1β-positive cells in each field of view. Arrows indicate IL-1β-positive cells.
[0039] (J) Immunohistochemical staining of CD68 in human nucleus pulposus tissue sections from the young, older, and young prominence groups. The left image is representative, with scale bars at 100 μm and 25 μm (magnified images). The right image shows a statistical chart of the proportion of CD68-positive cells in each field of view. Arrows indicate CD68-positive cells.
[0040] Data are presented as mean ± SEM. Three individuals were represented in each group. A two-tailed student's unpaired sample was used. t Test and evaluate statistical significance.
[0041] Figure 2 Single-nuclear transcriptomic analysis of nucleus pulposus tissue during aging and herniation of the human lumbar intervertebral disc.
[0042] (A) UMAP diagram of cell type distribution in human nucleus pulposus tissue. NPPC, nucleus pulposus progenitor cells; NPC 1, nucleus pulposus cell 1; NPC 2, nucleus pulposus cell 2; EC, endothelial cells; Per, pericytes; TC, T cells; Mac, macrophages; Neu, neurons.
[0043] (B) The heatmap shows the expression profiles of the top 50 cell type-specific marker genes for each cell type in human nucleus pulposus tissue, with corresponding functional annotations on the right. Colors from blue to red represent gene expression levels from low to high.
[0044] (C) The Venn diagram shows the differentially expressed genes in the nucleus pulposus tissue of the elderly and young prominence groups. The intersecting regions represent differentially expressed genes shared by both groups, and the non-intersecting regions represent differentially expressed genes specific to each group.
[0045] (D) The scatter plot shows the number of differentially expressed genes in all cell types of human nucleus pulposus tissue in the older and younger prominence groups.
[0046] (E) Bar graph showing the number (left) or proportion (right) of common and specific differentially expressed genes in chondrocyte-associated cells of the nucleus pulposus in patients with lumbar disc aging and herniation. Chondrocyte-associated cells, nucleus pulposus progenitor cells (NPPC), and nucleus pulposus cells (NPC1 and NPC2).
[0047] (F) The heatmap shows the common differentially expressed genes in chondrocyte-related cells of human nucleus pulposus tissue in both the older and younger prominence groups. Colors represent changes in the log2FC of differentially expressed genes. The dot plot shows gene ontology enrichment analysis of cell type-specific differentially expressed genes in chondrocyte-related cell populations. The color of the dots represents the degree of enrichment in log2FC. 10 ( P (adjust).
[0048] (G) Heatmap showing differentially expressed genes specific to the older group (left) and the younger group (right) in chondrocyte-related cells of human nucleus pulposus tissue. Colors indicate changes in the log2FC of differentially expressed genes. Dot plot showing gene ontology enrichment analysis of cell type-specific differentially expressed genes in chondrocyte-related cell populations. The color of the dots indicates the degree of enrichment in log2FC. 10 ( P (adjust).
[0049] (H) Oil Red O staining of human nucleus pulposus tissue sections from the young, old, and young prominence groups. The left image is representative. Scale bar, 100μm and 25μm (magnified images). The right image shows a statistical chart of the Oil Red O positive area.
[0050] Data are presented as mean ± SEM. Three individuals were represented in each group. A two-tailed student's unpaired sample was used. t Test and evaluate statistical significance.
[0051] Figure 3 Increased NFAT1 expression and senescence of nucleus pulposus precursor cells are associated with senescence of human lumbar intervertebral disc tissue and phenotypic changes in nucleus pulposus tissue during herniation.
[0052] (A) Showing the pseudo-time trajectories of nucleus pulposus precursor cells (NPPC) and nucleus pulposus cells (NPC 1 and NPC 2). The cell colors in the four images from left to right represent the cell type, sample source, pseudo-time state, and pseudo-time value, respectively.
[0053] (B) Density maps show the density changes of chondrocyte-related cells from state 1 to state 2 or from state 1 to state 3 in the sample groups, respectively.
[0054] (C) Box plots show the changes in cell type and cell number during the early (pseudo-time 0-0.5) and late (pseudo-time 6-8) stages of pseudo-time. The number and proportion of various cell types differ greatly in different pseudo-time states.
[0055] (D) Immunohistochemical staining of PRRX1 in human nucleus pulposus tissue sections from the young, old, and young prominence groups. The left image is representative, with scale bars at 100 μm and 25 μm (magnified images). The right image shows a statistical chart of the proportion of PRRX1-positive cells. Arrows indicate PRRX1-positive cells.
[0056] (E) Gene expression heatmap over pseudotime. Genes were divided into three clusters based on their different change patterns, and gene ontology enrichment analysis was performed on genes in each cluster.
[0057] (F) Alizarin Red staining of human nucleus pulposus tissue sections from the young, old, and young prominence groups. The left image is a representative image, scale bar, 25 μm. The right image is a statistical chart of alizarin Red positive areas.
[0058] (G) Immunofluorescence staining of 4-HNE in human nucleus pulposus tissue sections from the young, old, and young prominence groups. The left image is representative, scale bar 10 μm. The right image shows the statistical distribution of 4-HNE-positive cells in each field of view.
[0059] (H) The gene expression of nucleus pulposus precursor cells in cluster 1 of the young group, old group and young outstanding group was scored.
[0060] (I) Analysis of the expression scores of cell characteristic genes of nucleus pulposus precursor cells in young, old and young outstanding groups.
[0061] (J) Scoring analysis of cellular senescence-related genome expression in nucleus pulposus precursor cells in young, old and young prominence groups.
[0062] (K) Scoring analysis of cell cycle-related gene set expression in nucleus pulposus precursor cells in the young, old and young prominence groups.
[0063] (L) Transcription factor regulatory network, showing differentially or specifically expressed transcription factors in aged or young protruding nucleus pulposus tissues compared to the younger group. The size of the dots indicates the cell type in which the transcription factor is expressed, and the cell type is marked with a loop. Gray dots represent the target genes of the transcription factors.
[0064] (M) Target genes regulated by NFATC2 in nucleus pulposus precursor cells. The color of the dot's edge indicates whether the gene belongs to the older or younger prominence group. The colors represent the log2FC of differential expression of the target gene in senescence or prominence, respectively.
[0065] (N) Immunohistochemical staining of NFAT1 in human nucleus pulposus tissue sections from the young, older, and young prominence groups. The left image is representative, with scale bars at 100 μm and 25 μm (magnified images). The right image shows a statistical chart of the proportion of NFAT1-positive cells. Arrows indicate NFAT1-positive cells.
[0066] Data are presented as mean ± SEM. Three individuals were represented in each group. A two-tailed student's unpaired sample was used. t Test and evaluate statistical significance.
[0067] Figure 4 NFAT1 increases during both replicative and physiological aging.
[0068] (A) Schematic diagram of separating nucleus pulposus precursor cells from young and old nucleus pulposus tissues.
[0069] (B) Immunofluorescence staining of PRRX1 in young and aged nucleus pulposus precursor cells. The left image is representative, scale bar, 10 μm. The right image shows the percentage of PRRX1-positive cells as mean ± SEM.
[0070] (C) Schematic diagram of the replication and senescence model of nucleus pulposus precursor cells.
[0071] (D) Analysis of monoclonal proliferation capacity of early and late passage nucleus pulposus precursor cells. The left image is a representative image. The right image shows cell density statistics as mean ± SEM.
[0072] (E) Immunofluorescence staining of Ki67 in early and late generation nucleus pulposus precursor cells. Left image is a representative image, scale bar, 10 μm. Right image, percentage of Ki67 positive cells shown as mean ± SEM.
[0073] (F) SA-β-Gal staining in early and late generation nucleus pulposus precursor cells. The left image is a representative image, scale bar, 25 μm. The right image shows the percentage of SA-β-Gal positive cells as mean ± SEM.
[0074] (G) Western blot detection of P16 in early and late generation nucleus pulposus precursor cells INK4a P21 Cip1 Changes in the expression of LAP2 and LaminB1 were observed. GAPDH was used as an internal reference. Data are presented as mean ± SEM.
[0075] (H) Analysis of chondrogenic capacity of early and late nucleus pulposus precursor cells. The left image is representative, with scale bars at 50 μm and 100 μm, respectively. The right image shows the diameter of chondrocyte spheroids as mean ± SEM. Each group consisted of 11 biological replicates.
[0076] (I) RT-qPCR detection of early and late generation nucleus pulposus precursor cells NFATC2 Changes in mRNA expression levels. Data are expressed as mean ± SEM.
[0077] (J) Western blot analysis was used to detect changes in NFAT1 expression in early and late generation nucleus pulposus precursor cells. GAPDH was used as an internal control. Data are presented as mean ± SEM.
[0078] (K) Monoclonal proliferation capacity analysis of young and aged nucleus pulposus precursor cells. The left image is a representative image. The right image shows cell density as mean ± SEM.
[0079] (L) Immunofluorescence staining of Ki67 in young and aged nucleus pulposus precursor cells. The left image is representative, scale bar, 10 μm. The right image shows the percentage of Ki67-positive cells as mean ± SEM.
[0080] (M) SA-β-Gal staining of young and aged nucleus pulposus precursor cells. The left image is representative, scale bar, 25 μm. The right image shows the percentage of SA-β-Gal positive cells as mean ± SEM.
[0081] (N) Western blot detection of P16 in young and old nucleus pulposus precursor cells INK4a P21 Cip1 Changes in the expression of LAP2 and LaminB1 (P4). GAPDH was used as an internal reference. Data are expressed as mean ± SEM.
[0082] (O) Western blot analysis of NFAT1 expression changes in young and aged nucleus pulposus precursor cells. GAPDH was used as an internal control. Data are presented as mean ± SEM.
[0083] Except for the cartilage formation capacity analysis, all other experiments were performed in triplicate for each group. Two-tailed student unpaired... t Test and evaluate statistical significance.
[0084] Figure 5 Increased NFAT1 expression accelerates the senescence of nucleus pulposus precursor cells.
[0085] (A) Activation via CRISPR technology (CRISPRa) in early nucleus pulposus precursor cells. NFATC2 A schematic diagram.
[0086] (B) Activation via CRISPR technology in early nucleus pulposus precursor cells NFATC2 Then, RT-qPCR was used for detection. NFATC2 mRNA expression levels. Data are presented as mean ± SEM.
[0087] (C) Activation via CRISPR technology in early nucleus pulposus precursor cells NFATC2 Subsequently, Western blot was used to detect changes in NFAT1 expression. GAPDH was used as an internal reference. Data are presented as mean ± SEM.
[0088] (D) Activation via CRISPR in early nucleus pulposus precursor cells NFATC2 Subsequently, monoclonal proliferation capacity analysis was performed. The left image is a representative image. The right image shows cell density as mean ± SEM.
[0089] (E) Activation via CRISPR in early nucleus pulposus precursor cells NFATC2 Subsequently, Ki67 immunofluorescence staining was performed. The left image is a representative image, scale bar, 10 μm. The right image shows the percentage of Ki67 positive cells as mean ± SEM.
[0090] (F) Activation via CRISPR in early nucleus pulposus precursor cells NFATC2 Subsequently, SA-β-Gal staining was performed. The left image is representative, scale bar, 25 μm. The right image shows the percentage of SA-β-Gal positive cells as mean ± SEM.
[0091] (G) Activated by CRISPR in early nucleus pulposus precursor cells NFATC2 Subsequently, Western blot was used to detect P16. INK4a Variations in LAP2 and Lamin B1 were studied. GAPDH was used as an internal reference. Data are expressed as mean ± SEM.
[0092] Each group consisted of three biological replicates. Two-tailed Student's unpaired... t Test and evaluate statistical significance.
[0093] Figure 6 Knocking out NFATC2 can delay the senescence of nucleus pulposus precursor cells.
[0094] (A) CRISPR-mediated knockout in late-generation nucleus pulposus precursor cells (CRISPRko) NFATC2 A schematic diagram.
[0095] (B) Knockout in late-generation nucleus pulposus precursor cells NFATC2 Subsequently, Western blot was used to detect changes in NFAT1 expression. GAPDH was used as an internal control. Data are presented as mean ± SEM.
[0096] (C) Knockout in late-generation nucleus pulposus precursor cells NFATC2Monoclonal proliferation capacity was then analyzed. The left image is representative. The right image shows cell density as mean ± SEM.
[0097] (D) Knockout in late-generation nucleus pulposus precursor cells NFATC2 Following this, Ki67 was immunofluorescence stained. The left image is representative, scale bar, 10 μm. The right image shows the percentage of Ki67 positive cells as mean ± SEM.
[0098] (E) Knockout in late-generation nucleus pulposus precursor cells NFATC2 SA-β-Gal staining followed. The left image is representative, scale bar, 25 μm. The right image shows the percentage of SA-β-Gal positive cells as mean ± SEM.
[0099] (F) Knockout in late-generation nucleus pulposus precursor cells NFATC2 Subsequently, Western blot was used to detect P16. INK4a Changes in the expression of LAP2 and Lamin B1 were observed. GAPDH was used as an internal reference. Data are presented as mean ± SEM.
[0100] (G) Knockout in late-generation nucleus pulposus precursor cells NFATC2 Then proceed to P21 Cip1 Immunofluorescence staining. The left image is a representative image, scale bar, 10 μm. The right image is on page 21. Cip1 The percentage of positive cells is shown as mean ± SEM. 300 cells were counted in each group.
[0101] (H) Knockout in late-generation nucleus pulposus precursor cells NFATC2 Analysis of post-adipogenic capacity. The left image is a representative image, scale bar, 50 μm. The right image shows absorbance values as mean ± SEM.
[0102] (I) Knockout in late-generation nucleus pulposus precursor cells NFATC2 Osteogenic capacity analysis was performed afterward. The left image is a representative image, scale bar, 50 μm. The right image shows the Von Kossa positive area as mean ± SEM. Each group had 3 biological replicates.
[0103] (J) Analysis of chondrogenic capacity after NFATC2 knockout in LP NPPCs. Left panel: representative image, scale bar, 100 μm. Right panel: chondrocyte spheroid diameter, mean ± SEM. Ten biological replicates per group.
[0104] (K) Volcano diagram showing knockout in late-generation nucleus pulposus precursor cells NFATC2 Differentially expressed genes were identified. Log2FC values and log... 10 The gene with the highest FDR value.
[0105] (L) Knockout in late-generation nucleus pulposus precursor cells NFATC2 Functional enrichment analysis followed. The size of the dots represents the proportion of differentially expressed genes in the enriched gene pool, and the depth of the dot color represents the enrichment level (-log). 10 P.
[0106] Except for chondrogenic capacity analysis, each group had three biological replicates. Two-tailed Student's unpaired... t Test and evaluate statistical significance. Detailed Implementation
[0107] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available.
[0108] Hematoxylin and eosin (H&E) staining: Paraffin sections were dewaxed with xylene, then rehydrated with water and ethanol solutions of decreasing concentrations (100%, 90%, 80%, 70%, and 50%). They were then stained with hematoxylin for 3 minutes, washed with water, stained with eosin, dehydrated with ethanol solutions of increasing concentrations (50%, 70%, 80%, 90%, and 100%), and washed with 100% xylene. Images were taken under a microscope.
[0109] Masson-trichrome staining: Paraffin sections were dewaxed with xylene and rehydrated with a series of ethanol solutions and water. Masson staining was performed according to the manufacturer's instructions (Solarbio, G1340). Images were acquired using a Nikon microscope and analyzed using ImageJ.
[0110] SA-β-Gal staining: Frozen sections of human nucleus pulposus tissue (10 μm thick) or cultured NPPCs were fixed with 2% formaldehyde and 0.2% glutaraldehyde at room temperature for 5–10 min, and then incubated with 20 mg / mL X-gal staining solution at 37 °C. Images were acquired under a microscope. The area or percentage of SA-β-Gal positive cells was quantitatively analyzed using ImageJ.
[0111] Immunohistochemical staining: Paraffin sections were dewaxed with xylene, rehydrated with a series of ethanol solutions, and microwaved in citrate buffer (pH 6.0) for 20 min. Further processing steps were then performed on the paraffin sections or OCT-embedded sections. First, sections were permeabilized with 0.4% Triton X-100 for 30 min. This was followed by incubation with 3% H2O2 for 20 min. Finally, sections were blocked with 5% donkey serum (Jackson Immuno Research) at room temperature for 1 h. Then, they were incubated overnight at 4°C with a primary antibody. Slides were washed with phosphate-buffered saline (PBS), incubated with secondary antibody for 1 h according to the manufacturer's instructions, developed with DAB, and stained with hematoxylin. Finally, sections were dehydrated and mounted with neutral resin. Antibodies used include: anti-CollagenII (Abcam, ab34712), anti-MMP9 (Abcam, ab38898), anti-HERV-K-env (Austral Biologicals, HERM-1811-5), anti-IL-1β (Santa cruz biotechnology, sc-52012), anti-CD68 (Abcam, ab955), anti-Aggrecan (Abcam, ab3778), anti-PRRX1 (Abcam, ab211292), anti-NFAT1 (Santa cruzbiotechnology, sc-7296).
[0112] Oil Red O staining: The working solution was prepared by diluting Oil Red O stock solution (Sigma-Aldrich, #O1391) with water at a ratio of 3:2. The solution was then filtered through a 0.45 μm filter and applied to OCT-embedded nucleus pulposus tissue sections for staining for 15 minutes. After staining, the slides were rinsed with water and stained with hematoxylin. The samples were then observed under a microscope and quantitatively analyzed using ImageJ software.
[0113] Immunofluorescence staining: OCT-embedded sections were permeabilized with 0.4% Triton X-100 for 30 minutes, and cells were permeabilized with 0.4% Triton X-100 for 15 minutes, then incubated with 5% donkey serum at room temperature for 1 hour. Primary antibodies were incubated overnight at 4°C. Samples were washed three times with PBS, incubated with secondary antibodies conjugated to Alexa Fluor 488 or Alexa Fluor 568 at room temperature in the dark for 1 hour, cell nuclei were labeled with Hoechst 33342 (Thermo Fisher Scientific), and then mounted. Images were acquired using a Zeiss LSM900 confocal laser scanning microscope system. Antibodies used in this study included: anti-Ki67 (ZSGB-Bio, ZM-0166) and anti-P21. Cip1 (Cell signaling technology, 2947S), anti-PRRX1 (Abcam, ab211292), anti-4-HNE (ABclonal, A26085).
[0114] Cell nucleus isolation and single-nuclear RNA sequencing were performed using the 10xGenomics platform. All sample processing steps were performed on ice. Frozen tissue was homogenized using a pestle and mortar and dissolved in 1.5 mL of lysis buffer containing 250 mM sucrose, 25 mM KCl, 5 mM MgCl2, 10 mM Tris buffer, 1 μM dithiothreitol, 1x protease inhibitor, 0.4 U / μL RNaseIn, 0.2 U / μL Superasin, and 0.1% Triton X-100. Samples were filtered multiple times through a 40 μm cell filter (BDFalcon), centrifuged at 500 xg at 4°C for 8 min, and resuspended in PBS supplemented with 0.3% BSA, 0.4 U / μL RNaseIn, and 0.2 U / μL Superasin. Acridine orange and propidium iodide staining were used, and double-positive cell nuclei were sorted using FACS (BD influx). Mixed nuclei from the same group of nucleus pulposus tissues were used for single-nucleus capture library preparation using the 10x Genomics system (10x Genomics), capturing approximately 9,000 nuclei per sample, and then sequenced in a NovaSeq 6000 sequencing system (Illumina, 20012866).
[0115] BulkRNA-seq data processing: Total RNA was extracted using the TRIzol reagent kit (Invitrogen) according to the instructions, and RNA sequencing was performed using HiSeq-PE150 sequencing. Fastp (version 0.23.2) software was used for quality control, adapter trimming, and quality filtering of the raw, large-capacity RNA-seq reads. Then, HISAT2 (version 2.0.4) was used to map the trimmed reads to the Homo sapiens GRCh37.87 genome. The generated SAM files were then converted to BAM files using SAMtools (version 1.6). Read counts for each gene were calculated using featureCounts (version 2.0.3) software. The adjusted read counts were obtained using the R package DESeq2 (version 1.2.4) (Love et al., 2014). P Values <0.05 and |Log2FC|≥0.5 are cutoff values to identify differentially expressed genes between samples.
[0116] Raw data processing for single-nuclear RNA sequencing: Single-cell capture and transcriptome libraries were constructed using the 10x Genomics platform, Chromium single-cell 3' GelBead, and libraryV2Kit. Sequencing was performed on a NovaSeq 6000 sequencing platform (Illumina20012866) to obtain mononuclear transcriptome data. Further, a pre-mRNA reference for the Homo sapiens GRCh37.87 genome was constructed using Cell Ranger (4.0.0) software, and the gene expression matrix for downstream analysis was calculated using the "count" function and default parameters. CellBender (0.2.0) software was used with default parameters to eliminate potential background RNA bias. The R package Seurat (4.0.2) was used for downstream analysis, including screening for low-quality cells, data normalization, dimensionality reduction, clustering, and differential gene expression analysis. Cells with <200 genes or a mitochondrial gene proportion >5% were excluded as low-quality cells. DoubletFinder (2.0.3) (McGinnisetal., 2019) software was used to detect and remove potential double-cell data in technical artifacts. After normalizing and scaling the expression matrix of each sample using the "SCTransfrom" function, the "PrepSCTIntegration" and "findintegrationanchors" functions were used to select downstream integration features and anchors. Based on these features, the "IntegrateData" function was used to integrate all valid samples, and the "ScaleData" function was used for scaling. After data integration and scaling, principal component analysis and clustering were performed using the "RunPCA" and "FindCluster" functions. Dimensionality reduction was then performed using the "RunUMAP" function. Cell clustering was performed using the "FindNeighbors" and "FindClusters" functions. The "FindAllMarkers" function was used to calculate the marker genes for each cluster (avg_log2FC≥0.25, P _val_adj<0.05).
[0117] Cell characterization scoring analysis: By using Seurat's "FindAllMarkers" function to calculate the top 10 marker genes for NPPC in chondrocytes of the young group, a representative gene set for NPPC cell identity was obtained, with thresholds of avg_log2FC ≥ 1 and 1. P _val_adj<0.05. Subsequently, the cell identity score of NPPC in the YN, ON and YH groups was calculated based on these top 10 marker genes using the "AddModuleScore" function.
[0118] Differential expression analysis of single-nuclear RNA sequencing data: Differentially expressed genes between groups (ON / YN, YH / YN) were calculated using the Seurat function "FindMarkers" and the Wilcoxon signed-rank test. The avg_log2FC|≥0.75 and P Genes with _val_adj < 0.05 were identified as O-DEGs or H-DEGs.
[0119] Transcriptional regulatory network analysis: The upstream transcriptional regulatory network of DEGs was analyzed using GENIE3 (version 1.12.0) and RcisTarget (version 1.10.0) within the SCENIC (version 1.2.4) workflow with default parameters. HG19 genomic transcription factors (TFs) were downloaded from the RcisTarget database as a reference. In short, a TF-gene co-expression network was first constructed using GENIE3 based on the gene expression matrix, where each row represents a DEG and each column represents a cell nucleus, representing each cell type. Then, enriched TF-binding motifs and their target genes were inferred using RcisTarget. The transcriptional regulatory module network was visualized using Cytoscape (version 3.9.1).
[0120] Pathway enrichment analysis: Gene Ontology (GO) process and pathway enrichment analysis was performed using Metscape and ClusterProfiler (4.6.0). Two representative words were selected from the Metscape results, and the kappa test score between each word was calculated. P The value is ≤0.05, and it is used as the similarity score between words.
[0121] Pseudo-time trajectory analysis: The developmental trajectories of NPPCs and NPCs were studied using Monocle2 (2.99.3). The "differentialGeneTest" function was used to select the total differentially expressed genes in the cells, and the top 200 genes sorted by q-value were used for cell alignment. The "reduceDimension" function was used to reduce the cell dimension to two-dimensional space, and the "orderCells" function was used to sort the cells. Without modifying the root_state parameter, the starting point was called again to obtain the expected time trajectory of cell differentiation.
[0122] Gene set scoring analysis: Download gene sets from the KEGG and GO databases. Calculate gene set expression scores using Seurat's "AddModuleScore" function and visualize them using the R package ggplot2.
[0123] Isolation and cell culture of nucleus pulposus precursor cells: Nucleus pulposus progenitor cells (NPPCs) were isolated from nucleus pulposus tissue according to a previously established experimental protocol. First, the nucleus pulposus tissue was washed in PBS supplemented with 2% penicillin / streptomycin (Thermo Fisher Scientific). The washed tissue was then placed in 6-well plates and incubated at 37°C for 2 hours. Subsequently, 2 mL of culture medium was added to each well. The tissue was kept in the culture medium, which was changed every 2 days until NPPCs migrated from the tissue.
[0124] NPPCs were cultured in nucleus pulposus precursor cell culture medium supplemented with 10% (v / v) fetal bovine serum (FBS, Gemini), 0.1 mM NEAA (Gibco), 1% (v / v) penicillin and streptomycin (Penicillin: 10000 U / mL, Streptomycin: 10000 µg / mL) (Gibco), and 1 ng / mL FGF2 (Joint Protein Central) in Minimum Essential Medium αbasal medium (Thermo Fisher Scientific)
[0125] Precursor cells of the nucleus pulposus differentiate into adipocytes: P4 and P12 generation nucleus pulposus progenitor cells were respectively used at 6×10 5 Cells were seeded at a density of 0.1% Gelatin in 12-well plates. The medium was replaced with lipid differentiation medium the next day, and the medium was changed every other day. Cell status was observed. After about 21 days, a large number of lipid droplets were observed. Cells were removed and identified by Oil Red O (Sigma-Aldrich) staining.
[0126] The adipogenic differentiation medium was prepared by adding the following components to a high-glucose DMEM medium: 7.5% (v / v) human serum albumin solution (5% human serum albumin protein concentration), 7.5% (v / v) Knock-Out Serum Replacement, 0.5% (v / v) penicillin and streptomycin solution (Penicillin: 10000 U / mL, Streptomycin: 10000 µg / mL), 0.5% (v / v) NEAA, 0.001% (v / v) Plasmocin, 10 μg / mL insulin, 0.5 μM Rosiglitazone and 0.1 μM dexamethasone.
[0127] Nucleus pulposus precursor cells differentiate into chondrocytes: P4 and P12 generation nucleus pulposus progenitor cells or NFATC2 Knockout nucleus pulposus progenitor cells were administered at 2 × 10⁻⁶ cells per cell line. 5 Cells were seeded at a low adhesion 96-well plate and centrifuged at 450g for 5 minutes to promote cell spheroidization. The cartilage differentiation medium was changed every two days. After about 10 days, solid spheroids were observed. Cells were then cultured for another 25 days, and the size of the spheroids was recorded under a microscope. After overnight fixation with 4% paraformaldehyde, the spheroids were dehydrated in EP tubes with 30% sucrose for several days until they settled to the bottom. Subsequently, OCT embedding was performed, and sections were prepared with a thickness of 10 micrometers. The obtained sections were identified using toluidine blue (Sigma-Aldrich) staining.
[0128] The chondrogenic differentiation medium was prepared by adding the following components to a high-glucose DMEM medium: 1% (v / v) L-GlutaMAX, 1% (v / v) penicillin and streptomycin antibiotic solution (Penicillin: 10000 U / mL, Streptomycin: 10000 µg / mL), 1% (v / v) NEAA, 1% (v / v) ITS, 0.001% (v / v) Plasmocin, 40 μg / mL Proline, 40 μg / mL Vitamin C, and 100 nM dexamethasone.
[0129] Precursor cells of the nucleus pulposus differentiate into osteocytes: P4 and P12 generation nucleus pulposus progenitor cells were respectively used at 6×10 5Cells were seeded at a density suitable for osteodifferentiation in 12-well plates coated with 0.1% gelatin. The medium was replaced with osteodifferentiation medium every 4 days, and significant calcium deposition was observed in the cells after approximately 50 days. The cells were then removed and identified using Von Kossa staining (Genmed Sciences, GMS80045.3).
[0130] Osteogenic differentiation medium was prepared by adding the following components to α-MEM medium at the following concentrations: 10% (v / v) FBS, 1% (v / v) penicillin and streptomycin solution (Penicillin: 10000 U / mL, Streptomycin: 10000 µg / mL), 1% (v / v) L-GlutaMAX, 0.001% (v / v) Plasmocin, 10 mM β-glycerophosphate, 50 μg / mL vitamin C and 0.1 μM dexamethasone.
[0131] Monoclonal proliferation capacity experiment: 3000 cells were seeded in each well of a 12-well plate and cultured for approximately 15 days until complete confluence. Cells were then fixed with 4% paraformaldehyde (PFA) for 30 minutes, stained with 0.2% crystal violet (Biohao, C0520) at room temperature for 1 hour, and washed with water. Cell density was quantified using ImageJ.
[0132] Western blot analysis (WB): Cell samples were lysed with 1xSDS lysis buffer (50mM Tris-HCl, pH 6.8, 10% glycerol, 2% SDS, and 2% β-mercaptoethanol), denatured at 105°C for 10 min, and then quantified using a BCA protein quantification kit (Beijing Dingguo Changsheng Biotechnology Co., Ltd., BCA02). SDS-PAGE separation was performed, and the samples were electrotransferred to a 0.2μm PVDF membrane (Millipore, ISEQ00010). The membrane was incubated with 5% (w / v) skim milk powder (BBI Life Sciences, a600669-0250) at room temperature for 1 hour, followed by overnight incubation with primary antibody at 4°C. HRP-conjugated secondary antibody was incubated at room temperature for 1 hour, then visualized using the Chemi DocXRS+ system (Bio-Rad), and the data were analyzed using ImageJ. The antibody used in this study was anti-P16. INK4a (BD,550834), anti-LAP2 (BD,61000), anti-P21 Cip1(CellSignaling Technology, 2947s), anti-LaminB1 (Abcam, ab16048), anti-NFAT1 (CellSignaling technology, 5861T), anti-GAPDH (Santacruzbiotechnology, sc-365062).
[0133] Real-time quantitative PCR detection: Total RNA was extracted using the TRIzol kit reagent (Invitrogen) according to the manufacturer's instructions. cDNA was synthesized using the GoScript reverse transcription system (Promega), and 2 μg of total RNA was extracted. RT-qPCR was performed on the QuantStudio™ 5 real-time PCR system (Applied Biosystems). The relative expression of each gene was normalized using GAPDH.
[0134] Detection NFATC2 Primers used for mRNA: Forward primer (5'-3'): CATCTAACCCCATCGAGTGC, Reverse primer (5'-3'): GCTGTCTGTGTCTTGTCTTTCAA.
[0135] The internal reference was GAPDH, and the primers were: forward primer (5'-3'): ACAACTTTGGTATCGTGGAAGG, and reverse primer (5'-3'): GCCATCACGCCACAGTTTC.
[0136] Example 1: Increased expression of NFAT1 in aging and herniated nucleus pulposus tissue samples of the lumbar intervertebral disc. 1. Phenotypic changes of the nucleus pulposus tissue during aging and lumbar disc herniation To explore the phenotypic changes of nucleus pulposus tissue related to aging and herniation, the inventors collected human lumbar intervertebral disc nucleus pulposus tissue samples and divided them into three groups: a young group, an older group, and a young herniation group for analysis. Figure 1 (A)
[0137] Patients and Samples: The inventors obtained nucleus pulposus tissue samples through lumbar disc surgery and then divided them into three distinct groups based on age and Pfirrmann classification: young nucleus pulposus tissue (YN, n=6, age 15–38 years, classification ≤ II), young herniated nucleus pulposus tissue (YH, n=11, age 15–8 years, classification ≥ IV), and elderly nucleus pulposus tissue (ON, n=11, age 60–80 years, classification ≤ II). Samples in the YN group came from young scoliosis patients requiring corrective surgery with healthy disc tissue. YH samples came from young patients diagnosed with lumbar disc herniation. ON samples were taken from elderly patients presenting with lumbar spinal stenosis. Due to the aforementioned lumbar disc pathology, all nucleus pulposus tissue was obtained from surgical resection. Exclusion criteria included lumbar trauma, infection, tuberculosis, tumors, and autoimmune diseases. This study was approved by the Institutional Review Board of Peking University First Hospital (Approval No.: 2021-key-252). All sample collection was performed by the same researcher to ensure consistency. In the young group, three samples were used for single-nucleus sequencing, and another three samples were used for staining validation. In the older and young prodigies groups, eight individuals each were used for single-nucleus sequencing, and three samples were used for staining validation.
[0138] The inventors first observed morphological changes using H&E and Masson staining. Compared to the young nucleus pulposus tissue group, the nucleus pulposus tissue structure of the older and younger protruding groups was more disordered, and the total collagen, the main extracellular matrix component in the nucleus pulposus tissue, was reduced. Figure 1 (B and C). Meanwhile, the main collagen type, type II collagen, and the main proteoglycan aggregates in the nucleus pulposus tissue were significantly reduced in both the older and younger prominent groups. Figure 1 (D and E) These results indicate that extracellular matrix degradation occurs during lumbar disc aging and protrusion. Consistent with extracellular matrix degradation, the expression of matrix metalloproteinase MMP9, which is involved in the degradation of type II collagen and proteoglycan aggregates, is upregulated. Figure 1 These observations indicate that aged and prominent nucleus pulposus tissues exhibit similar structural degeneration, manifested as extracellular matrix dysregulation. Tissue aging is often accompanied by an increase in senescent cells. The inventors found increased aging-related β-galactosidase (SA-β-Gal) activity in both the aged and young prominent nucleus pulposus groups. Figure 1 In addition, the novel aging biomarker human endogenous retrovirus-K (HERV-K) was elevated in both the older and younger prominence groups. Figure 1 (H). One characteristic of senescent cells is the secretion of inflammatory factors and chemokines, collectively known as the aging-related secretory phenotype. The inventors found that the typical aging-related secretory phenotype and the pro-inflammatory cytokine interleukin-1β (IL-1β) were upregulated in both older and younger prominent groups. Figure 1 In addition, the infiltration of immune cells increased in both the older and younger prominent groups, such as the increase in CD68-positive macrophages (I). Figure 1 (J). Histological analysis revealed similar changes such as structural disorder and cellular senescence in lumbar disc herniation and aging nucleus pulposus tissue.
[0139] 2. Mononuclear transcriptome atlas of nucleus pulposus tissue in the aging process and lumbar disc herniation To analyze the molecular basis of changes in nucleus pulposus tissue during aging and lumbar disc herniation, the inventors constructed mononuclear transcriptome atlases of nucleus pulposus tissue in young, old, and young herniated disc groups. After quality control, 10,884 mononuclear transcriptomes were obtained and clustered into eight different cell types based on marker genes: nucleus pulposus progenitor cells (NPPC), nucleus pulposus cell 1 (NPC1), nucleus pulposus cell 2 (NPC2), endothelial cells (EC), pericytes (Per), T cells (TC), macrophages (Mac), and neurons (Neu). Figure 2 (A). Pathway enrichment analysis of the top 50 marker genes for each cell type was used to label their functional roles, such as "collagen formation and developmental growth" for NPPC and "T cell proliferation" for TC. Figure 2 (B)
[0140] Differential gene expression analysis between groups revealed 2,024 differentially expressed genes between the older and younger groups, including 1,626 upregulated genes and 398 downregulated genes. The young and prominent group had 2,272 differentially expressed genes compared to the younger group, including 2,092 upregulated genes and 180 downregulated genes (Log2FC≥0.75). P .adjust<0.05) Figure 2 (C). During lumbar disc aging and herniation, 731 upregulated genes and 138 downregulated genes were observed to overlap, indicating a similarity in gene expression patterns between the two groups. Figure 2 (C) Chondrocytes are the main cellular component of the nucleus pulposus tissue, and the gene expression changes of chondrocyte populations are most pronounced during lumbar intervertebral disc aging and herniation. Figure 2 (D), which indicates that they play an important role in the homeostasis of the nucleus pulposus tissue. Therefore, the inventors have made nucleus pulposus cells and nucleus pulposus precursor cells the focus of their future research.
[0141] Differentially expressed genes in most chondrocyte populations are upregulated genes, and about one-third of the genes show the same changes between older and younger salient cells. Figure 2 (E). For example, they can function synergistically within the nucleus pulposus. FN1 and COMPConsistently upregulated across different chondrocyte types. Conversely, factors promoting chondrocyte proliferation and collagen expression... FBLN1 Decreased in both the older and younger outstanding groups ( Figure 2 These results suggest that there are some similar molecular changes in aging and lumbar disc herniation. Gene ontology (GO) terminology analysis of differentially expressed genes in chondrocytes showed that genes associated with cell aggregation and TGF-β / SMAD signaling were generally upregulated in NPC1 and NPC2 nucleus pulposus cells, suggesting that they may play a role in intervertebral disc degeneration and ossification. Figure 2 The differentially expressed genes specific to lumbar disc aging and herniation revealed their respective unique mechanistic characteristics. For example, lipid metabolism-related genes were upregulated only in the older group, while stress fiber-related genes were upregulated only in the younger herniation group. Figure 2 Oil Red O staining confirmed that lipid droplets specifically increased in nucleus pulposus tissue samples from older patients. Figure 2 (H).
[0142] In summary, by analyzing single-cell transcriptomics of human nucleus pulposus tissue samples, the inventors depicted cell type-specific gene expression changes, highlighting the importance of common and characteristic molecular changes in chondrocytes during lumbar intervertebral disc aging and herniation.
[0143] 3. In old age and during lumbar disc herniation, the nucleus pulposus progenitor cells are depleted. Nucleus pulposus progenitor cells derived from the notochord possess stem cell / progenitor cell characteristics, which are crucial for cellular replenishment and tissue repair of the lumbar intervertebral disc and nucleus pulposus tissue. To explore the developmental trajectory among cell types within the nucleus pulposus tissue, the inventors performed a pseudo-time analysis on all chondrocyte populations within the nucleus pulposus tissue. As expected, the nucleus pulposus progenitor cells were located at the starting point of the pseudo-time trajectory and differentiated into two distinct lineages, termed state 2 and state 3 (…). Figure 3 (A)
[0144] It is noteworthy that the inventors observed a decrease in the proportion of nucleus pulposus progenitor cells in aging and protruding nucleus pulposus tissue samples during the initial stage of the pseudo-time (state 1). Figure 3 (Middle B and C). Under aging and spur conditions, PRRX1 The reduction in positive NPPCs confirms this view, indicating that progenitor cell depletion has occurred. Figure 3 Consistent with this, compared to the younger group, genes highly expressed in nucleus pulposus progenitor cells in state 1 (involving stem cell differentiation, growth regulation, and cell cycle) were downregulated in the older or younger progenitor groups. Figure 3 (E and H). These findings support the concept of nucleus pulposus precursor cell depletion during lumbar intervertebral disc aging and herniation.
[0145] Chondrocyte state 2 is mainly composed of NPC1 cells, which are evenly distributed in both the older and younger prominent groups. Figure 3 (AC). Dynamic gene expression analysis from state 1 (nucleus pulposus progenitor cells NPPCs) to state 2 (mainly nucleus pulposus cells NPC1) showed upregulation of genes associated with ossification and extracellular matrix degradation. Figure 3 (Middle E). This suggests that the presence of NPC1 may represent a cellular response associated with calcification, which is relevant to disease progression and aging. Alizarin Red staining, indicating increased ossification levels in aged nucleus pulposus tissue, supports this hypothesis. Figure 3 (Middle F). Similar trends were also observed in the nucleus pulposus tissue samples of lumbar disc herniation ( Figure 3 (Middle F).
[0146] NPC2 mainly appears at the end of state 3, and is mainly distributed in the older group. Figure 3 The gene expression profile along a pseudo-time trajectory from state 1 (nucleus pulposus progenitor cells) to state 3 (mainly nucleus pulposus cells NPC2) showed upregulation of genes associated with ferroptosis, cellular responses to oxidative stress, and cellular senescence. Figure 3 (Middle E). This suggests that there may be abnormal differentiation of nucleus pulposus progenitor cells and dysfunctional features of NPC2 in the older group. Consistent with the above speculation, 4-HNE-positive cells increased only in the older group, while 4-HNE is associated with lipid oxidative damage and ferroptosis ( Figure 3 (G).
[0147] 4. NFATC2 It is a core regulator of gene expression changes in nucleus pulposus precursor cells during aging and lumbar disc herniation. Since nucleus pulposus progenitor cell depletion is a common feature of lumbar disc aging and herniation, and changes in nucleus pulposus progenitor cells may lead to abnormal chondrocyte differentiation, the inventors analyzed changes in the expression of nucleus pulposus progenitor cell-specific genes under these conditions. The inventors found that a decrease in the gene set score of nucleus pulposus progenitor cell marker genes indicates a loss of cellular identity in nucleus pulposus progenitor cells in both older and younger herniated disc groups. Figure 3 (H and I). Simultaneously, during lumbar disc aging and herniation, the gene set score associated with cellular senescence in nucleus pulposus precursor cells is upregulated, while the gene set score associated with the cell cycle is downregulated (H and I). Figure 3 (J and K), which is consistent with the observed accumulation of senescent cells in the aging and herniation process of the lumbar intervertebral disc.
[0148] To identify pro-aging factors in nucleus pulposus precursor cells, the inventors performed upstream regulatory factor analysis on all chondrocyte types and identified common upstream regulators of differentially expressed genes in both aging and lumbar disc herniation. Notably, in both aging and lumbar disc herniation... NFATC2 These are all important transcription factors of differentially expressed genes in nucleus pulposus progenitor cells, which is consistent with their role in the proliferation and differentiation of adult stem cells. Figure 3 (L). Further analysis revealed NFATC2 Potential downstream targets, including BMP6 A gene that plays a crucial role in the osteogenic process ( Figure 3 Immunohistochemical staining confirmed that NFAT1 (by M) was present in tissue samples of senescent and herniated nucleus pulposus of the lumbar intervertebral disc. NFATC2 Encoding) expression increased ( Figure 3 The N), highlighting the potential regulatory role of NFAT1 in nucleus pulposus progenitor cells.
[0149] in, NFATC2 The gene (NM_173091.4, 02-AUG-2024) encodes the NFAT1 protein (NP_775114.1, 02-AUG-2024).
[0150] Example 2: NFAT1 expression is associated with senescence of nucleus pulposus progenitor cells. To further investigate the molecular mechanisms behind the senescence of nucleus pulposus progenitor cells, the inventors isolated nucleus pulposus progenitor cells from young people's nucleus pulposus tissue and performed primary cell culture. Figure 4 (Middle A). These cells express the typical nucleus pulposus progenitor cell marker PRRX1 and can be passaged, but cell growth arrests in later passages (P12 generation). Figure 4 (B and C). Comparative analysis of early-generation nucleus pulposus progenitor cells (P4 generation) and late-generation nucleus pulposus progenitor cells revealed that late-generation nucleus pulposus progenitor cells exhibited characteristics of cellular senescence, including decreased cell proliferation capacity, decreased monoclonal proliferation capacity, reduced Ki67-positive cells, and increased SA-β-gal-positive cells. Figure 4 (Middle DF), late-generation nucleus pulposus precursor cells are replicating senescent nucleus pulposus precursor cells. In addition, P21 in late-generation nucleus pulposus precursor cells... Cip1 and P16 INK4a Increased expression, decreased expression of LAP2 and Lamin B1 ( Figure 4 (G).
[0151] Along with impaired proliferative capacity, the chondrogenic ability of nucleus pulposus precursor cells is also impaired. Compared with early-generation nucleus pulposus precursor cells, the chondrocyte spheroids differentiated from late-generation nucleus pulposus precursor cells are smaller in size. Figure 4 (H). RT-qPCR and Western blot analysis showed that late-generation nucleus pulposus precursor cells... NFATC2 mRNA and protein levels increased approximately twofold, consistent with the inventors' observations in aging and prominent nucleus pulposus tissue. Figure 3 N, Figure 4 (I and J).
[0152] Furthermore, the inventors isolated and analyzed primary nucleus pulposus precursor cells from nucleus pulposus tissues of both young and elderly individuals. Consistent with the replicative senescence phenotype of nucleus pulposus precursor cells, physiologically senescent nucleus pulposus precursor cells exhibited similar senescence phenotypes, including slowed cell growth, impaired monoclonal proliferation, and elevated senescence markers. Figure 4 (Middle KM). Western blotting showed P21 Cip1 and P16 INK4a Increase, LAP2 and LaminB1 decrease ( Figure 4 (N). Notably, NFAT1 expression is upregulated in older NPPCs (N). Figure 4 (O).
[0153] Example 3: Increased NFAT1 expression promotes senescence of nucleus pulposus progenitor cells To elucidate the role of NFAT1 in the senescence of nucleus pulposus progenitor cells, the inventors employed techniques based on CRISPR activation (CRISPRa) or CRISPR knockout (CRISPRko) to increase the number of early-generation (P4) nucleus pulposus progenitor cells in young adults. NFATC2 Expression or knockout NFATC2 Gene.
[0154] Lentiviral-mediated CRISPR activation NFATC2 Expression: targeting NFATC2 The sgRNAs were cloned into the lentiSAMv2 vector. The specific steps are as follows: Target NFATC2 The forward and reverse single-stranded DNA of the sgRNAs were annealed. The product was then ligated to the vector backbone obtained by digesting the lentiSAMv2 vector with Esp3I, and the recombinant plasmid with the correct sequence was obtained by sequencing and named lentiSAMv2-NFATC2.
[0155] After obtaining plasmids with correct sequences, lentivirus packaging was performed in 293T cells using viral packaging plasmids psPAX2 and pMD2.G. The culture medium was collected and centrifuged at high speed to obtain concentrated, infectious, and targeted activation-enabled lentiviruses. NFATC2 The expressed virus. First, the viral titer was determined in nucleus pulposus precursor cells to ensure a high infectivity rate while minimizing impact on cell state. P4 generation nucleus pulposus precursor cells were cultured at a rate of 1×10⁻⁶. 5Cells were seeded at the specified density in six-well plates coated with 0.1% gelatin. The next day, the medium was replaced with fresh nucleus pulposus progenitor cells containing polybrene at a 1:1000 ratio. Virus-infected cells were then added according to the determined titer. After 24 hours of infection, the medium was replaced with fresh nucleus pulposus progenitor cells. Forty-eight hours after infection, cells were screened for drug treatment using hygromycin B gold (invivogen) and blasticidin (invivogen) at ratios of 1:4000 and 1:2000, respectively. Six days after drug treatment, only virus-infected cells survived. These cells were then cultured in normal medium for further experiments.
[0156] Targeted NFATC2 The forward single-stranded DNA sequence of sgRNAs is CGGACCTGACCACACTGTCC (5'-3'), and the reverse single-stranded DNA sequence is GGACAGTGTGGTCAGGTCCG (5'-3'). The forward single-stranded DNA sequence of NTC is CTGAAAAAGGAAGGAGTTGA (5'-3'), and the reverse single-stranded DNA sequence is TCAACTCCTTCCTTTTTCAG (5'-3').
[0157] The results showed that the primary nucleus pulposus progenitor cells infected with the virus were contemporary NFATC2 The expression of [a substance] was significantly increased, and the content of NFAT1 was also significantly increased. Figure 5 Increased NFAT1 expression leads to accelerated senescence of nucleus pulposus progenitor cells, characterized by decreased monoclonal proliferation, reduced Ki67-positive cells, and increased SA-β-gal-positive cells. Figure 5 (DF). NFATC2 Activation leads to P16 INK4a Increased expression, decreased levels of LAP2 and LaminB1 ( Figure 5 (G).
[0158] Lentiviral-mediated CRISPR knockout NFATC2 Genes: Targeting NFATC2 The sgRNAs were cloned into lentiCRISPR v2. The specific steps are as follows: Target NFATC2 The forward and reverse single-stranded DNA of the sgRNAs were annealed. The product was then ligated to the vector backbone obtained by digesting the lentiCRISPR v2 vector with Esp3I, and the recombinant plasmid with the correct sequence was obtained by sequencing and named lentiCRISPR v2-NFATC2.
[0159] After obtaining plasmids with correct sequences, lentiviruses were packaged in 293T cells using the viral packaging plasmids psPAX2 and pMD2.G. The culture medium was collected and centrifuged at high speed to obtain concentrated, infectious, and targetable knockout viruses. NFATC2 The virus was first detected in nucleus pulposus precursor cells to ensure a high infectivity rate while minimizing its impact on cell state. P8 generation nucleus pulposus precursor cells were then cultured at a rate of 1 × 10⁻⁶. 5 Cells were seeded at the specified density in six-well plates coated with 0.1% Gelatin. The next day, the medium was replaced with fresh nucleus pulposus progenitor cells in a 1:1000 ratio with polybrene (Sigma). Virus-infected cells were then added at the determined titer. After 24 hours of infection, the medium was replaced with fresh nucleus pulposus progenitor cells. 48 hours after infection, cells were screened for viral infection using a medium containing puromycin (invivogen) at a ratio of 1:10000. Four days after viral infection, only virus-infected cells survived. The culture medium was then replaced with normal medium for further experiments.
[0160] Targeted NFATC2 The forward single-stranded DNA sequence of sgRNAs is CAGCGGCCGTACTCTACCAG (5'-3'), and the reverse single-stranded DNA sequence is CTGGTAGAGTACGGCCGCTG (5'-3'). The forward single-stranded DNA sequence of NTC is ACGGGCGGCTATCGCTGACT (5'-3'), and the reverse single-stranded DNA sequence is AGTCAGCGATAGCCGCCCGT (5'-3').
[0161] The results showed that P8 generation late-generation nucleus pulposus progenitor cells were knocked out in the current generation. NFATC2 Following gene sequencing, the level of NFAT1 also decreased significantly. NFATC2 CRISPR-knockout enhances cell self-renewal capacity, monoclonal proliferation, and increases the proportion of Ki67-positive cells. Figure 6 (AD). This genetic intervention also alleviated cellular senescence, manifested as a decrease in SA-β-gal positive cells, P21 Cip1 and P16 INK4a Down, while LAP2 and Lamin B1 up. Figure 6 (Zhong EG). Although NFATC2 Knockout of NPPCs did not affect the osteogenic or adipogenic differentiation ability of primary NPPCs, but it promoted the chondrogenic differentiation ability of nucleus pulposus precursor cells, manifested as an increase in the diameter of chondrocyte spheroids. Figure 6 (HJ). RNA sequencing (RNA-seq) analysis revealed upregulation of differentially expressed genes associated with cell cycle progression and downregulation of differentially expressed genes associated with extracellular matrix degradation. Figure 6 (K and L). These transcriptomic changes are consistent with a decrease in the self-renewal and differentiation potential of nucleus pulposus precursor cells.
[0162] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. Any of the following applications: A1) The application of substances that reduce the content and / or activity of NFAT1 protein in delaying or assisting in delaying aging; A2) The application of substances that reduce the content and / or activity of NFAT1 protein in the preparation of products that delay or assist in delaying aging; A3) Inhibition NFATC2 Gene expression or knockout NFATC2 The application of genetic material in delaying or assisting in delaying aging; A4) Inhibition NFATC2 Gene expression or knockout NFATC2 The application of genetic material in the preparation of products that delay or assist in delaying aging.
2. The application according to claim 1, characterized in that: The aforementioned delay in aging refers to delaying the aging of the body, tissues, or cells; Alternatively, the tissue or cells may be intervertebral disc tissue or cells.
3. Any of the following applications: B1) The use of substances that reduce the content and / or activity of NFAT1 protein in the treatment or adjuvant treatment of intervertebral disc herniation; B2) The use of substances that reduce the content and / or activity of NFAT1 protein in the preparation of products for the treatment or adjunctive treatment of intervertebral disc herniation; B3) Inhibition NFATC2 Gene expression or knockout NFATC2 The application of genetic material in the treatment or adjuvant treatment of intervertebral disc herniation; B4) Inhibition NFATC2 Gene expression or knockout NFATC2 The application of genetic material in the preparation of products for the treatment or adjuvant treatment of intervertebral disc herniation; B5) The use of substances that reduce NFAT1 protein content and / or activity in the treatment or adjuvant treatment of intervertebral disc degeneration; B6) The use of substances that reduce the content and / or activity of NFAT1 protein in the preparation of products for the treatment or adjuvant treatment of intervertebral disc degeneration; B7) Inhibition NFATC2 Gene expression or knockout NFATC2 The application of genetic material in the treatment or adjuvant treatment of intervertebral disc degeneration; B8) Inhibition NFATC2 Gene expression or knockout NFATC2 The application of genetic material in the preparation of products for the treatment or adjuvant treatment of intervertebral disc degeneration.
4. The application according to claim 3, characterized in that: The intervertebral disc in question is a lumbar intervertebral disc.
5. A product containing a substance that reduces the content and / or activity of NFAT1 protein, or inhibits... NFATC2 Gene expression or knockout NFATC2 Genetic material.
6. Any of the following applications of NFAT1 protein or substances that increase the content or activity of said NFAT1 protein: C1) Constructing a model of senescent cells; C2) Products for constructing senescent cell models; C3) Screening or assisting in the screening of drugs that delay aging; C4) Products for preparing or assisting in the screening of drugs that delay aging; C5) Screening or assisting in the screening of drugs that delay intervertebral disc aging; C6) Products for preparing or assisting in the screening of drugs that delay intervertebral disc aging; C7) Screening or assisting in the screening of drugs for the treatment of intervertebral disc herniation; C8) Products for preparing or assisting in the screening of drugs for the treatment of intervertebral disc herniation.
7. The application according to claim 6, characterized in that: The aforementioned delay in aging refers to delaying the aging of the body, tissues, or cells; Alternatively, the cells may be intervertebral disc cells.
8. A product containing NFAT1 protein or a substance that increases the content or activity of said NFAT1 protein.
9. Substances or detectors for detecting NFAT1 protein content NFATC2 Any of the following applications of substances that affect gene expression levels: D1) Detection or auxiliary detection of the aging level of an organism, tissue, or cell; D2) Prepare products for detecting or assisting in the detection of aging levels in the body, tissues, or cells; D3) Screening or auxiliary screening of patients with aging of the body, tissues, or cells; D4) Prepare products for screening or assisting in screening patients with aging of the body, tissues or cells; D5) Diagnosis or auxiliary diagnosis of intervertebral disc herniation; D6) Prepare products for the diagnosis or auxiliary diagnosis of intervertebral disc herniation; D7) Screening or auxiliary screening for patients with intervertebral disc herniation; D8) Prepare products for screening or assisting in the screening of patients with intervertebral disc herniation; D9) Diagnosis or auxiliary diagnosis of intervertebral disc degeneration; D10) Products for the diagnosis or auxiliary diagnosis of intervertebral disc degeneration; D11) Screening or auxiliary screening for patients with intervertebral disc degeneration; D12) Products for screening or assisting in the screening of patients with intervertebral disc degeneration.