Glycoside hydrolase lysEC-18 and uses thereof
By developing the glycoside hydrolase LysEC-18 and its formulation, the problem of the spread of multidrug-resistant strains has been solved, providing a broad-spectrum and highly effective antibacterial solution suitable for applications in multiple fields.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NANLING WANZE MICROBIAL ENGINEERING RESEARCH INSTITUTE CO LTD
- Filing Date
- 2026-04-02
- Publication Date
- 2026-07-21
AI Technical Summary
Existing technologies are insufficient to effectively address the spread of multidrug-resistant strains, especially bacteremia caused by Escherichia coli and drug resistance problems in animal husbandry. Furthermore, the development speed of traditional antibiotics cannot keep up with the speed of drug resistance spread, necessitating the development of new broad-spectrum and highly effective antibacterial agents.
We developed the glycoside hydrolase LysEC-18 and its formulation, combined with an outer membrane permeability agent, for the preparation of antibacterial products, which showed broad-spectrum antibacterial ability against drug-resistant strains.
LysEC-18 exhibits significant antibacterial effects against a variety of drug-resistant strains. It possesses biological characteristics such as high activity in neutral to slightly acidic environments and a well-defined proliferation cycle, making it suitable for applications in multiple fields, including food preservation and animal husbandry.
Smart Images

Figure CN122427901A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to the glycoside hydrolase LysEC-18 and its applications. Background Technology
[0002] Against the backdrop of an increasingly severe global situation regarding bacterial resistance, the detection rate of multidrug-resistant strains continues to rise, seriously threatening global public health security. Studies have shown that the mortality rate of bacteremia caused by multidrug-resistant Enterobacteriaceae is significantly higher than that of non-resistant strains, especially infections caused by extended-spectrum β-lactamase-producing and carbapenem-resistant Enterobacteriaceae, which are closely associated with a higher risk of death. Furthermore, drug-resistant Escherichia coli are also important pathogens that hinder the growth and development of livestock and poultry, affecting the economic benefits of animal husbandry. Currently, the detection of drug-resistant Enterobacteriaceae from various sources is increasing, and the resistance genes they carry can spread to humans through contact transmission or food chain migration, exacerbating the spread of bacterial resistance and causing harm to multiple areas such as livestock farming, food safety, and healthcare. One study reported that 76.47% of E. coli isolated from pets and livestock carried extended-spectrum β-lactamase genes; another study isolated 14 strains of E. coli O157:H7 from retail raw beef samples, 8 of which exhibited multidrug resistance. In the post-antibiotic era, the development of new antibiotics cannot keep up with the spread of antibiotic resistance, so there is an urgent need to find a new type of antibacterial agent to combat the spread of bacterial resistance.
[0003] In recent years, bacteriophages have emerged as a promising alternative strategy to combat the spread of bacterial resistance. One of the core functional components of bacteriophage lysis is the lysin, with most bacteriophages functioning through the Holin-Lysin binary lysis system. Holin proteins form pores in the bacterial cell membrane, allowing the lysin to reach its target site in the peptidoglycan layer. This lysin hydrolyzes key chemical bonds in the peptidoglycan, disrupting cell wall integrity and promoting the release of progeny bacteriophages. Based on their target sites in peptidoglycan, lysins are mainly classified into three categories: amidases, endopeptidases, and glycosidases. Amidases primarily cleave the amide bond between N-acetylmuramic acid and L-alanine; endopeptidases act on the internal side chains of peptides or on peptide bridges connecting different peptide chains; and glycosidases hydrolyze the β-1,4 glycosidic bond between N-acetylmuramic acid and N-acetylglucosamine. Bacteriophage lysins are considered a novel strategy for preventing the spread of bacterial resistance due to their high antibacterial activity, broad bactericidal spectrum, and low likelihood of inducing resistance. Summary of the Invention
[0004] This invention aims to develop novel broad-spectrum and highly effective antibacterial agents. It comprehensively evaluates the antibacterial activity and environmental tolerance of the glycoside hydrolase LysEC-18, providing a new reference for the development of novel broad-spectrum and highly effective antibacterial agents.
[0005] The present invention provides a glycoside hydrolase LysEC-18, characterized in that: the DNA sequence of glycoside hydrolase LysEC-18 is shown in SEQ ID NO. 1.
[0006] Furthermore, the present invention also suggests the expression of cedar glycoside hydrolase LysEC-18, characterized by including primers as shown in SEQ ID NO. 2 and SEQ ID NO. 3.
[0007] Furthermore, this invention also suggests the application of the aforementioned glycoside hydrolase LysEC-18 in the preparation of antibacterial products.
[0008] Furthermore, the present invention also provides a formulation characterized by comprising the above-mentioned glycoside hydrolase LysEC-18 and an outer membrane permeabilizing agent.
[0009] Furthermore, this invention also suggests the application of the above-mentioned formulation in the preparation of antibacterial products.
[0010] The aforementioned antibacterial product is characterized in that it is an antibacterial drug;
[0011] Antimicrobial drugs also include pharmaceutically acceptable excipients.
[0012] The aforementioned antibacterial products are characterized in that they are disinfection / sterilization products;
[0013] Disinfectants / sterilizers also contain at least one of the following: stabilizers, pH adjusters, corrosion inhibitors, and solvents.
[0014] The aforementioned antibacterial product is characterized by being an additive;
[0015] Additives are used in feed processing, food industry, animal husbandry, beer industry, aquaculture, cosmetics production, and fruit preservation. Attached Figure Description
[0016] Figure 1 Phage pEC-M938-2.1 plaque.
[0017] Figure 2 Biological characteristics of bacteriophage pEC-M938-2.1, where A represents temperature stability results, B represents pH stability results, and C represents a partial growth curve.
[0018] Figure 3 .pEC-M938-2.1 Whole genome analysis, where A is the genome structure, B is the genome phylogenetic tree, and C is the genome similarity comparison.
[0019] Figure 4.LysEC-18 multiple sequence alignments were performed, in which UVJ52694.1, UNJ52694.1, AKE47249.1, and UNY67723.1 were derived from Salmonella phage XF2-1, Salmonella phage SLMP1, Escherichiacoli O157 typing phage 15, and Escherichia phage PBEC131, respectively.
[0020] Figure 5 .Structure and properties analysis of LysEC-18 protein, where A is the phylogenetic tree, B is the tertiary structure, and C is the molecular docking simulation.
[0021] Figure 6 LysEC-18 nucleic acid electrophoresis and SDS-PAGE gel electrophoresis were performed. In Figure A, PCR amplification of the target gene was performed, with M1 representing the relative molecular mass standard of DL2000 DNA. In Figure B, recombinant E. coil BL21(DE3) colony PCR was performed, with M2 representing the relative molecular mass standard of DL2000 DNA. In Figure C, SDS-PAGE gel electrophoresis was performed, with M3 representing the relative molecular mass standard of protein (100 kDa). 1: Whole cells of empty vector E. coil BL21(DE3) before induction; 2: Whole cells of empty vector E. coil BL21(DE3) after induction; 3: Whole cells of recombinant E. coil BL21(DE3)-Lys before induction; 4: Whole cells of recombinant E. coil BL21(DE3)-Lys after induction; 5: Recombinant E. coil BL21(DE3)-Lys.
[0022] Figure 7 The antibacterial activity of LysEC-18 was determined, where A represents the antibacterial activity of LysEC-18 against E coli M3729-1At and E coli S163-2; B represents the effect of different concentrations on the antibacterial effect of E coli M3729-1At; C represents the effect of different enzyme concentrations on the antibacterial effect of E coli S163-2; D represents the temperature stability of LysEC-18; and E represents the acid-base stability of LysEC-18. Detailed Implementation
[0023] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0024] Example 1. Preparation of glycoside hydrolase LysEC-18
[0025] 1.1 Source of strains
[0026] The test strains in this embodiment were obtained from wastewater samples from a wastewater treatment plant in Guangzhou. The test strains were previously identified as drug-resistant strains using the KB disc method according to CLSI / NCCLS standards.
[0027] 1.2 Isolation and purification of bacteriophages
[0028] After activation, the test strain was inoculated into MHB liquid medium and cultured until the logarithmic growth phase. 100 μL each of the wastewater sample and the test bacterial culture were simultaneously inoculated into MHB liquid medium and cultured at 37 ℃ for 12 h on a shaker. The supernatant was then centrifuged and filtered through a 0.22 μm filter membrane. 100 μL of the test bacterial culture was mixed with preheated semi-solid medium and quickly poured onto MHA solid medium. After the upper layer had completely solidified, 10 μL of the filtrate was dropped onto a plate and incubated upside down at 37 ℃. During this period, the plate was observed for the formation of transparent plaques.
[0029] Select a single plaque, serially dilute it 10-fold, and mix it with an equal volume of host bacterial culture. Add approximately 5 mL of preheated semi-solid culture medium and quickly pour it onto MHA solid medium. Incubate at 37 °C upside down and observe the plaque morphology. Repeat the above steps 3-5 times with a single plaque until the plaques are of uniform size and morphology to obtain purified bacteriophages.
[0030] A virulent bacteriophage strain was isolated from the sewage sample and named pEC-M938-2.1. Figure 1 As shown, the purified pEC-M938-2.1 phage plaques are round and transparent with a halo around them, and the diameter is approximately 0.86 mm.
[0031] 1.3 Determination of biological characteristics of bacteriophages
[0032] 1.3.1 Temperature stability
[0033] Take 1 mL of purified phage fluid and incubate it at -20 ℃, 4 ℃, 25 ℃, 37 ℃, 50 ℃ and 60 ℃ for 60 min. Then, dilute it 10 times to the appropriate concentration and determine the titer using the double-layer plate method. Each group of the above experiments was repeated 3 times.
[0034] The results are as follows Figure 2 As shown in Figure A, pEC-M938-2.1 maintains a potency of 10 over a temperature range of -20 °C to 37 °C. 7 pfu / ml ~10 8 pfu / ml.
[0035] Among them, the highest potency was observed at 25 ℃, with a value of 1.1 × 10⁻⁶. 8 pfu / mL; at 50 °C, the potency decreased to 10. 6 pfu / mL; completely inactivated after incubation at 70℃ for 1 h.
[0036] 1.3.2 pH stability
[0037] The pH of MHB liquid medium was adjusted to 2.0, 4.0, 6.0, 7.0, 8.0, 10.0, and 12.0 using HCl and NaOH solutions. 100 μL of purified phage fluid was mixed with 900 μL of MHB liquid medium at different pH values and incubated at 37 °C for 1 h. After serial dilution to the appropriate concentration by 10-fold, the titer was determined by the double-layer plate method. Each experiment was repeated 3 times.
[0038] The results are as follows Figure 2 As shown in B, the potency is highest at pH 6.0, reaching 9.0 × 10⁻⁶. 7 pfu / mL; at pH 4.0 and 8.0, the potency decreased to 10. 6 The cells were completely inactivated after incubation at pfu / ml and pH 2.0 and 12.0 for 1 h.
[0039] 1.3.3 One-step growth curve
[0040] After mixing the bacteriophages and host bacteria at a multiplicity of infection (MOI) of 0.1, the mixture was incubated at 37 °C for 10 min to allow for full adsorption of the bacteriophages. After centrifugation to remove the supernatant, the precipitate was washed twice with MHB liquid medium and resuspended in 10 mL. The mixture was then shaken and mixed, and this was marked as time 0. Samples were taken every 10 min, and the titer was determined by the double-layer plate method, and a one-step growth curve was plotted.
[0041] The results are as follows Figure 2 As shown in C, the incubation period of pEC-M938-2.1 is about 60 minutes. After 60 minutes, it enters the burst phase, which lasts for about 40 minutes before the curve flattens out and enters the plateau phase.
[0042] Based on the above characteristics, it can be found that the phage pEC-M938-2.1 has good low-temperature stability, high activity in neutral to slightly acidic environments, and a well-defined proliferation cycle. Its temperature and pH tolerance range basically meets the requirements of conventional laboratory storage (-20℃ / 4℃), room temperature operation (25℃), and some biological environments (such as neutral to slightly acidic body fluids). Moreover, its proliferation efficiency is predictable, providing key characteristic data support for its subsequent application in phage therapy (such as infection control for susceptible host bacteria) and food preservation.
[0043] 1.4 Phage whole-genome sequencing and functional analysis
[0044] 1.4.1 Whole genome sequencing
[0045] Whole-genome sequencing was performed using the Illumina Novaseq 6000 sequencing platform (Guangdong Megagene Technology Co., Ltd., Guangzhou). Soapnuke software was used to assess the quality of the sequencing data and remove low-quality data. Megahit software was used to perform de novo assembly of the clean data. MetaGeneMark (v3.38) was used for genome gene prediction. BLASTp (e<10⁻³) was used to align the predicted gene amino acid sequences with the UniProtKB database (ViralZone, reviewed protein, https: / / viralzone.expasy.org / ). Simultaneously, phage sequences were submitted to the pfam database (http: / / pfam.xfam.org / ) for annotation. The combined use of these two methods yielded corrected annotation results.
[0046] Whole-genome sequencing revealed that, for example Figure 3 As shown in Figure A, the full-length genome of phage pEC-M938-2.1 is 44,567 bp, with an average CG content of 50.36%. According to functional prediction, a total of 55 coding sequences (CDS) were predicted for the phage pEC-M938-2.1 genome, of which 26 CDS were predicted to have known functions. Their functions mainly include four functional modules: (1) DNA replication, modification and metabolism module: mainly including single-stranded DNA binding proteins, nucleic acid modification proteins, ATPases, phosphatases, DNA binding proteins, exonucleases, DNA polymerases, helicases, DNA methyltransferases and nucleases, etc. (2) DNA packaging module: mainly including the large subunit of terminal enzymes. (3) Lysis module: mainly including endolysin and the putative cell wall hydrolase. (4) Structural proteins and viral particle assembly modules: These mainly include phage tail assembly-related proteins, tail tube proteins, major capsid proteins, head proteins, tail spike proteins, host-specific proteins, minor tail proteins, tapered protein, tail filament proteins, and tail assembly proteins. Comparison between the drug resistance gene database and the virulence gene database showed that pEC-M938-2.1 did not carry drug resistance genes or virulence factors.
[0047] 1.4.2 Phage genome structure and function analysis and phylogenetic tree construction
[0048] Whole genome sequences of bacteriophages from different genera within the same subfamily were downloaded from the GenBank database. Phage genome phylogenetic trees were constructed using the online website VICTOR (https: / / ggdc.dsmz.de / victor.php#) and visualized using iToL (https: / / itol.embl.de / ). Whole genome maps were plotted using SnapGene 6.0.2 software, and whole genome comparisons were performed using BLAST Ring Image Generator (BRIG) software.
[0049] The results are as follows Figure 3 As shown in Figure B, BLASTn sequence alignment analysis revealed that pEC-M938-2.1 showed high similarity to Enterobacterial bacteriophage Escherichia phage EC115 (NCBI accession number: NC_073080.1), with a coverage rate of 95% and a sequence homology of 95.86%. Escherichia phage EC115 was classified as a member of the Dhillonvirus genus. Genome information of representative phages belonging to Dhillonvirus, Jouyvirus, Lambdavirus, Asteriusvirus, and Justusliebigvirus were downloaded from the GenBank database, and a phylogenetic tree was constructed. The results showed that pEC-M938-2.1 was similar to Escherichia phage PC2 (ON184124.1), Escherichia phage vb_EcoS_bov22_1 (MT884014.1), Escherichia phage BF9 (MW822006.1), and Escherichia phage... vB_EcoS-CHD5UKE2(MZ234029.1), Escherichia phage vB_EcoS_WFI(MK373791.1), and Escherichia phage vb_EcoS_bov22_1(MT884014.1) belong to the same evolutionary branch. Therefore, pEC-M938-2.1 belongs to the genus Dhillonvirus, whose members are distributed worldwide, and most of them are Enterobacterial bacteriophages.
[0050] like Figure 3As shown in C, whole-genome alignment analysis revealed that pEC-M938-2.1 showed high overall genome similarity to Escherichia phage PC2 (ON184124.1), Escherichia phage vb_EcoS_bov22_1 (MT884014.1), and Escherichia phagevB_EcoS_WFI (MK373791.1), but differences were found in the Intramolecular Chaperone Auto-processing (ICA) domain.
[0051] 1.5 Analysis of Lyase Sequence and Protein Structure Properties
[0052] Basic physicochemical properties, such as the endolysin signal peptide, molecular weight, and isoelectric point, were predicted using the Expasy program (https: / / web.expasy.org / protscale). Protein function was predicted using InterPro (http: / / www.ebi.ac.uk / interpro / ). Conserved domains were predicted using the NCBI online tool CD-search (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi / ). Homologous protein sequences were searched using the NCBI Blastp tool. A phylogenetic tree of the lyase was constructed using MGAE 11 software. Multiple sequence comparisons were performed using the Clustal Omega tool (http: / / www.clustal.org) with members of the same protein family whose activities had been verified, followed by multiple sequence alignment using ESPript 3.0 (https: / / espript.ibcp.fr / ESPript / ESPript / index.php). Homology modeling was performed using Swiss-Modle (https: / / swissmodel.expasy.org). The cross-linked composite structure of N-acetylglucosamine (GlcNAc) and N-acetylmuramic acid (MurNAc) (GlcNAc-MurNAc-GlcNAc-MurNAc PubChemCID:133080587) was obtained from the PubChem (https: / / pubchem.ncbi.nlm.nih.gov) database. Molecular docking was performed using the online tool CB-Dock 2 (https: / / cadd.labshare.cn / cb-dock2 / php / index.php), and the results were visualized using PyMOL software.
[0053] The lyase encodes a 163-amino acid sequence, lacking a signal peptide and transmembrane region. The protein has an instability index of 30.01, an isoelectric point (pI) of 9.22, and a mean hydrophobicity (GRAVY) of -0.447. Identified by InterPro and NCBI CDsearch as a lyzase-like endolysin domain (accession number cd00737), belonging to the glycoside hydrolase family 24 (GH24, accession number COG3772), it contains only a single catalytic domain (CD) covering amino acid positions 7 to 148. Sequence comparisons between LysEC-18 and other members of the same protein family are shown below. Figure 4 As shown, the similarity comparison results between LysEC-18 and its family members with verified activity showed that the highest similarity between LysEC-18 and its family members was only 41%.
[0054] like Figure 5 As shown in Figure A, the phylogenetic tree reveals that LysEC-18 and Escherichia phage PC2 lysins belong to the same evolutionary branch and are most closely related, while Escherichia phage PC2 also belongs to the Dhillonvirus genus of bacteriophages. Figure 5 As shown in B, the three-dimensional structure prediction of LysEC-18 indicates that it is a monomeric spherical structure composed of a single catalytic domain, as shown in Figure B. Figure 5 As shown in C, the molecular docking results of the predicted three-dimensional structure of LysEC-18 with the glycan cross-linking structure of peptidoglycan (GlcNAc-MurNAc-GlcNAc-MurNAc) show that the docking binding energy is -7.3 kcal / mol, indicating strong binding force.
[0055] 1.6 Construction, expression, and purification of the recombinant lyase LysEC-18 expression vector
[0056] 1.6.1 Amplification of the LysEC-18 lysin gene
[0057] Based on whole-genome sequencing and annotation analysis, CDS18 was predicted to be a glycoside hydrolase of pEC-M938-2.1, and was named LysEC-18. Using CDS18 as a template, a pair of primers were designed using Snap Gene 6.0.2: LysEC-18-EcoRI: 5'-ccgGAATTCATGCGATTCAGTGACAACGGTCTGAGATT-3' (SEQ ID NO. 2); LysEC-18-XhoI: 5'-cgCTCGAGTGCAGCGTTACGCCCGATCTTCT-3' (SEQ ID NO. 3). The PCR reaction program was 29 cycles: 95 ℃ for 5 min; 94 ℃ for 30 s; 58 ℃ for 30 s; 72 ℃ for 1 min, followed by 72 ℃ for 10 min. After confirming the size of the PCR product by 1% agarose gel electrophoresis, the target fragment was recovered using a kit.
[0058] like Figure 6 As shown in Figure A, the recovered target fragment was detected by 1% agarose gel electrophoresis, and a specific band was amplified at 500 bp.
[0059] 1.6.2 Construction of recombinant gene expression vectors
[0060] The recovered fragment and plasmid pET-28a(+) were double-digested with EcoRI and XhoI at 37 ℃ and ligated using T4 ligase to obtain a recombinant plasmid. The recombinant plasmid was transformed into E. coli BL21(DE3) competent cells via heat shock transformation to obtain recombinant E. coli BL21(DE3)-Lys. The recombinant E. coli BL21(DE3)-Lys cells were plated on kanamycin-resistant LB agar and incubated upside down at 37 ℃. Single colonies were picked and amplified using the aforementioned primers to screen for positive colonies. Clones verified as positive by PCR were sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for sequencing.
[0061] like Figure 6 As shown in B, single colonies of recombinant E. coil BL21(DE3)-Lys were randomly selected for colony PCR, and the results showed that the target band size was correct.
[0062] 1.6.3 Expression and purification of recombinant lyase LysEC-18
[0063] Recombinant E. coil BL21(DE3)-Lys, whose sequencing verification was correct, was inoculated into 800 mL of LB medium containing kanamycin and cultured at 37 °C until the OD600 nm reached approximately 0.6. After induction at low temperature for 16 h with IPTG to a final concentration of 0.1 mmol / L, the bacterial culture was collected. After centrifugation at 10,000 r / min for 10 min, the bacterial pellet was collected. The pellet was washed twice with sterile PBS buffer and resuspended in Lysis Buffer (50 mM Tris-HCl, 300 mM NaCl, pH=7.4). Cell homogenization was performed, and the supernatant and pellet were collected separately for SDS-PAGE analysis. Protein was purified using nickel affinity chromatography, concentrated using ultrafiltration, and excess imidazole was removed using a desalting column. Protein concentration was determined using the BCA method.
[0064] like Figure 6 As shown in Figure C, after IPTG induction, specific bands appeared at approximately 25 kDa in both the lysed supernatant and the lysed precipitate, with most of the expression being soluble and a small amount existing as inclusion bodies. Further purification of the soluble expression fraction resulted in a single, clear band at approximately 25 kDa, as expected. The concentration of the purified protein was determined to be 1.7 mg / mL using a BCA assay kit.
[0065] The DNA sequence (SEQ ID NO.1) of the lysin LysEC-18 is as follows:
[0066] ATGCGATTCAGTGACAACGGTCTGAGATTCACGGCAGCCTGGGAGGCTTTCAGCCCGGTGCCGTATTTCGCGACCAAGAAAGAGCAGGCCCGCGGCCTGTACACCTGGGGTTATGGTCATACTGGCACTAACCCGCCTCGAAGCATTACCCGTGCGGAAGCGCTGGAACTGCTCAAGCGAGATGTGGCGTATGCCGAGGACTGGGTGAACAAATACGCACATCCGAGCATTAACCAGGCGCAATTC GACGCGCTGGTGGACCTGGTAATCAATGCCGGTCAAGGTCCGATCGTACCGGATAACATCGCGAATGATTTCGATGATGCGGTGCGACTGGGCGACTGGGCGAAGGTCCGTGCTACTCTGCCG CAGTTCCGCAAGCAAGGCGGGGAAGTGCTTAAGGGTCTGGTACGCCGTGCAATCGGCAGACAGGCGTTGTTTGATGGTAAGCAGTGGGACGTTGCCGAGAAGATCGGGCGTAACGCTGCATAA.
[0067] Example 2. Determination of antibacterial activity of recombinant lyase LysEC-18
[0068] 2.1 Determination of the antibacterial activity of recombinant LysEC-18
[0069] Activated *E. coli* M3729-1At and *E. coli* S163-2 were cultured until the OD600 nm reached 0.6. The bacterial suspensions were then divided into two equal volumes. One volume was resuspended in 20 mM Tris-HCl buffer, and the other in 20 mM Tris-HCl buffer containing 0.5 mM EDTA. 140 μL of bacterial suspension was mixed with 60 μL Tris-HCl buffer to form the Tris-HCl group, and LysEC-18 was replaced with Tris-HCl to form the LysEC-18 group. Similarly, 140 μL of bacterial suspension containing EDTA was mixed with 60 μL Tris-HCl to form the EDTA group, and LysEC-18 was replaced with Tris-HCl to form the EDTA-LysEC-18 group. All four groups were incubated at 37 ℃ for 2 h, then diluted and plated. Viable cell counts were performed to analyze the antibacterial activity of LysEC-18.
[0070] The results are as follows Figure 7As shown in Figure A, compared with the untreated group, the combination of LysEC-18 and EDTA enhanced the antibacterial activity of E. coli M3729-1At and E. coli S163-2. After the combination treatment, the colony count of E. coli M3729-1At increased from 4.01 × 10⁻⁶ to 4.01 × 10⁻⁶. 8 CFU / mL (Tris group) decreased to 1.18 × 10⁻⁶. 8 cfu / mL, while for E. coli S163-2 it was 4.02×10⁻⁶. 8 CFU / mL (Tris group) decreased to 2.76 × 10⁻⁶ 7 cfu / mL. LysEC-18 alone did not cause a significant decrease in viable bacterial count in E. coli M3729-1At, and there was no significant difference compared with the Tris group and the EDTA group. However, LysEC-18 alone showed a significant antibacterial effect on E. coli S163-2 (p<0.1).
[0071] 2.2 Effect of recombinant LysEC-18 concentration on antibacterial effect
[0072] LysEC-18 was diluted to different concentrations using Tris-HCl buffer and treated in two groups, E. coli M3729-1At and E. coli S163-2, using the same method described above. 140 μL of EDTA-treated and untreated bacterial cultures were mixed with 60 μL of enzyme solutions of different concentrations to form the EDTA-LysEC-18 group and the LysEC-18 group, respectively. The enzyme solutions were replaced with an equal volume of Tris-HCl buffer to form the EDTA group and the Tris-HCl group, respectively. After incubation at 37 °C for 2 h, the cultures were plated and counted.
[0073] For E. coli M3729-1At, the results are as follows Figure 7 As shown in Figure B, the antibacterial effect of LysEC-18 combined with EDTA was concentration-dependent; when the enzyme concentration was 510 μg / mL, the colony count increased from 3.93 × 10⁻⁶. 8 CFU / mL (Tris group) decreased to 3.23 × 10⁻⁶. 7 The cfu / mL count decreased by approximately one logarithmic order; while when LysEC-18 was used alone, the viable count only decreased from 3.93 × 10⁻⁶ at 255 μg / mL. 8 CFU / mL (Tris group) decreased to 2.26 × 10⁻⁶ 8 Increasing the concentration to cfu / mL did not significantly improve the antibacterial effect.
[0074] For E. coli S163-2, the results are as follows Figure 7As shown in Figure C, when the enzyme concentration was 102 μg / mL, it exhibited significant antibacterial activity both alone and in combination with EDTA, with the viable cell count increasing from 3.78 × 10⁻⁶. 8 The cfu / mL (Tris group) decreased to 1.02×10⁻⁶. 8 cfu / mL (untreated with EDTA) and 4.80×10 7 cfu / mL (EDTA treatment), but as the concentration further increased, the antibacterial effect did not show a significant increase. Figure 7 C).
[0075] In other words, the optimal concentration of LysEC-18 for both strains does not need to be too high: 510 μg / mL + EDTA for M3729-1At and 102 μg / mL for S163-2. Higher concentrations not only offer no benefit but also increase costs. It is recommended to use LysEC-18 + EDTA for inhibiting E. coli M3729-1At; however, no additional EDTA is needed for E. coli S163-2, indicating that LysEC-18 has the potential to penetrate the outer membrane of Gram-negative bacteria.
[0076] 2.3 Stability of Recombinant LysEC-18
[0077] 2.3.1. Temperature stability experiment
[0078] The enzyme solution was incubated at 4 ℃, 20 ℃, 30 ℃, 40 ℃, 50 ℃, and 60 ℃ for 30 min, respectively, and then cooled to room temperature. A mixture of 140 μL of bacterial suspension containing EDTA and 60 μL of enzyme solution was incubated at 37 ℃ for 2 h. The enzyme solution was replaced with Tris-HCl buffer as a control group. The OD600 nm value was measured using a microplate reader to assess the temperature stability of the enzyme. Each stability experiment was performed in triplicate. The antibacterial activity was calculated as: (OD600 nm of control group - OD600 nm of experimental group) / OD600 nm of control group × 100%.
[0079] The results are as follows Figure 7 As shown in D, LysEC-18 can maintain more than 20% antibacterial activity in the range of 4 ℃ to 40 ℃, but it drops to 12.8% at 50 ℃ and only 5.37% at 60 ℃.
[0080] 2.3.2 pH stability experiment
[0081] The enzyme was incubated for 30 min in buffer solutions with pH values of 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 (Tris-HCl buffer pH values of 7.0, 8.0, 9.0, and 10.0; citrate-sodium citrate buffer pH values of 4.0, 5.0, and 6.0). A mixture of 140 μL of bacterial culture containing EDTA and 60 μL of enzyme solution served as the experimental group, while the enzyme solution replaced the Tris-HCl buffer as the control group. After incubation at 37 ℃ for 2 h, the OD600 nm value was measured using a microplate reader to assess the enzyme's acid-base stability. Each stability experiment was performed in triplicate. Antibacterial activity was calculated as (OD600 nm of control group - OD600 nm of experimental group) / OD600 nm of control group × 100%.
[0082] The results are as follows Figure 7 As shown in E, the pH stability experiment showed that the enzyme was completely inactivated at pH 4.0, its activity increased to 23.89% at pH 7.0, decreased slightly at pH 8.0 (18.19%), and had the highest activity at pH 10.0 (29.71%).
[0083] Based on the above characteristics, it can be found that the lyase LysEC-18 has good stability at medium and low temperatures, high activity in neutral environments, and a well-defined proliferation cycle. Its temperature and pH tolerance range basically meets the requirements of conventional laboratory storage (-20℃ / 4℃), room temperature operation (25℃), and some biological environments (such as neutral body fluids). Moreover, its proliferation efficiency is predictable, providing key characteristic data support for its subsequent application as an additive in feed processing, food industry, animal husbandry, brewing industry, aquaculture, cosmetics production, and fruit preservation.
[0084] Example 3. Determination of fragmentation spectra of pEC-M938-2.1 and recombinant LysEC-18
[0085] After activating the test strain, rejuvenate it to the logarithmic growth phase. Take 100 μL of bacterial culture and mix it with 5 mL of preheated semi-solid culture medium, then pour it onto MHA solid culture medium. After the upper culture medium solidifies, take 10 μL of phage proliferation solution and drop it onto the plate. Incubate at 37℃ upside down for 12 h. During this period, observe whether transparent phage plaques are produced. If clear and transparent phage plaques appear, it means that the phage can lyse the strain; otherwise, it cannot.
[0086] To determine the cleavage spectrum of LysEC-18, after treating the test bacterial liquid in the same method as in 2.3, 140 μL of the bacterial liquid containing EDTA was mixed with 60 μL of the enzyme solution (final concentration: 510 μg / mL) as the experimental group, and the enzyme solution was replaced with Tris-HCl buffer as the control group. After incubating at 37 °C for 2 h, the OD600nm value was measured using a microplate reader. Each sample was set with 3 replicates, and the data was analyzed by independent sample t-test.
[0087] The results are shown in Table 1 below. Except for the host bacterium E. coli M938-2, pEC-M938-2.1 has no antibacterial ability against other tested strains. When LysEC-18 is used in combination with EDTA, except for the original host bacterium, it has significant antibacterial activity against E. coli S163-2, E. coli M3729-1At, E. coli 1-2, E. coli M719-6WT, A. baumannii N3491-2At, and K. pneumoniae N3220-3At (p < 0.5).
[0088] Table 1 Antibacterial range of pEC-M938-2.1 and LysEC-18
[0089]
[0090] Note: +: Lytic; -: Non-lytic; 0.01 < P < 0.05 is indicated by *; P < 0.01 is indicated by **.
[0091] 注:+:可裂解;-:不可裂解;统计显著性:* 0.01 < P <0.05;** P < 0.01。
[0092] Functions and effects of this example:
[0093] Facing the major threat to human health caused by the global spread of bacterial drug resistance, phages have attracted much attention as a potential alternative strategy. In this example, a phage pEC-M938-2.1 was isolated and identified from sewage, and its glycoside hydrolase LysEC-18 was expressed in prokaryotes.
[0094] Through systematic evaluation of the antibacterial functions of pEC-M938-2.1 and its glycoside hydrolase LysEC-18, it was found that both pEC-M938-2.1 and the glycoside hydrolase LysEC-18 showed bactericidal effects on the tested drug-resistant strains to varying degrees. pEC-M938-2.1 can lyse a drug-resistant Escherichia coli strain, but has no lytic activity against other tested strains, while LysEC-18 shows antibacterial ability against multiple tested drug-resistant bacteria.
[0095] LysEC-18 exhibits characteristics of most Gram-negative bacterial endosomal enzymes. When used in combination with 0.5 mM EDTA, its activity is significantly enhanced, demonstrating broad-spectrum antibacterial ability. However, against E. coli S163-2, it exerts its antibacterial effect without EDTA even at an enzyme concentration of only 102 μg / mL, proving that LysEC-18 has the potential to penetrate the outer membrane of Gram-negative bacteria.
[0096] T4 lysozyme, a representative member of the glycoside hydrolase family 24, possesses a typical catalytic triplet (Glu-9aa-Asp-5aa-Thr) that is central to the hydrolysis of peptidoglycan. LysEC-18 exhibits the typical hairpin structure common to glycoside enzyme families, a key region for peptidoglycan binding. While the lyase Ab Lys1 possesses a typical catalytic triplet structure, it shows high selectivity against *A. baumannii*. LysEC-18 did not exhibit the typical T4 lysozyme catalytic triplet (Glu-9aa-Asp-5aa-Thr), yet it still showed excellent broad-spectrum antibacterial effects against multiple tested bacteria, suggesting that it employs an atypical catalytic mechanism for peptidoglycan hydrolysis. Aspartic acid (Asp) and glutamate (Glu) have been shown to play important roles in peptidoglycan hydrolysis; substitution of aspartic acid (Asp) weakens enzyme activity, while mutations in glutamate (Glu) completely eliminate enzyme activity. Based on the molecular docking model and the above discussion, it is preliminarily inferred that glutamic acid at position 39 (G39) and aspartic acid at position 61 (D61) of LysEC-18 are key catalytic residues. Both sites are key sites for binding peptidoglycan crosslinking structures and are located in hairpin structures.
[0097] In summary, this embodiment comprehensively evaluated the antibacterial activity of bacteriophage pEC-M938-2.1 and its glycoside hydrolase LysEC-18. Both exhibited good temperature and pH tolerance. Both pEC-M938-2.1 and LysEC-18 demonstrated antibacterial activity against the tested resistant strains. LysEC-18, as a typical Gram-negative bacterial endosomal, showed broad-spectrum antibacterial activity when used in combination with EDTA, and also possessed considerable antibacterial activity when used alone, demonstrating its potential to penetrate the outer membrane of Gram-negative bacteria. LysEC-18 may catalyze the hydrolysis of peptidoglycan using an atypical catalytic mechanism. The study of bacteriophage pEC-M938-2.1 and its glycoside hydrolase LysEC-18 provides a reference for the development of bacteriophage-related biological agents.
Claims
1. A glycoside hydrolase LysEC-18, characterized in that: The DNA sequence of the glycoside hydrolase LysEC-18 is shown in SEQ ID NO.
1.
2. The expression of a glycoside hydrolase LysEC-18, characterized in that, Includes primers as shown in SEQ ID NO. 2 and SEQ ID NO.
3.
3. The application of the glycoside hydrolase LysEC-18 as described in claim 1 or 2 in the preparation of antibacterial products.
4. A formulation, characterized in that: It includes the glycoside hydrolase LysEC-18 as described in claim 1 or 2, and an outer membrane permeabilizer.
5. The application of the formulation as described in claim 4 in the preparation of antibacterial products.
6. An antibacterial product as described in claim 3 or 5, characterized in that: It is an antibacterial drug; The antimicrobial drug also includes pharmaceutically acceptable excipients.
7. An antibacterial product as described in claim 3 or 5, characterized in that: For disinfection / sterilization products; The disinfection / sterilization product also contains at least one of the following: stabilizer, pH adjuster, corrosion inhibitor, and solvent.
8. An antibacterial product as described in claim 3 or 5, characterized in that: As an additive; The additives are used in feed processing, food industry, animal husbandry, beer industry, aquaculture, cosmetics production, and fruit preservation.