Application of sirt5 as a treatment target for abdominal aortic aneurysm

Abstract

The present application relates to a kind of SIRT5 as abdominal aortic aneurysm treatment target point application, it is related to biological medicine technical field.The present application first confirms that SIRT5 is significantly up-regulated in human abdominal aortic aneurysm tissue, animal model and pathological stimulation vascular smooth muscle cell expression, and closely related with vascular smooth muscle cell phenotype conversion, vascular smooth muscle cell specific knock-out SIRT5 can significantly inhibit the occurrence and development of AAA, and overexpression SIRT5 exacerbates the pathological process of AAA, suggests that SIRT5 can be used as the intervention target point of AAA, and in animal model, it is confirmed that MC3482 can significantly inhibit the formation of abdominal aortic aneurysm, provides a new drug intervention target point and candidate compound for abdominal aortic aneurysm, and lays a solid foundation for the treatment of abdominal aortic aneurysm and subsequent drug development.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of SIRT5 as a therapeutic target for abdominal aortic aneurysms. Background Technology

[0002] Abdominal aortic aneurysm (AAA) is an aneurysm-like lesion formed by abnormal local dilation of the abdominal aorta. It is usually caused by factors such as weak arterial walls, hypertension, and arteriosclerosis, and is common in the elderly and smokers. Early stages are asymptomatic, but rupture can be life-threatening. Currently, the clinical management of abdominal aortic aneurysms mainly relies on open surgery and endovascular repair, which is only suitable for patients whose aneurysm diameter meets the surgical criteria. For small / medium-sized aneurysms that do not meet the surgical criteria, clinical management only involves regular imaging monitoring, and effective drug intervention is lacking.

[0003] Existing research indicates that the pathological process of abdominal aortic aneurysms involves multiple stages, including phenotypic transformation of vascular smooth muscle cells, extracellular matrix degradation, and inflammatory infiltration. Currently reported molecular targets, such as matrix metalloproteinases (MMP-2, MMP-9), inflammatory factors (NF-κB, TNF-α, IL-6), and some non-coding RNAs, are mostly involved in systemic physiological functions, and targeted interventions are prone to systemic side effects, making clinical translation difficult. Therefore, identifying intervention targets that possess both tissue specificity and pathway specificity is a crucial problem that urgently needs to be solved in this field.

[0004] Sirtuin5 (SIRT5) is a type of NAD5. + SIRT5 is a protein-dependent lysine deacylase, primarily located in mitochondria, involved in regulating various metabolic processes. Current technology has only reported the role of SIRT5 in diseases such as tumors; its function, mechanism, and value as a therapeutic target in abdominal aortic aneurysms have not been publicly reported. Summary of the Invention

[0005] The purpose of this invention is to provide new uses for SIRT5 in the treatment of abdominal aortic aneurysms, including as a therapeutic target and drug application and drug screening methods based on this target.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] The first aspect of the present invention provides the use of SIRT5 as a target in the preparation of a medicament for treating abdominal aortic aneurysm, wherein the medicament treats abdominal aortic aneurysm by inhibiting the expression or activity of SIRT5, and the medicament is a SIRT5-specific inhibitor MC3482.

[0008] Furthermore, in the application technology solution, the drug contains a gene expression inhibitor targeting SIRT5, which inhibits the expression of SIRT5 in vascular smooth muscle cells.

[0009] Furthermore, in the application technology solution, the gene expression inhibitor is selected from shRNA or CRISPR-Cas9 system.

[0010] A second aspect of the present invention provides a method for screening candidate drugs for the treatment of abdominal aortic aneurysms, the method comprising detecting the inhibitory effect of candidate substances on SIRT5 expression or activity.

[0011] In summary, this application includes at least one of the following beneficial technical effects:

[0012] 1. This invention is the first to demonstrate that SIRT5 is upregulated in human abdominal aortic aneurysm tissue, animal models, and pathologically stimulated vascular smooth muscle cells, and is closely related to vascular smooth muscle cell phenotypic transformation. Specific knockout of SIRT5 in vascular smooth muscle cells can significantly inhibit the occurrence and development of AAA, while overexpression of SIRT5 exacerbates the pathological process of AAA. This invention constructs SIRT5 conditional knockout and overexpression mice, and combined with the tissue-specific Cre system, demonstrates for the first time in vivo that SIRT5 drives the occurrence and development of abdominal aortic aneurysms by regulating vascular smooth muscle cell phenotypic transformation.

[0013] 2. This invention is the first to demonstrate in an animal model that the SIRT5-specific small molecule inhibitor MC3482 can significantly inhibit the formation of abdominal aortic aneurysms, providing a novel drug intervention target and candidate compound for abdominal aortic aneurysms.

[0014] 3. This invention provides a drug screening method targeting SIRT5, laying a solid foundation for subsequent drug development. Attached Figure Description

[0015] Figure 1 The graph shows the analysis results and verification results of Example 1. Figure 1 A is a plot showing the SIRT5 expression levels in a human sample dataset. Figure 1 B is a plot showing the SIRT5 expression level in the dataset of the mouse Ang II infusion-induced AAA model. Figure 1 C represents the SIRT5 expression level in a dataset of AngII-stimulated human aortic smooth muscle cells. Figure 1 D shows the protein band results for the control group and the AAA model group in C57BL / 6J mice. Figure 1 E represents the protein expression levels of SIRT5 in the aortic tissue of C57BL / 6J mice in the control group and AAA model group. Figure 1F represents the mRNA expression levels of SIRT5 in the aortic tissue of C57BL / 6J mice in the control group and AAA model group. Figure 1 G is for ApoE - / - Protein banding results for the control group and the AAA model group in mice. Figure 1 H represents ApoE - / - Plots showing the protein expression levels of SIRT5 in the aortic tissue of mice in the control group and the AAA model group. Figure 1 I is ApoE - / - In mice, the mRNA expression levels of SIRT5 in the aortic tissue of the control group and the AAA model group are shown in the figure. Figure 1 Figure J shows the results of immunofluorescence staining to detect the localization and expression of SIRT5 (red) in the aortic tissue of C57BL / 6 mice. Figure 1 K represents the immunofluorescence staining detection of SIRT5 (red) in ApoE. - / - Image showing the localization and expression results in mouse aortic tissue;

[0016] Figure 2 The experimental results and analysis graphs for Example 2 are shown below. Figure 2 A is a flowchart of the mouse abdominal aortic aneurysm model construction process. Figure 2 B is the survival curve of the two groups of mice. Figure 2 C is a statistical graph showing the tumor formation rate of AAA in the two groups of mice. Figure 2 D shows a gross representation of the aorta in both groups of mice. Figure 2 E is a graph showing the quantitative analysis of the aortic wet weight / body weight ratio in the two groups of mice. Figure 2 F is a quantitative analysis diagram of the maximum outer diameter of the aorta in the two groups of mice. Figure 2 G shows HE, EVG, and MT staining images of aortic tissue from two groups of mice. HE staining shows the overall and local structures, EVG staining shows elastic fibers (black), and Masson staining shows collagen fibers (blue). Figure 2 H represents the quantitative statistics of elastic fiber fracture counts based on EVG staining. Figure 2 Figure I shows the percentage and quantitative analysis of collagen deposition area in the aorta of mice in each group.

[0017] Figure 3 The figure shows the experimental results of Example 3, in which, Figure 3 Figure A shows the HVSMC migration ability detection results of the control group (shCon) and the SIRT5 knockdown group (shSirt5). Figure 3 B is a quantitative statistical chart of migration rate in the migration experiment. Figure 3 C shows the fluorescence images of Movas cells in the control group and SIRT5 knockdown group detected by the EdU incorporation experiment (EdU-positive cells are red, and the cell nuclei are counterstained with DAPI; scale bar = 100 μm). Figure 3 D is a quantitative statistical chart of the percentage of EdU-positive cells. Figure 3 E shows the distribution of F-actin and cell morphology of four groups of HVSMCs observed by phalloidin staining (scale bar = 50 μm).

[0018] Figure 4 The experimental results and analysis graphs for Example 4 are shown below. Figure 4 A is Sirt5 SMKI Flowchart for constructing mouse and corresponding control group abdominal aortic aneurysm models. Figure 4 B is Sirt5 SMKI Survival curves of mice and their control mice. Figure 4 C is a statistical graph showing the tumor formation rate in the two groups of mice. Figure 4 D is a gross representation of the aorta of the two groups of mice. Figure 4 E is a graph showing the quantitative analysis of the aortic wet weight / body weight ratio in the two groups of mice. Figure 4 F represents the quantitative analysis of the maximum outer diameter of the aorta in the two groups of mice. Figure 4 G shows HE, EVG, and MT staining images of aortic tissue from two groups of mice. HE staining shows the overall and local structures, EVG staining shows elastic fibers (black), and Masson staining shows collagen fibers (blue). Figure 4 H is a quantitative statistical graph of the number of elastic fiber fractures based on EVG staining. Figure 4 Figure I shows the quantitative analysis of the percentage of collagen deposition area in the aorta of mice in each group.

[0019] Figure 5 The experimental results and analysis graphs for Example 5 are shown below. Figure 5 Figure A shows the HVSMC migration ability detection results of the control group (oeCon) and the SIRT5 overexpression group (oeSirt5). Figure 5 B is a quantitative statistical chart of migration rate in the migration experiment. Figure 5 C represents the fluorescence images of Movas cells in the control group and the SIRT5 overexpression group, as detected by the EdU incorporation experiment. Figure 5 D is a quantitative statistical chart of the percentage of EdU-positive cells. Figure 5 E is a diagram showing the distribution of F-actin and cell morphology of four groups of HVSMCs after phalloidin staining.

[0020] Figure 6 The experimental results and analysis graphs for Example 6 are shown below. Figure 6 A is the flowchart of the mouse drug treatment experiment. Figure 6 B is the survival curve of mice in each group. Figure 6 C is a statistical graph showing the tumor formation rate of AAA in each group of mice. Figure 6 D shows a gross representative image of the aorta of each group of mice. Figure 6 E is a graph showing the quantitative analysis of the aortic wet weight / body weight ratio in each group of mice. Figure 6 F is a quantitative analysis diagram of the outermost diameter of the aorta in each group of mice. Figure 6 G shows representative images of aortic tissue from each group of mice stained with HE, EVG, and MT. HE staining shows the overall and local structures, EVG staining shows elastic fibers (black), and Masson staining shows collagen fibers (blue). Figure 6 H is a quantitative statistical graph of the number of elastic fiber fractures based on EVG staining. Figure 6 I represents the quantitative analysis of the percentage of collagen deposition area in the aorta of mice in each group. Detailed Implementation

[0021] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments and accompanying drawings. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. Modifications or equivalent substitutions made by those skilled in the art based on their understanding of the technical solutions of this invention, without departing from the spirit and scope of the invention, should all be covered within the protection scope of this invention.

[0022] Unless otherwise specified, the reagents, instruments and equipment used in the following examples are all commercially available products. Other specific conditions not specified shall be performed in accordance with conventional conditions or the conditions recommended by the manufacturer.

[0023] Unless otherwise specified, the Chinese definitions of chemical abbreviations and English translations in this application shall be based on the generally accepted understanding in the industry.

[0024] All experimental data in all embodiments of this application were statistically analyzed and graphically plotted using GraphPadPrism 10.0 software (GraphPad Software, USA). Image data were quantitatively analyzed using ImageJ software (National Institutes of Health, USA). All image analyses were performed independently by two observers unaware of the experimental groupings, and the average value was used for subsequent statistical analysis.

[0025] Quantitative data are expressed as mean ± standard error (mean ± SEM). The sample size (n) for each group is indicated in the corresponding figure caption. All experiments were independently repeated three times to ensure the reproducibility of the results.

[0026] When comparing two groups, if the data are normally distributed and have homogeneous variances, use the unpaired two-tailed Student's test; if the variances are unequal, use Welch's correction followed by a t-test. For comparisons among multiple groups, use one-way ANOVA or two-way ANOVA, and then select an appropriate post-hoc test method based on the experimental design: use Dunnett's test when comparing each group with a single control group; use Tukey's test when performing pairwise comparisons among all groups; and use Bonferroni correction for multiple comparisons when there are two or more grouping factors.

[0027] For categorical variables (such as the incidence of abdominal aortic aneurysm and mortality rate), Fisher's exact test (when the total sample size is small or the theoretical frequency is <5) or Pearson's chi-square test were used to analyze differences between groups, depending on the sample size and theoretical frequency. Time-dependent data (such as survival curves) were analyzed using the Kaplan-Meier method, and the log-rank test was used to compare differences between groups.

[0028] All statistical analyses were performed using two-tailed tests. A p-value < 0.05 was considered statistically significant, and the significance level was indicated by the specific p-value.

[0029] I. Implementation Examples

[0030] Example 1

[0031] This embodiment analyzes the expression characteristics of SIRT5 in abdominal aortic aneurysms.

[0032] 1. GEO Database Analysis

[0033] To clarify the expression characteristics of SIRT5 in AAA lesions, stratified analysis was performed using three independent GEO datasets. Gene expression profile data were obtained from the NCBI GEO database (https: / / www.ncbi.nlm.nih.gov / geo / ). R 4.3.2, combined with Bioconductor toolkits, was used for automated data acquisition and preprocessing, with fixed workflows and parameters to ensure reproducibility.

[0034] The specific process is as follows: (1) Data acquisition: Use the getGEO function of the GEOquery package to download the SeriesMatrix File and the corresponding GPL platform annotation file. The annotation file is only used for one-to-one mapping between probe and gene name, and no additional screening is performed. (2) Data format conversion: Based on the ExpressionSet object returned by getGEO, use exprs() to extract the expression matrix and pData() to extract sample grouping and phenotypic information, without expanding the information. (3) Probe annotation and gene conversion: Convert the probe into a Gene Symbol according to the GPL annotation file; when there are multiple probes for a single gene, take the median or average value as the final expression value. The two methods are not mixed.

[0035] Table 1 Data Availability Information Table

[0036] serial number Species Information source Persistent ID / URL GSE183464 Homo sapiens GEO database https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE183464 GSE175683 Mus musculus GEO database https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE175683 GSE291516 Homo sapiens GEO database https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE291516

[0037] The analysis results for the human sample dataset GSE183464 (including 7 AAA samples and 7 normal control samples) are as follows: Figure 1 As shown in Figure A, there was no significant difference in the expression level of SIRT5 in AAA tissues. Further analysis was conducted at the animal model level using the GSE175683 dataset of a mouse Ang II infusion-induced AAA model. The results are as follows... Figure 1 As shown in Figure B, the mRNA level of SIRT5 in the aortic tissue of the AAA model group mice was significantly upregulated compared with the control group. At the cellular level, focusing on the main effector cells of the blood vessel wall, the human aortic smooth muscle cell (HASMC) dataset GSE291516 was analyzed, and the results are as follows: Figure 1 As shown in Figure C, the expression level of SIRT5 in HASMCs was significantly increased after Ang II intervention, which verifies its expression regulation at the cellular level.

[0038] 2. Animal model validation

[0039] To further validate the correlation between SIRT5 and AAA in vivo, C57BL / 6J wild-type mice and ApoE gene knockout mice were selected, respectively. - / - A mouse AAA model was established by implanting an AngII slow-release pump. After 4 weeks of routine feeding, aortic tissue was collected from the mice to detect the mRNA and protein expression levels of SIRT5.

[0040] The specific process is as follows:

[0041] 2.1 Establishment of animal models

[0042] Animal source: Male C57BL / 6J mice aged 6-8 weeks were provided by Beijing Vital River Laboratory Animal Technology Co., Ltd.; 6-8 week old male ApoE gene knockout (ApoE) mice were used. - / - Mice with a genetic background of C57BL / 6N were provided by Suzhou Cyagen Biotechnology Co., Ltd., and all animal experiments were conducted in accordance with the guidelines of the Animal Ethics Committee of Army Medical University.

[0043] Husbandry environment: The experimental mice were housed in a specific pathogen-free environment. The husbandry conditions were strictly controlled at a constant temperature of 22°C and a constant humidity of 60%-65%, and a 12-hour light-dark cycle was maintained. The animals had free access to sterilized drinking water and ordinary maintenance feed.

[0044] After purchasing the mice, they were first fed for two weeks to adapt. The experiment was conducted at 8-10 weeks of age and then randomly divided into the following two experimental groups: (1) Saline group (referred to as sham operation group, control group or control group); (2) Angiotensin II induction group (AngII, referred to as AAA model group).

[0045] AngII solution preparation: The required dosage per animal was precisely calculated based on the animal's body weight and a dosing rate of 1.44 mg / kg / day. AngII powder (#A107852, Aladdin) was dissolved in a mixed solvent with a fixed ratio of 5% DMSO, 5 μL PBS, and 95% physiological saline. After dissolution, the solution was placed in a 37°C incubator and thoroughly shaken until the powder was completely dissolved and no residue remained.

[0046] Osmotic pump implantation surgery: The prepared AngII solution was slowly filled into the implantable micro-osmotic pump (#RWD2004W, Reward). After filling, the pump was placed back in a 37°C incubator overnight to complete activation. The experimental mice were anesthetized with isoflurane. After the anesthesia took effect, the postauricular area was thoroughly prepared and routinely disinfected. An incision of appropriate length was made in the disinfected area behind the ear, and the subcutaneous tissue was bluntly dissected. The drug-filled osmotic pump was implanted subcutaneously, with the drug outlet facing inward to avoid reverse placement.

[0047] Postoperative management: After implantation, confirm that the osmotic pump can move slightly under the skin without jamming or embedding, and then close the surgical incision layer by layer with sutures. After surgery, transfer the mice to a warming blanket and monitor them at a constant temperature until they are fully awake and resume spontaneous activity. Then transfer them to a normal feeding environment. The saline group is infused with saline. Four weeks after surgery, the aortic tissue of the mice is collected according to standard laboratory methods.

[0048] 2.2 Experimental Methods

[0049] 2.2.1 Western blot experiment

[0050] (1) Protein extraction: The lysis buffer was prepared fresh and used immediately. Freshly prepared protease inhibitor (#5892970001, Roche) was added immediately before use to avoid inactivation of the inhibitor due to pre-preparation. The cell pellet was resuspended in the above-prepared lysis buffer and lysed on ice throughout the process. Low temperature operation prevented protein degradation.

[0051] (2) Protein quantification and sample preparation: The total protein concentration in cell lysate was determined using the BCA method (#P0010, Beyotime). The detection procedure strictly followed the standard procedure of the kit. After the determination, the final concentration of all samples was adjusted to ensure that the protein concentration of each group of samples was completely consistent, thus eliminating the interference of concentration differences on the experimental results.

[0052] (3) Electrophoresis and transfer: Equal amounts of protein were loaded onto each group. Based on the molecular weight of the target protein, a 4-12% SDS-polyacrylamide gel (#F15412MGel, ACE) was selected to complete the protein electrophoresis separation. After electrophoresis, the separated protein bands were transferred to a PVDF membrane. The transfer parameters were fixed to ensure that the transfer efficiency of each group was consistent.

[0053] (4) Immunoassay: After the membrane transfer is completed, 2% bovine serum albumin or 5% skim milk powder is used to block the membrane for 1-2 hours at room temperature to block non-specific binding sites. The specific primary antibody corresponding to the target protein (SIRT5, #8782S, CST; GAPDH, #10494, Proteintech) is added and incubated overnight at 4°C to ensure sufficient antigen-antibody binding. After the primary antibody incubation is completed, the matching secondary antibody is added and incubated at room temperature to complete the antibody binding labeling. The protein band is developed using ECL luminescent substrate from MCE to clearly display the target protein band. The gray value of the band is quantified using ImageJ software. GAPDH is used as an internal reference protein, and the quantitative results are standardized and corrected to ensure the comparability of the results.

[0054] 2.2.2 RNA extraction and real-time quantitative PCR (qPCR)

[0055] Total RNA was extracted from aortic tissue or VSMCs using Tripe separation reagent according to the manufacturer's instructions. The mRNA was reverse transcribed into cDNA using a reverse transcription kit (211000, Toyobo). Semi-quantitative RT-PCR amplification was performed using SYBR Green Mix (4913914001, Roche). The mRNA level was calculated based on the threshold cycle number and standardized using the 18S rRNA Ct value as an internal control. Three technical replicates were set up for each sample.

[0056] Primer sequences are shown in Table 2:

[0057] Table 2 Primer sequence listing

[0058] Gene Forward primer (5′-3′) SEQ ID NO Reverse primer (5′-3′) SEQ ID NO Homo 18s GGACCAGAGCGAAAGCATTTGCC 1 TCAATCTCGGGTGGCTGAACGC 2 Homo Sirt5 GCCATAGCCGAGTGTGAGAC 3 CAACTCCACAAGAGGTACATCG 4 Mus 18s CATTCGAACGTCTGCCCTATC 5 CCTGCTGCCTTCCTTGGA 6 Mus Sirt5 CTCCGGGCCGATTCATTTCC 7 GCGTTCGCAAAACACTTCCG 8

[0059] 2.2.3 Immunofluorescence staining

[0060] Mouse aortic tissue samples were collected, fixed with 4% paraformaldehyde, and routinely embedded in paraffin to prepare continuous tissue sections with a thickness of 4 μm. These sections were then attached to anti-detachment glass slides to prevent detachment. The sections were baked in a 60°C oven for 2 hours, followed by dewaxing with xylene, graded hydration with ethanol, and washing with PBS 2-3 times. The treated sections were then ready for use.

[0061] Formaldehyde-fixed tissue sections were permeabilized with 0.3% Triton solution, followed by washing three times with PBS for 5 minutes each time. Blocking with 5% BSA at room temperature blocked non-specific fluorescent binding sites, reducing background interference. Specific primary antibodies were added, and the sections were incubated overnight at 4°C. The next day, the sections were warmed to room temperature for 1 hour to improve antigen-antibody binding efficiency. Unbound primary antibodies (SIRT5, #15122, Proteintech; αSMA, ab7817, Abcam) were thoroughly washed with PBS to remove them. Fluorescent secondary antibodies (#A11029, #A11037, Thermo Fisher) were added, and the sections were incubated at room temperature in the dark for 40 minutes to prevent fluorescence quenching. Cell nuclei were stained with DAPI for 10 minutes, followed by mounting. A DAPI-containing anti-fluorescence quenching mounting solution can be used directly. An inverted fluorescence microscope (TE2000-U; Nikon, Tokyo, Japan) with NIS-Elements BR version 3.2 software (Nikon) was used to observe tissue fluorescence expression and acquire images.

[0062] 2.3 Experimental Results

[0063] Experimental results are as follows Figure 1 As shown in DK, where... Figure 1 D shows the protein band results of the Western blot experiment in C57BL / 6J mice, including the control group and the AAA model group (n=4). Figure 1 E represents the protein expression level of SIRT5 in the aortic tissue of C57BL / 6J mice (n=4) as detected by Western blotting in the control group and AAA model group. Figure 1 F is a graph showing the mRNA expression levels of SIRT5 in the aortic tissue of C57BL / 6J mice, in the control group and the AAA model group, as detected by qPCR (n=5). Figure 1 G is for ApoE - / - Protein banding results of WB experiments in mice, including the control group and the AAA model group (n=4). Figure 1 H represents ApoE - / -In mice, Western blot analysis was performed on the expression levels of SIRT5 in the aortic tissue of the control group and the AAA model group (n=4). Figure 1 I is ApoE - / - In mice, the mRNA expression levels of SIRT5 in the aortic tissue of the control group and the AAA model group were detected by qPCR (n=5). Figure 1 J shows the results of immunofluorescence staining to detect the localization and expression of SIRT5 (red) in the aortic tissue of C57BL / 6 mice (n=3, scale bar=25μm). Figure 1 K represents the immunofluorescence staining detection of SIRT5 (red) in ApoE. - / - Localization and expression results in mouse aortic tissue (n=3, scale bar=25μm).

[0064] As shown in the figure, the gray value of the SIRT5 protein band was significantly higher in C57BL / 6J mice than in the control group. qPCR detection further confirmed this trend at the mRNA level. Immunofluorescence staining results visually confirmed the above conclusions. In the control group, SIRT5 was lowly expressed in the aortic tissue, with weak fluorescence signal, while the SIRT5 fluorescence signal intensity was significantly enhanced in the aorta of the AAA model group. - / - In mice, qPCR and Western blot analyses also confirmed that the mRNA and protein expression levels of SIRT5 in the aortic tissue of the AAA model group were significantly higher than those in the control group; immunofluorescence staining further showed that ApoE - / - The fluorescence signal of SIRT5 in the aortic aneurysm wall tissue of the mouse AAA model group was significantly enhanced compared with that of the control group, and it co-localized with the vascular smooth muscle cell (VSMC) marker αSMA. The positive signal was mainly distributed in the tunica media smooth muscle layer.

[0065] The above results indicate that SIRT5 is upregulated in AAA lesions and is closely related to VSMC.

[0066] Example 2

[0067] This embodiment describes the construction and phenotypic analysis of vascular smooth muscle cell (VSMC)-specific SIRT5 knockout mice.

[0068] 1. Construction of conditional gene knockout mice

[0069] (1) Sirt5 conditional knockout mice

[0070] Sirt5 gene knockout mice were constructed by Cyagen Biosciences (Suzhou, China) using CRISPR / Cas9 technology combined with an embryonic stem cell targeting strategy. Specifically, guide RNA and targeting vectors were designed to target the mouse Sirt5 gene (NCBI Gene ID: 68346). Two loxP sites were inserted into mouse embryonic stem cells with a C57BL / 6N background, successfully establishing Sirt5 conditional knockout mice (strain name: C57BL / 6N-Sirt5). em1Cflox / Cya; Product No.: CKOCMP-68346-Sirt5-B6N-VA), referred to as Sirt5 flox / flox A mouse carrying the fluxed allele of the Sirt5 gene, when mated with a tissue-specific Cre transgenic mouse, can achieve Sirt5 gene knockout in a specific cell type.

[0071] (2) Sirt5 conditionally overexpressing mice

[0072] Sirt5 conditionally overexpressing mice were constructed by Cyagen Biosciences Co., Ltd. (Suzhou, China) using CRISPR / Cas9-mediated ROSA26 site-directed knock-in technology. The specific strategy involved microinjecting a gRNA targeting the ROSA26 gene (sequence: CTCCAGTCTTTCTAGAAGATGGG), Cas9 mRNA, and a donor vector containing the expression cassette "CAG promoter-loxP-PGK-Neo-6×SV40polyA-loxP-Kozak sequence-mouse Sirt5 CDS-WPRE-BGH polyA" into mouse zygotes. Homologous recombination was then used to integrate the target expression cassette into the ROSA26 gene locus. PCR and sequencing confirmed the correct targeting, resulting in the first F0 generation of mice. These mice were then crossbred with wild-type mice to verify germline transmission, establishing a stable and genetically inherited Sirt5-CAG-LSL (LoxP-Stop-LoxP) strain, denoted as Sirt5. KI / KI Mice.

[0073] (3) VSMC-specific knockout / overexpression mice

[0074] To obtain VSMC-specific Sirt5 knockout and overexpression mice, we used the above Sirt5... flox / flox Or Sirt5 KI / KI Mice were mated with Tagln-Cre transgenic mice (Cyagen Biosciences). Through two generations of hybridization, the Sirt5 genotype was ultimately obtained. flox / flox Tagln-Cre + The experimental group mice (hereinafter referred to as Sirt5) SMKO ) and its littermate control Sirt5flox / flox Tagln-Cre - Mouse; Sirt5 KI / KI Tagln-Cre + The experimental group mice (hereinafter referred to as Sirt5) SMKI ) and its littermate control Sirt5 KI / KI Tagln-Cre - Mice.

[0075] Because of the protective effect of estrogen against cardiovascular disease, only male animals were used to eliminate the effects of the hormone. The control group mice used in the experiment were littermates without carrying Cre, and were randomly assigned to each experimental group.

[0076] All mice were genotyped by PCR. Primer and sequence information are shown in Table 3.

[0077] Table 3 Primer sequence listing

[0078]

[0079] 2. Construction and phenotypic analysis of abdominal aortic aneurysm model

[0080] To investigate the role of smooth muscle-derived SIRT5 in the pathogenesis of AAA, this invention uses a control group (Sirt5) flox / flox ) and Sirt5 SMKO Mice were given AngII to induce AAA model, and the sham-operated group was treated with saline as a control. The experimental procedure is as follows: Figure 2 As shown in A, the model was established with reference to Example 1.

[0081] 2.1 Experimental Methods

[0082] 2.1.1 Survival Experiment

[0083] The survival rate of the two groups of mice was observed over a 28-day period.

[0084] 2.1.2 Evaluation of aortic disease models

[0085] (1) General observation and measurement;

[0086] (2) After euthanizing the mice, quickly dissect the abdominal and thoracic cavities of the mice, carefully peel off and remove the surrounding attached organs such as liver and kidneys, fully expose the aorta, completely separate the aortic tissue, and avoid damaging the blood vessel wall during the separation process; after separation, observe each segment of the ascending aorta, aortic arch, thoracic aorta, suprenal abdominal aorta, and infrarenal abdominal aorta in turn to assess the integrity, morphology and structure of each segment and the presence of any abnormal lesions, so as to ensure the validity of subsequent experimental samples;

[0087] (3) Collect overall images of the aorta and preserve morphological data;

[0088] (4) Two observers who were completely unaware of the experimental groupings were selected, and the diameter of each segment of the aorta was independently measured using vernier calipers. The average diameter of each group was calculated and compared between groups. For the AngII-induced abdominal aortic aneurysm model, the outer diameter of the largest dilated part of the abdominal aorta below the kidney was measured.

[0089] (5) Aortic weight measurement: After separation, the aortic tissue was quickly rinsed with pre-cooled PBS to remove residual blood; the tissue surface moisture was gently blotted dry with sterile gauze, and the entire process was performed on ice to ensure sample freshness. The processed tissue was placed on a microbalance with an accuracy of 0.1 mg and weighed wet. The absolute weight of the aorta for each mouse was recorded, and the ratio of aortic weight to body weight (mg / g) was calculated simultaneously to assess the degree of aortic tissue proliferation and remodeling. Each sample was weighed three times, and the average value was taken as the final data.

[0090] (6) Disease definition criteria: Abdominal aortic aneurysm lesions were defined as those whose aortic diameter was ≥ 1.5 times the average diameter of the corresponding segment in mice with the same genetic background. The incidence of abdominal aortic aneurysms in each group of mice was statistically analyzed, and the data were summarized.

[0091] (7) Sample allocation: 1) Molecular biological detection: Complete blood vessel segments were homogenized for subsequent Western blot, RNA sequencing, metabolomics sequencing and other experiments; 2) Histopathological evaluation: Vascular lesion areas were selected for immunofluorescence staining, EVG staining, HE staining and Masson staining; corresponding anatomically matched areas were selected for control blood vessels to ensure consistency of controls.

[0092] 2.1.3 Hematoxylin-eosin staining (HE staining)

[0093] HE staining of the aorta was performed using a HE staining kit (G1120, Solarbio, China). Routine section preparation, dewaxing, and hydration were performed. The hydrated sections were immersed in Mayer's hematoxylin staining solution for 3 minutes to stain the nuclei. Excess stain was removed by rinsing with running water, followed by immersion in a blue reversion solution for 10-15 seconds to ensure clear blue nuclei. After rinsing again with running water, the sections were rapidly dehydrated with anhydrous ethanol, and excess liquid was aspirated. Eosin solution was added to cover the tissue, and incubation was performed for 1 minute to stain the cytoplasm. Excess eosin was removed by rinsing with anhydrous ethanol, followed by three gradient dehydration steps with anhydrous ethanol, clearing with xylene, and finally mounting with neutral resin.

[0094] 2.1.4 Staining of elastic fibers (Verhoeff Van Gieson / EVG staining)

[0095] Aortic EVG staining was performed using an EVG staining kit (ab150667, Abcam, USA). Hydrated sections were placed in working concentration Verhoeff elasticity staining solution (containing hematoxylin, ferric chloride, and iodine) and incubated at room temperature for 45 minutes to stain elastic fibers. After rinsing with running water to remove excess staining solution, the sections were immersed in differentiation solution and rapidly lifted 15-20 times to differentiate until the elastic fibers were black and the background was grayish-white. The degree of differentiation was observed under a microscope, and after confirming it was appropriate, the sections were rinsed with running water to terminate differentiation. The sections were then treated with sodium thiosulfate solution for 1 minute to remove residual iodine solution and rinsed with running water. Finally, the sections were counterstained with Van Gieson staining solution (picric acid-acid fuchsin) for 5 minutes to make collagen fibers red and smooth muscle yellow. After staining, the sections were rapidly rinsed twice with 95% ethanol, dehydrated with anhydrous ethanol, cleared with xylene, and fixed with neutral resin.

[0096] 2.1.5 Masson / MT staining

[0097] Masson's trichrome staining kit (G1340, Solarbio) was used to stain collagen fibers to assess the degree of fibrosis and extracellular matrix deposition in aortic tissue. Paraffin sections were dewaxed and hydrated, then placed in Bouin's fixative (a mixture of saturated picric acid, formaldehyde, and glacial acetic acid) and mordanted at 60°C for 1 hour to enhance subsequent staining. After rinsing with running water until the yellow staining was completely removed, the sections were stained with Weigert's iron hematoxylin solution (a mixture of solutions A and B in equal proportions) for 5 minutes to stain the cell nuclei. After rinsing with running water for 10 minutes to remove excess stain, the sections were stained with Ponceau S-acid fuchsin solution for 5 minutes to make the cytoplasm and myofibrils appear red. After rapid rinsing with distilled water, phosphomolybdic acid solution was added for differentiation treatment for about 5 minutes. Under a microscope, the collagen fibers were observed to be a pale pink with a clear background. After discarding the phosphomolybdic acid, aniline blue solution was added directly for counterstaining for 3 minutes to make the collagen fibers appear blue. Rapid differentiation was performed with 1% glacial acetic acid solution for 1 minute to remove excess aniline blue. The sample was then mounted with dehydrated clear resin.

[0098] Staining results observed under a microscope: cell nuclei appear blue-black, cytoplasm, muscle fibers and erythrocytes appear red, and collagen fibers appear blue.

[0099] 2.2 Experimental Results

[0100] Experimental results are as follows Figure 2 As shown in BI, Figure 2 B is the survival curve of the two groups of mice (n=17-21 / group). Figure 2 C is a statistical graph of the tumor formation rate of AAA in the two groups of mice (n=17-21 / group). Figure 2 D shows a gross representation of the aorta in both groups of mice. Figure 2E is a quantitative analysis graph of the aortic wet weight / body weight ratio in two groups of mice (n=17-21 / group). Figure 2 F is a quantitative analysis chart of the maximum outer diameter of the aorta in two groups of mice (n=17-21 / group). Figure 2 G shows HE, EVG, and MT staining images of aortic tissue from two groups of mice. HE staining shows the overall and local structures (scale bar = 50 μm), EVG staining shows elastic fibers (black), and Masson staining shows collagen fibers (blue). Figure 2 H represents the quantitative statistics of the number of elastic fiber fractures based on EVG staining (n=6 / group). Figure 2 Figure I shows the percentage and quantitative analysis of collagen deposition area in the aorta of mice in each group (normalized with the control group, n=6 / group).

[0101] As shown in the figure, survival analysis revealed that after AngII induction, the mortality rate of the control group mice significantly increased during the experiment, while that of Sirt5 mice was significantly higher. SMKO The survival rate of mice was significantly improved compared with the control group (82.4% vs 100%). Figure 2 B); Statistical results on tumorigenesis showed that specific knockout of SIRT5 in VSMCs significantly reduced the AngII-induced AAA tumorigenesis rate (17.6% vs 5%). Figure 2 C) suggests that SIRT5-specific deletion in VSMC has an ameliorative effect on the occurrence of AAA.

[0102] Gross images of the aorta show that the abdominal aorta of the control group mice exhibited significant aneurysmal dilation after AngII induction, while Sirt5 mice showed... SMKO The degree of aortic dilation in mice was significantly reduced. Figure 2 D). Further quantitative analysis showed that, compared with the control group, Sirt5 SMKO The wet weight / body weight ratio of the aorta in mice was significantly reduced, and the maximum outer diameter of the aorta was significantly decreased. Figure 2 (EF), confirming that specific knockout of SIRT5 in VSMC effectively improved AngII-induced pathological aortic dilatation.

[0103] To further clarify the role of smooth muscle-derived SIRT5 in AAA tissue remodeling, this invention compared the control group and SIRT5... SMKO Mouse aortic sections were stained with hematoxylin and eosin (HE), EVG, and Masson staining.

[0104] HE staining results showed that, after AngII induction, the aortic wall of control mice was significantly thinned, the medial structure was disordered, and local aneurysmal dilatations were visible; while Sirt5 mice showed... SMKO The above pathological changes in mice were significantly reduced ( Figure 2G). EVG staining results showed that after AngII induction, the elastic fibers of the aorta in the control group mice were broken, sparse, and the structure was severely damaged; while Sirt5 SMKO The integrity of elastic fibers in mice was significantly improved. Figure 2 G). Quantitative analysis showed that Sirt5 SMKO The number of elastic fiber ruptures in mice was significantly reduced compared to the control group. Figure 2 H). Masson staining results showed that collagen deposition in the aortic wall of control mice was significantly increased after AngII induction; while Sirt5... SMKO Collagen deposition in mice was significantly reduced compared to the control group. Figure 2 G). Compared with the control group, Sirt5 SMKO The percentage of collagen deposition area in mice was significantly reduced. Figure 2 I).

[0105] The above results demonstrate that SIRT5 derived from VSMC plays a crucial pathogenic role in the occurrence and development of AAA.

[0106] Example 3

[0107] This embodiment verifies the function of SIRT5 in regulating phenotypic transformation of vascular smooth muscle cells (VSMCs) (knockdown inhibition).

[0108] 1. Lentiviral-mediated SIRT5 silencing and overexpression experiments

[0109] To clarify the effect of SIRT5 on VSMC function at the cellular level, this invention employs lentiviral vector-mediated gene manipulation technology. Lentiviral-mediated shRNA was used to achieve silencing and overexpression of the SIRT5 gene in human primary vascular smooth muscle cells (HVSMC, CM-H081, Pronosai) or mouse vascular smooth muscle cell lines (Movas, ZQ1056, Zhongqiao Xinzhou). Systematic evaluation was conducted using immunofluorescence and functional experiments. Due to the poor proliferation potential of HVSMC, the EdU proliferation assay was performed using Movas cells.

[0110] 1.1 Experimental Methods

[0111] 1.1.1 Construction and Synthesis of Lentiviral Vectors

[0112] The Sirt5 gene knockdown lentivirus (shSirt5) and the corresponding control knockdown lentivirus (shCon) were both synthesized by Shanghai Jikai Gene Chemical Technology Co., Ltd.; the Sirt5 gene overexpression lentivirus (oeSirt5) and the corresponding control overexpression lentivirus (oeCon) were also synthesized by the same company.

[0113] The target sequence information for each lentiviral vector is detailed in Table 4.

[0114] Table 4. Target sequence list for each lentiviral vector

[0115] Type Name / Identifier Identifier SEQ ID NO Lentivirus Human shSirt5 Target Seq:GCTATATTGTGGCCTGAAGCC 17 Lentivirus Human oeSirt5 Gene: SIRT5 (NM_012241)Promoter: UbiSelection: Puromycin - Lentivirus Mouse shSirt5 Target Seq: GCCTTTGCTCGAAACCCCATCA 18 Lentivirus Mouse oeSirt5 Gene: Sirt5 (NM_178848)Promoter: UbiSelection: Puromycin -

[0116] Cell infection and stable selection: HVSMCs in good growth condition were seeded into culture plates; according to the multiplicity of infection (MOI) of 10 to 30, the various lentiviruses listed in Table 4 above were added to the cell culture medium respectively; after infection and culture for an appropriate time, puromycin was added to the culture medium for selection to remove uninfected cells and obtain stably infected cell lines.

[0117] Infection efficiency verification: Cells stably infected after screening with puromycin were collected, and total RNA and total protein were extracted. The mRNA and protein expression levels of the Sirt5 gene in each group of cells were detected by real-time quantitative polymerase chain reaction and Western blotting, respectively, according to the detection method in Example 1. The infection efficiency and gene knockdown / overexpression effect of each lentivirus were evaluated by comparing the gene expression levels of the knockdown group and the control group, and the overexpression group and the control group.

[0118] 1.1.2 EdU Proliferation Experiment

[0119] Cell seeding: VSMCs were evenly seeded in confocal dishes; EdU labeling: EdU reagent was added and incubated for 2 hours; Fixation: 4% paraformaldehyde was used for fixation; Staining: Staining was performed according to the BeyoClick™ EdU Cell Proliferation Kit (Alexa Fluor 555, Beyotime) instructions; Image acquisition and analysis: Cell images were acquired under a fluorescence microscope and quantitative analysis was performed using ImageJ software.

[0120] The formula for calculating the EdU positivity rate is: EdU positivity rate = (number of EdU-positive cell nuclei / total number of cell nuclei) × 100%.

[0121] Three fields of view were randomly selected for each sample, and the average value was taken as the final result.

[0122] 1.1.3 Cell scratch assay (migration detection)

[0123] Cell seeding: Cells were seeded into 6-well plates and cultured until a fully confluent cell monolayer was formed; Scraping: Using a 200 μL sterile pipette tip, a vertical straight scratch was made in the center of each well, ensuring a uniform scratch width. After washing with PBS, cell intervention was performed; Image acquisition: Images of the scratched area were acquired at 0 and 24 hours after scratching using an inverted microscope (DMIL LED; Leica, Germany); Data analysis: The scratch area at each time point was measured using ImageJ software, and cell migration rate was calculated.

[0124] Migration rate calculation formula: Migration rate = (Initial scratch area - 24-hour residual scratch area) / Initial scratch area × 100%. Each sample corresponds to 3 fields of view, and the average value is taken as the final data.

[0125] 1.1.4 Staining of Phalloid Peptide

[0126] After gently washing HVSMCs with preheated PBS, fix them with 4% paraformaldehyde at room temperature for 15 minutes, wash them three times with PBS, add phalloidin working solution (C2207S, Beyotime) diluted to 100 nM with PBS containing 1% BSA, and incubate at room temperature in the dark for 45 minutes. After washing with PBS, add anti-fluorescence quenching mounting medium containing DAPI to mount the slides, and then observe them under a fluorescence microscope.

[0127] 2. Experimental Results

[0128] Experimental results are as follows Figure 3 As shown, where, Figure 3 Figure A shows the HVSMC migration ability detection results of the control group (shCon) and the SIRT5 knockdown group (shSirt5). Figure 3 B is a quantitative statistical chart of migration rate in the migration experiment. Figure 3 C shows the fluorescence images of Movas cells in the control group and SIRT5 knockdown group detected by the EdU incorporation experiment (EdU-positive cells are red, and the cell nuclei are counterstained with DAPI; scale bar = 100 μm). Figure 3 D is a quantitative statistical chart of the percentage of EdU-positive cells (n=3 / group). Figure 3 E shows the distribution of F-actin and cell morphology of four groups of HVSMCs observed by phalloidin staining (scale bar = 50 μm).

[0129] As shown in the figure, the migration ability test results indicated that the number of migrating cells in the SIRT5 knockdown group was significantly reduced compared to the control group. Figure 3 A), quantitative statistical analysis showed a significant decrease in the number of migrating cells ( ). Figure 3 B), indicating that silencing SIRT5 can significantly inhibit the migration ability of HVSMCs; the proliferation assay showed that in the EdU incorporation experiment, the number of EdU-positive cells (red) in the SIRT5 knockdown group was significantly reduced compared with the control group ( Figure 3 C), quantitative analysis showed that the percentage of EdU-positive cells was significantly lower than that of the control group, decreasing by approximately 20 percentage points. Figure 3 D), suggesting that silencing SIRT5 can inhibit DNA synthesis and cell proliferation in VSMCs.

[0130] Cell morphology observation showed that after PBS intervention, HVSMCs in the control group and knockdown group exhibited typical long spindle-shaped and fusiform morphology, with F-actin stress fibers arranged regularly and distributed orderly along the long axis of the cell; while after PDGF-BB intervention, cells in the control group showed a spread-out morphology, with slightly disordered F-actin arrangement, while after SIRT5 knockdown, cells showed a more contracted and slender morphology, with more dense F-actin arrangement. Figure 3 E), suggesting that SIRT5 knockdown has a certain impact on cytoskeleton structure.

[0131] These results indicate that silencing SIRT5 can promote the transformation of HVSMCs to a contractile phenotype while inhibiting their migration and Movas proliferation, suggesting that SIRT5 plays an important role in the phenotype regulation and functional maintenance of VSMCs.

[0132] Example 4

[0133] This embodiment describes the construction and phenotypic analysis of mice that specifically overexpress SIRT5 in vascular smooth muscle cells.

[0134] To further clarify the role of SIRT5 derived from vascular smooth muscle cells in the pathogenesis of AAA, this invention focuses on SIRT5. SMKI Mice and corresponding control groups were induced with AngII to construct the AAA model. The experimental procedure is as follows: Figure 4 A. The mouse model construction method is as described in Examples 1 and 2.

[0135] To clarify the role of smooth muscle-derived SIRT5 in the pathogenesis of AAA, this invention constructed VSMC-specific SIRT5 overexpressing mice in Example 2. This is because SIRT5 was overexpressed during the AngII induction experiment. SMKI The mortality rate of mice was significantly higher than that of the control group. By day 20, the number of surviving mice was insufficient to meet the statistical requirements for survival analysis. Therefore, all surviving mice were sampled and analyzed on day 21.

[0136] The experimental method in this embodiment is the same as that in Embodiment 2.

[0137] Experimental results are as follows Figure 4 As shown in BI, Figure 4 B is Sirt5 SMKI Survival curves of mice and their control mice. Figure 4 C is a statistical graph of tumor formation rate in two groups of mice (n=20-24 / group). Figure 4 D is a gross representation of the aorta of the two groups of mice. Figure 4 E is a quantitative analysis graph of the aortic wet weight / body weight ratio in two groups of mice (n=20-24 / group). Figure 4 F represents the quantitative analysis of the maximum outer diameter of the aorta in the two groups of mice (n=20-24 / group). Figure 4 G shows HE, EVG, and MT staining images of aortic tissue from two groups of mice. HE staining displays the overall and local structures (scale bar = 50 μm), EVG staining shows elastic fibers (black), and Masson staining shows collagen fibers (blue). Figure 4 H is a quantitative statistical chart of the number of elastic fiber fractures based on EVG staining (n=6 / group). Figure 4 Figure I shows the quantitative analysis of the percentage of collagen deposition area in the aorta of mice in each group (normalized compared with the control group, n=6 / group).

[0138] As shown in the figure, compared with the control group, Sirt5 SMKI The survival rate of mice induced by AngII was significantly reduced (91.7% vs 66.7%). Figure 4 B), the tumorigenesis rate of AAA was significantly increased (16.7% vs 47.6%). Figure 4 C), suggesting that specific overexpression of SIRT5 in VSMCs can exacerbate AngII-induced AAA.

[0139] Gross images of the aorta show Sirt5 after AngII induction. SMKI The degree of aneurysmal dilation of the abdominal aorta in mice was more significant than that in the control group. Figure 4 D); Quantitative analysis showed that SIRT5 SMKI The wet weight / body weight ratio of the aorta and the maximum outer diameter of the aorta were significantly increased in mice compared with the control group. Figure 4 (EF), confirming that specific overexpression of SIRT5 in VSMC can aggravate AngII-induced pathological aortic dilatation.

[0140] For Sirt5 SMKI Histological analysis of aortic sections from mice in both the control and general groups was performed to further clarify the effect of SIRT5 overexpression on aortic remodeling. HE staining results showed that SIRT5 expression increased after AngII induction. SMKI The aortic wall thinning and medial structure disorder were more severe in mice than in the control group. Figure 4 G); EVG staining and quantitative analysis showed that Sirt5 SMKI The number of elastic fiber ruptures in mice was significantly increased compared to the control group. Figure 4 GH), suggesting that SIRT5 overexpression can exacerbate elastic fiber degradation; Masson staining and quantitative analysis showed that Sirt5 SMKI The percentage of collagen deposition area in the aortic wall of mice was significantly higher than that in the control group. Figure 4 (G, I) confirmed that specific overexpression of SIRT5 in VSMCs can promote extracellular matrix remodeling.

[0141] Example 5

[0142] This embodiment verifies the function of SIRT5 in regulating phenotypic transformation of vascular smooth muscle cells (VSMCs) (promoted by overexpression).

[0143] To further verify the effect of SIRT5 on VSMC function at the cellular level, this invention utilizes a lentivirus-mediated overexpression vector to upregulate SIRT5 expression in HVSMCs, and conducts systematic evaluation through immunofluorescence, migration assays, etc. Since HVSMCs have poor proliferation potential, the proliferation experiment was still performed using Movas cells, and the experimental method is described in Example 3.

[0144] Experimental results are as follows Figure 5 As shown, where, Figure 5 Figure A shows the HVSMC migration ability detection results of the control group (oeCon) and the SIRT5 overexpression group (oeSirt5). Figure 5 B is a quantitative statistical chart of migration rate in the migration experiment (n = 3 / group). Figure 5 C shows the fluorescence images of Movas cells in the control group and SIRT5 overexpression group detected by the EdU incorporation experiment (EdU-positive cells are red, and the cell nuclei are counterstained with DAPI; scale bar = 100 μm). Figure 5 D is a quantitative statistical chart of the percentage of EdU-positive cells (n=3 / group). Figure 5 E shows the distribution of F-actin and cell morphology of four groups of HVSMCs observed by phalloidin staining (scale bar = 50 μm).

[0145] As shown in the figure, the migration ability test results indicated that the number of migrating cells in the SIRT5 overexpression group was significantly increased compared to the control group. Figure 5 A), quantitative statistical analysis showed a significant increase in the number of migrating cells (A), Figure 5 B) indicates that SIRT5 overexpression significantly promotes the migration ability of HVSMCs; proliferation assays were performed in Movas cells, and the EdU incorporation assay showed that the number of EdU-positive cells (red) in the SIRT5 overexpression group was significantly increased compared with the control group. Figure 5 C), quantitative analysis showed that the percentage of EdU-positive cells was significantly higher than that in the control group ( Figure 5 D), suggesting that overexpression of SIRT5 can promote DNA synthesis and cell proliferation in VSMCs.

[0146] Cell morphology observation showed that after PBS intervention, HVSMCs in both the control and overexpression groups still exhibited typical long spindle-shaped and fusiform morphologies, with F-actin stress fibers arranged regularly and distributed orderly along the long axis of the cell. Although the morphology of overexpressed VSMCs was slightly spread out, they still maintained a spindle shape. However, after PDGF-BB intervention, the control group cells showed a more spread-out morphology, and the F-actin arrangement was slightly disordered. After SIRT5 overexpression, the cell morphology was even more spread out, and the F-actin arrangement was even more disordered. Figure 5 E), suggesting that SIRT5 overexpression has a significant impact on cytoskeleton structure.

[0147] These results indicate that overexpression of SIRT5 can promote the transformation of VSMCs to a synthetic phenotype and enhance their migration and proliferation abilities, further confirming the key role of SIRT5 in the phenotype regulation and functional maintenance of VSMCs.

[0148] Example 6

[0149] This embodiment verifies the therapeutic effect of the SIRT5-specific inhibitor MC3482 on abdominal aortic aneurysm.

[0150] 1. Experimental Methods

[0151] The method for constructing the AngII-induced abdominal aortic aneurysm model is the same as in Example 1, and ApoE is propagated. - / - Mice were used as experimental subjects, and the SIRT5-specific inhibitor MC3482 was selected for treatment experiments. Compared with C57BL / 6J mice (wild-type) treated with ApoE alone, the treatment was more effective. - / - Establishing an AngII-induced AAA model in mice yields a higher and more stable AAA incidence rate, allowing for better observation of pharmacological effects. This model is used to identify ApoE. - / - The gene sorting sequence of mice is shown in Table 5 (two reverse primers share the same forward primer):

[0152] Table 5. Used for identifying ApoE - / - Mouse gene sorting sequence listing

[0153]

[0154] To investigate the therapeutic efficacy of the SIRT5 inhibitor MC3482 in AAA, this invention incorporates ApoE... - / - Mice were randomly divided into four groups: saline group (Saline), MC3482 treatment group (Saline + MC3482), angiotensin II-induced group (AngII), and AngII + MC3482 combined treatment group (AngII + MC3482). The experimental procedure is as follows: Figure 6 As shown in A, the specific grouping and treatment are shown in Table 6. Unless otherwise specified, the drugs and reagents are all conventional products obtained from ordinary commercial channels.

[0155] Table 6. Mouse Grouping Table

[0156] Grouping Handling method Saline Saline infusion + solvent control (Vehicle) Saline+MC3482 Normal saline infusion + MC3482 (5mg / kg / day) AngII AngII infusion (1.44 mg / kg / day, for 4 weeks) + solvent control AngII+MC3482 AngII infusion + MC3482 (5mg / kg / day)

[0157] Preparation of MC3482: Dissolve MC3482 (HY-112587, MCE, CAS: 2922280-89-0) powder in a mixed solvent consisting of 5% dimethyl sulfoxide (DMSO), 5% Tween-80, 30% polyethylene glycol 300 (PEG-300) and 60% physiological saline, and adjust the pH value to between 7.0 and 8.0.

[0158] Administration: Mice in the Saline+MC3482 group and the AngII+MC3482 group were administered the above-mentioned MC3482 solution via intraperitoneal injection at a dose of 5 mg / kg / day.

[0159] Experimental period: Drug injections were performed one day apart, with continuous intervention for 4 weeks; during the same period, mice in the Saline group and AngII group received corresponding volumes of solvent or physiological saline as controls.

[0160] Samples were analyzed four weeks after the intervention, using the same experimental method as in Example 2.

[0161] 2. Experimental Results

[0162] Experimental results are as follows Figure 6 As shown in BI, Figure 6 B shows the survival curves of mice in each group (n = 20 / group). Figure 6 C is a statistical graph of the AAA tumor formation rate in mice of each group (n=10-20 / group). Figure 6 D shows a gross representative image of the aorta of each group of mice. Figure 6 E is a quantitative analysis graph of the aortic wet weight / body weight ratio of mice in each group (n=10-20 / group). Figure 6 F is a quantitative analysis chart of the outermost diameter of the aorta in each group of mice (n=10-20 / group). Figure 6 G shows representative images of HE, EVG, and MT staining of aortic tissue from each group of mice. HE staining shows the overall and local structures (scale bar = 50 μm), EVG staining shows elastic fibers (black), and Masson staining shows collagen fibers (blue). Figure 6 H is a quantitative statistical chart of the number of elastic fiber fractures based on EVG staining (n=6 / group). Figure 6 I represents the quantitative analysis of the percentage of collagen deposition area in the aorta of mice in each group (normalized with the Saline group, n=6 / group).

[0163] As shown in the figure, survival analysis revealed a significantly higher mortality rate in the AngII group during the experiment, while the survival rate of mice treated with the AngII + MC3482 combination was significantly improved compared to the AngII group. Figure 6 B), and at the same time, the tumorigenesis rate statistics showed that MC3482 intervention significantly reduced the AngII-induced AAA tumorigenesis rate (B). Figure 6 C), indicating that MC3482 has an inhibitory effect on the occurrence of AAA.

[0164] Gross images of the aorta show that the abdominal aorta of mice in the AngII group exhibits obvious aneurysmal dilatation, while the degree of aortic dilatation is significantly reduced in the AngII + MC3482 combined treatment group. Figure 6 D); Further quantitative analysis showed that, compared with the Saline group, the AngII group had a significantly increased aortic wet weight / body weight ratio and a significantly widened maximum aortic diameter; while MC3482 intervention significantly reversed the above changes ( Figure 6 The Saline + MC3482 group showed no significant difference from the Saline group, suggesting that MC3482 treatment alone has no significant effect on normal aortic morphology.

[0165] To further evaluate the effect of MC3482 on AngII-induced aortic tissue remodeling, this invention performed tissue staining and immunohistochemical detection on aortic sections from four groups of mice.

[0166] HE staining results showed that the aortic structure of mice in the Saline group and the Saline+MC3482 group was intact, with clear three-layer structure; the aortic wall of the AngII group was significantly thinned, the medial structure was disordered, and obvious aneurysm-like dilatation was visible in some areas. The above pathological changes were significantly reduced in the AngII+MC3482 combined treatment group. Figure 6 G).

[0167] EVG staining results showed that the elastic fibers of the aorta in the AngII group mice were broken, sparse, and severely damaged; while the integrity of the elastic fibers in the AngII+MC3482 group was significantly improved. Figure 6 G); Quantitative analysis showed that the number of elastic fiber fractures in the AngII group was significantly higher than that in the Saline group, while the number of fractures was significantly reduced after MC3482 intervention. Figure 6 H).

[0168] Masson staining results showed that collagen deposition in the aortic wall was significantly increased in the AngII group, while collagen deposition in the AngII+MC3482 group was significantly reduced compared to the AngII group. Figure 6 G); Quantitative analysis showed that the percentage of collagen deposition area was significantly higher in the AngII group compared with the Saline group, while MC3482 intervention changed this trend ( Figure 6 I).

[0169] The above results indicate that the SIRT5-specific inhibitor MC3482 can significantly reduce the mortality rate and tumor formation rate of AAA mice, alleviate aortic dilation and pathological remodeling, suggesting that it can be used as a candidate drug for abdominal aortic aneurysms.

[0170] In summary, based on Examples 1-6, SIRT5 expression was significantly upregulated in mouse AAA models and Ang II-stimulated vascular smooth muscle cells. VSMC-specific knockout of SIRT5 significantly reduced AAA mortality, tumor formation rate, and aortic dilation, while overexpression of SIRT5 exacerbated pathological changes. Therefore, SIRT5 can serve as a therapeutic target and prognostic indicator for abdominal aortic aneurysms, thus compensating for the lack of effective molecular markers in existing technologies.

[0171] Secondly, through animal model validation, the SIRT5-specific small molecule inhibitor MC3482 can significantly inhibit the formation of abdominal aortic aneurysms, thus providing a novel drug intervention target and candidate compounds for abdominal aortic aneurysms, and offering a drug screening approach: contacting candidate drugs or substances with biological samples, detecting the inhibitory effect of candidate substances on SIRT5 expression or activity, determining whether the compound has a therapeutic effect on abdominal aortic aneurysms, and selecting candidate drugs or substances that can inhibit SIRT5 expression or activity as candidate drugs for the treatment of abdominal aortic aneurysms.

Claims

1. The application of SIRT5 specific inhibitors in the preparation of drugs for treating abdominal aortic aneurysms, characterized in that: The drug treats abdominal aortic aneurysms by inhibiting the expression or activity of SIRT5, and the SIRT5-specific inhibitor is MC3482.

Images