Construction method of spodoptera exigua crisper / cas9 whole genome knockout library and screening method of pyridalyl sensitive gene

Abstract

The application belongs to the technical field of gene bioengineering, and discloses a construction method of a Spodoptera frugiperda CRISPR / Cas9 whole genome knockout plasmid library and a cell library, mainly comprising the following steps: designing and synthesizing a Spodoptera frugiperda whole genome knockout sgRNA library chip; connecting the library chip to a CRISPR / Cas9 knockout vector to obtain a whole genome knockout plasmid library; co-transfecting the plasmid library and a transposase auxiliary plasmid into Spodoptera frugiperda ovary cells, continuously screening for 15 days by using an antibiotic, and obtaining a Spodoptera frugiperda whole genome knockout cell library. A key sensitive gene of an insecticide pyridalyl with an unknown long-term action mechanism is screened by using the library. The application can realize high-throughput and unbiased knockout screening of Spodoptera frugiperda genes at a cell level, and can be widely applied to functional gene screening under various exogenous stress conditions such as insecticides, biological toxins, nucleic acid pesticides, and pathogenic microorganisms.

Description

Technical Field

[0001] This invention belongs to the field of genetic bioengineering technology, and relates to a method for constructing a CRISPR / Cas9 whole genome knockout library for fall armyworm and a method for screening genes sensitive to acetamiprid. Background Technology

[0002] The fall armyworm (Spodoptera frugiperda) is a highly invasive, migratory, and explosive pest of the Lepidoptera noctuid moth family. It is listed as one of the world's top ten plant pests and a Class A crop pest in my country. The fall armyworm can damage 353 host plant species from 76 families and has developed varying degrees of resistance to multiple active ingredients in insecticides, posing a significant threat to my country's agricultural production and food security. Currently, the control of the fall armyworm still relies mainly on chemical control and genetically modified crops. However, with the long-term and widespread use of insecticides, the fall armyworm has developed resistance to many pesticides, making control increasingly difficult.

[0003] In pest control research, elucidating the function of pest genes is a crucial foundation for developing novel control strategies. However, the fall armyworm genome is quite large, with tens of thousands of protein-coding genes. Traditional methods such as single-gene knockout, RNA interference (RNAi), or candidate gene validation have limitations, including long research cycles, low throughput, and reliance on prior assumptions, making it difficult to systematically and unbiasedly analyze the functional gene network related to exogenous stress.

[0004] In recent years, genome-wide CRISPR / Cas9 knockout screening technology, as an important tool for systematically linking genotype and phenotype, has been widely used in mammalian functional genomics research, achieving significant progress in areas such as physiological regulation, disease mechanisms, and toxicology. This technology, by constructing genome-wide sgRNA (single guide RNA) libraries, enables high-throughput knockout of target genes at the cellular level, thereby allowing for unbiased screening of key functional genes associated with specific phenotypes. Genome-wide CRISPR / Cas9 knockout screening technology has also been explored in a few model organisms or important public health pests. For example, in the Drosophila melanogaster cell system, researchers successfully identified key receptor genes related to bacterial toxin recognition and pathogenic processes using genome-wide CRISPR / Cas9 knockout screening, providing a new research tool for elucidating insect-pathogen interaction mechanisms. In mosquito research, a genome-wide CRISPR / Cas9 knockout screening platform based on Anopheles gambiae cells has been used to screen functional genes related to cell survival, immune function, and stress resistance, providing important clues for vector-borne insect biology research and disease control. In the beneficial insect silkworm, researchers constructed a CRISPR / Cas9-based genome-wide knockout library and systematically identified key genes essential for maintaining cell survival and responding to abiotic and biotic stresses at the cellular level.

[0005] To date, no mature and systematic genome-wide CRISPR / Cas9 knockout cell library or its construction method has been established for insect cell lines derived from major agricultural pests. Particularly for major agricultural pests with global impact, such as the fall armyworm, there is a lack of a CRISPR / Cas9 genome-wide knockout platform suitable for high-throughput, unbiased screening of functional genes. This, to some extent, restricts systematic research on their insecticide action mechanisms, resistance formation basis, and stress response pathways. Therefore, it is necessary to establish a CRISPR / Cas9 genome-wide knockout cell library with high coverage, good stability, and suitability for the fall armyworm cell system to achieve high-throughput, unbiased screening of functional genes, providing fundamental technical support for elucidating the molecular response mechanisms of the fall armyworm to insecticides and other exogenous stresses.

[0006] Acetaminophen, also known as trifluralin, is a novel insecticide not yet classified in the IRAC. Its unique chemical structure exhibits high insecticidal activity against lepidopteran pests and thrips; it also shows low toxicity to major beneficial insects, making it an environmentally friendly insecticide. Currently, research on the insecticidal mechanism of acetamiprid is scarce. The only existing reports suggest that it may exert its insecticidal effect through the activation of cytochrome P450 monooxygenases. P450 enzymes help convert acetamiprid into biologically active metabolites, which can lead to the production of reactive oxygen species, thereby damaging various intracellular biomolecules, increasing protease activity, and resulting in protein degradation and increased necrotic apoptosis. Furthermore, field populations of diamondback moth and western flower thrips have shown varying degrees of resistance to acetamiprid; however, the relevant resistance genes have not yet been identified. Therefore, it is urgent to build a gene function screening and analysis platform to systematically elucidate the mechanism of action of acetamiprid, thereby gaining a deeper understanding of the molecular basis of its highly effective insecticidal activity against pests and providing scientific support for the integrated management of field resistance to this pesticide. Summary of the Invention

[0007] This invention addresses the technical problems in the control of fall armyworm by providing a method for constructing a CRISPR / Cas9 whole-genome knockout plasmid library and cell library for fall armyworm. This method enables high-throughput, unbiased knockout screening of fall armyworm genes at the cellular level, achieving systematic coverage of fall armyworm protein-encoding genes. It fills the technical gap in the field of agricultural pests by lacking a comprehensive CRISPR / Cas9 knockout screening platform and can be widely applied to functional gene screening under various exogenous stress conditions, such as insecticides, biotoxins, nucleic acid pesticides, and pathogenic microorganisms.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides a method for constructing a CRISPR / Cas9 whole-genome knockout plasmid library of fall armyworm, comprising the following steps: designing and synthesizing a fall armyworm whole-genome knockout sgRNA library chip; amplifying the sgRNA library chip using specific primer pairs; digesting the fall armyworm CRISPR / Cas9 knockout vector into a linearized vector; ligating the amplified product with the linearized vector, transforming the ligated product into competent cells, extracting plasmids, and finally obtaining a fall armyworm whole-genome knockout plasmid library.

[0010] In the above technical solution, the CRISPR / Cas9 knockout vector for fall armyworm includes a pB-CRISPR vector, a piggyBac transposon, an SfU6 promoter, a target site sgRNA, a Cas9 protein expression cassette, and a selection marker. The selection marker is the antibiotic Zeocin.

[0011] In the above technical solution, the sequences of the specific primer pairs are shown in SEQ ID NO.5~SEQ ID NO.6.

[0012] Secondly, the present invention provides a method for constructing a CRISPR / Cas9 whole genome knockout cell library of fall armyworm, comprising the following steps: co-transfecting the constructed fall armyworm CRISPR / Cas9 whole genome knockout plasmid library and transposase helper plasmid into fall armyworm ovarian cells (Sf9 cells), and continuously screening with antibiotics for 15 days to obtain the fall armyworm CRISPR / Cas9 whole genome knockout cell library.

[0013] In the above technical solution, the antibiotic is Zeocin, and the screening concentration is 500 μg / ml.

[0014] Thirdly, the present invention provides an application of the above-constructed fall armyworm CRISPR / Cas9 whole genome knockout cell library in screening for insecticides, Bt toxins, nucleic acid pesticides, viruses, and bacterial sensitive genes, wherein the preferred insecticide is acetamiprid.

[0015] Fourthly, this invention provides a method for screening genes susceptible to acetamiprid, comprising the following steps: The constructed fall armyworm CRISPR / Cas9 whole-genome knockout cell library is cultured in a medium containing acetamiprid, and a concentration gradient method is used for continuous screening for 33 days, with low concentrations from day 1 to day 21, medium concentrations from day 22 to day 28, and high concentrations from day 29 to day 33; live cells are collected each time the screening concentration is increased, and genomic DNA is extracted for high-throughput sequencing; by analyzing the genes targeted by sgRNA in the enriched cells, candidate genes susceptible to acetamiprid in fall armyworm are screened; single-gene knockout cell lines are constructed to verify whether the enriched target genes are susceptible genes, and finally, the key susceptible genes of fall armyworm to acetamiprid are determined.

[0016] In the above technical solution, the specific steps of the concentration gradient method are as follows: the concentration of acetamiprid in the culture medium from day 1 to day 21 is 400 nmol / L, the concentration of acetamiprid in the culture medium from day 22 to day 28 is 2 μmol / L, and the concentration of acetamiprid in the culture medium from day 29 to day 33 is 10 μmol / L.

[0017] In the above technical solution, the candidate sensitivity genes of fall armyworm to acetamiprid include Sfn270461, Sfn250326, Sfn250117, Sfn120653, Sfn240417, Sfn280283, Sfn110319, Sfn110579, Sfn210133, Sfn170294, Sfn040115, Sfn010702, and Sfn290453.

[0018] In the above technical solution, the sgRNA sequences of the candidate sensitivity gene Sfn270461 to acetamiprid are shown in SEQ ID NO.14~SEQ ID NO.16, respectively; the sgRNA sequences of Sfn250326, Sfn250117, Sfn120653, Sfn240417, Sfn280283, Sfn110319, Sfn110579, Sfn210133, Sfn170294, Sfn040115, Sfn010702, and Sfn290453 are shown in SEQ ID NO.17~SEQ ID NO.28, respectively.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] This invention is the first to construct a CRISPR / Cas9 whole-genome knockout cell library suitable for the major agricultural pest, fall armyworm, achieving systematic coverage of the protein-encoding genes of fall armyworm and filling the technological gap in the field of agricultural pests where there is a lack of CRISPR / Cas9 knockout screening platforms with broad genome coverage.

[0021] This invention enables high-throughput, unbiased knockout screening of fall armyworm genes at the cellular level by constructing sgRNA plasmid libraries and cell libraries with high coverage and stable expression. This overcomes the shortcomings of traditional single-gene knockout or RNA interference methods, such as low throughput, low efficiency, and reliance on prior assumptions.

[0022] The fall armyworm CRISPR / Cas9 whole genome knockout cell library constructed in this invention has the characteristics of relatively uniform genetic background, stable operation, and strong reproducibility, making it suitable for large-scale parallel screening experiments and significantly improving the efficiency and reliability of functional gene screening.

[0023] The cell library provided by this invention can be widely used for functional gene screening under various exogenous stress conditions such as insecticides, biotoxins, nucleic acid pesticides, and pathogenic microorganisms. It helps to systematically analyze the target of exogenous compounds, the basis of resistance formation, and the molecular response mechanism of fall armyworm. Attached Figure Description

[0024] Figure 1 The flowchart for constructing a CRISPR / Cas9 whole-genome knockout cell library for fall armyworm includes sgRNA oligo pool synthesis, construction of the sgRNA plasmid library SfpBCRLib, transfection of the plasmid library into Sf9 cells, and screening to obtain a stably expressed CRISPR / Cas9 cell library SfGCKLib.

[0025] Figure 2 This is a map of the SfpB-CRISPR vector of the present invention.

[0026] Figure 3 Distribution of sgRNA in the CRISPR / Cas9 whole genome knockout plasmid library SfpBCRLib for fall armyworm.

[0027] Figure 4 Distribution characteristics of deep sequencing reads and sgRNA counts in the SfGCKLib CRISPR / Cas9 whole-genome knockout cell library of fall armyworm.

[0028] Figure 5 Flowchart for screening acetamiprid-sensitive genes using a CRISPR / Cas9 whole-genome knockout cell library from the fall armyworm.

[0029] Figure 6 The toxicity curve of Sf9 cells to acetamiprid.

[0030] Figure 7 The results of MAGeCK analysis for candidate genes.

[0031] Figure 8 This is to verify cell survival results for single genes. Detailed Implementation

[0032] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of protection of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the test methods in the following embodiments are conventional methods.

[0033] Example 1: Construction of a CRISPR / Cas9 whole-genome knockout cell library of fall armyworm

[0034] 1. Experimental Materials

[0035] Fall armyworm ovarian cells Sf9 (long-term preservation at the Insect Reproduction and Biological Interaction Laboratory of Henan University), InsectPro ®Serum-free insect cell culture medium (Shanghai Yuanpei Biotechnology Co., Ltd.), Fetal Bovine Serum (FBS) (ExCell Bio), CCK-8 assay kit (Beyotime), genome extraction kit (Tiangen Biotech Co., Ltd.), competent cells (Beijing TransGen Biotech Co., Ltd.), pB-CRISPR vector (provided by Southwest University), A3 helper vector (provided by Southwest University), Zeocin antibiotic (Thermo Fisher Scientific), PCR enzyme (Nanjing Novizan Biotechnology Co., Ltd.), restriction endonuclease (NEB), homologous recombinase (Takara Bio Inc.).

[0036] 2. Construction of a CRISPR / Cas9 whole-genome knockout cell library of fall armyworm

[0037] Reference Figure 1 The process is shown below.

[0038] 2.1 Construction of a CRISPR / Cas9 knockout vector suitable for fall armyworm

[0039] Containing the piggyBac transposon, the fall armyworm-specific SfU6 promoter, target site sgRNA, Cas9 protein expression cassette, and the selection marker Zeocin, this vector is named SfpB-CRISPR. Details are as follows:

[0040] 1) The pB-CRISPR vector was linearized by digestion with AscI and NheI enzymes.

[0041] 2) Using Sf9 cell genomic DNA as a template, the SfU6 promoter was amplified using specific primers SfU6-F / R (see Table 1). Specifically, the PCR amplification system consisted of: 9.5 μL ddH2O, 12.5 μL 2×phanta, 1 μL SfU6-F (10 pmol / μL), 1 μL SfU6-R (10 pmol / μL), and 1 μL Sf9 cell genomic DNA, for a total volume of 25 μL. The PCR amplification program was as follows: pre-deformation at 95℃ for 3 min, deformation at 95℃ for 15 s, annealing at 60℃ for 15 s, extension at 72℃ for 30 s, for 35 cycles, followed by a final extension at 72℃ for 5 min and 10℃ infinity.

[0042] 3) Using the pB-CRISPR vector as a template, the sgRNA scaffold region was amplified using specific primers sgRNA-F / R (see Table 1). Specifically, the PCR amplification system consisted of: 9.5 μL ddH2O, 12.5 μL 2×phanta, 1 μL sgRNA-F (10 pmol / μL), 1 μL sgRNA-R (10 pmol / μL), and 1 μL pB-CRISPR plasmid, for a total volume of 25 μL. The PCR amplification program was as follows: pre-deformation at 95℃ for 3 min, deformation at 95℃ for 15 s, annealing at 60℃ for 15 s, extension at 72℃ for 30 s, for 35 cycles, followed by a final extension at 72℃ for 5 min and 10℃ infinity.

[0043] 4) The products from steps 1) to 3) were linked via homologous recombination at 50°C for 30 min. This yielded a suitable CRISPR / Cas9 knockout vector for the fall armyworm, named SfpB-CRISPR (see diagram). Figure 2 (SEQ ID NO. 29).

[0044] Table 1 Primers used for constructing the SfpB-CRISPR vector

[0045]

[0046] 2.2 sgRNA Design

[0047] Based on the fall armyworm genome information (GWHHASD00000000.1), whole-genome knockout sgRNAs were designed using CCtop software. The design of the sgRNAs followed the following five criteria: 1) The target gene locus of the sgRNA contained NGG PAM, and the sgRNA length was 20 nt; 2) The predicted targeting efficiency was >70% (scored using the CRISPRater algorithm); 3) The overall GC content was controlled within the range of 20-80%, with a preference for the ideal range of 40-60%; 4) Transcription termination signal sequences containing "TTTT" (>4 consecutive Ts) and polyA signal sequences (≥7 consecutive adenosine nucleotides) were excluded; 5) The 5' region adjacent to the translation start site was preferentially targeted to achieve effective disruption of the functional domain.

[0048] This invention uses Bowtie alignment tool to screen off-target sites for the designed sgRNA (allowing ≤3 mismatches); establishes a specificity scoring system (0-1000 points), the higher the score, the lower the off-target risk, and selects the sgRNA with the highest specificity score close to 1000; requires that the sgRNA sequence be unique in the whole genome (single site match).

[0049] In this invention, 6 sgRNAs were designed for each gene, and a total of 91,179 sgRNAs were designed and selected to target 14,444 protein-coding genes.

[0050] 2.3 sgRNA oligo pool synthesis

[0051] Adapters were added to both ends of the designed sgRNA sequence, and the sgRNA sequence with added homologous arms was synthesized into an sgRNA library chip. The sgRNA sequence is NNNNNNNNNNNNNNNNNNNN; the 5' adapter sequence is TATACAAAAATTCGTGCTCGACCACCGATGGCAGGT ACCACCG; the 3' adapter sequence is GTTTTAGAGCTAGAAATAGCAAGTTAA; the specific sequence is: TATACAAAAATTCGTGCTCGACCACCGNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAA. After synthesis, the sgRNA library chip was obtained. All sgRNAs were synthesized by Suzhou Hongxun Biotechnology Co., Ltd.

[0052] 2.4 Construction of sgRNA plasmid library

[0053] The synthesized sgRNA library chip was cloned into the SfpB-CRISPR vector. The specific steps are as follows:

[0054] 1) The SfpBCRLib-Con-F / R primer pair (see Table 2) was used to amplify the chip. Specifically, the PCR amplification system consisted of: 35 μL ddH2O, 10 μL 5×PCR Buffer, 1 μL 10 mM dNTP, 1 μL SfpBCRLib-Con-F (20 pmol / μL), 1 μL SfpBCRLib-Con-R (20 pmol / μL), 1 μL Hot start, and 1 μL plasmid, for a total volume of 50 μL. The PCR amplification program was as follows: pre-deformation at 98℃ for 2 min, deformation at 98℃ for 30 s, annealing at 62℃ for 30 s, extension at 72℃ for 30 s, 25 cycles, and a final extension at 72℃ for 2 min, followed by 10℃ infinity.

[0055] 2) The vector SfpB-CRISPR was linearized by digestion with XhoI restriction endonuclease. Specifically: preparation of the digestion vector: 800 μL ddH2O, 100 μL 10×Buffer, 100 μg plasmid, 50 μL endonuclease, for a total volume of 1000 μL.

[0056] 3) Using homologous recombination, the InFusion® Snap Assembly cloning kit (Takara Bio) was selected to ligate the product from step 1) with the linearized vector from step 2). The reaction conditions were 37°C for 30 min. The ligation product was then physically transformed into Trans 5α competent cells, and plasmids were extracted. Finally, a whole genome plasmid library of *S. fall armyworm* was obtained and named SfpBCRLib.

[0057] 4) The PCR fragments covering sgRNA in the SfpBCRLib plasmid library were amplified using primer pairs SfpBCRLib-NGS-F1 / R1 and SfpBCRLib-NGS-F2 / R2 (see Table 2) through two rounds of PCR. Specifically, the first round of PCR amplification system consisted of: 35 μL ddH2O, 10 μL 5×PCR Buffer, 1 μL 10 mM dNTP, 1 μL SfpBCRLib-NGS-F1 (20 pmol / μL), 1 μL SfpBCRLib-NGS-R1 (20 pmol / μL), 1 μL Hot start, and 1 μL plasmid, for a total volume of 50 μL. The PCR amplification program was as follows: pre-deformation at 98℃ for 2 min, deformation at 98℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, 10 cycles, final extension at 72℃ for 2 min, 4℃ infinity. The second-round PCR amplification system consisted of: 34 μL ddH2O, 10 μL 5×PCR Buffer, 1 μL 10 mM dNTP, 1 μL SfpBCRLib-NGS-F2 (20 pmol / μL), 1 μL SfpBCRLib-NGS-R2 (20 pmol / μL), 1 μL Hot start, and 2 μL of the first-round PCR product, for a total volume of 50 μL. The PCR amplification program was as follows: pre-deformation at 98℃ for 2 min, deformation at 98℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, 10 cycles, final extension at 72℃ for 2 min, 4℃ infinity.

[0058] The coverage of sgRNA in the SfpBCRLib plasmid library was then assessed using next-generation sequencing (NGS), and the results are as follows: Figure 3 As shown in the figure. NGS data analysis revealed that the fall armyworm whole-genome plasmid library coverage was 97.06%, targeting 14,437 protein-coding genes. NGS library construction and sequencing were performed by Suzhou Hongxun Biotechnology Co., Ltd.

[0059] Table 2 Primers used for sgRNA plasmid library construction

[0060]

[0061] 2.5 Plasmid library transfection into Sf9 cells

[0062] Sf9 cells (fall armyworm ovarian cells) were cultured in Sf9-specific medium (Insectpro). ® Sf9 medium and 10% fetal bovine serum (FBS) were used at 27°C. Transfection conditions: Sf9 cells must have a viability of over 98% and be in the logarithmic growth phase. Sf9 cells were seeded into T-25 culture flasks (4 × 10⁶ cells per flask). 6 (cells), after overnight culture, used FuGENE ® HD transfection reagent was used to co-transfect 0.75 μg of the plasmid library SfpBCRLib and 0.75 μg of A3 helper (an A3 promoter-driven transposase helper plasmid). A total of 108 parallel transfections were performed to achieve a library coverage of over 2000-fold.

[0063] 2.6 Screening to obtain a stable CRISPR / Cas9 genome knockout cell library expressing fall armyworm.

[0064] Forty-eight hours after transfecting Sf9 cells with the plasmid library, they were cultured in complete medium containing 500 μg / ml of Zeocin antibiotic. The culture medium was changed every two days, and cells were passaged if necessary. After 15 days of continuous culture, a stable Sf9 cell library SfGCKLib was obtained.

[0065] Using a cell library as a template, the amplicons required for NGS are amplified using a high-fidelity enzyme. For example... Figure 4 As shown, analysis of NGS data revealed that the fall armyworm whole genome knockout cell library SfGCKLib constructed in this invention contains 90,759 sgRNAs, targeting 14,434 protein-coding genes.

[0066] 3. Screening for acetamiprid ether-sensitive genes

[0067] Reference Figure 5 The screening process is shown below.

[0068] 3.1 The cytotoxicity of the Sf9 cell library to the insecticide acetamiprid was determined, and the screening concentration of acetamiprid was established.

[0069] The Sf9 cells were seeded in 96-well plates at a density of 5 × 10⁶ cells / well. 4After incubating the cells / well for 2 hours, the Sf9 cell supernatant was removed and replaced with medium containing different concentration gradients of acetamiprid (0.001 μmol / L, 0.01 μmol / L, 0.1 μmol / L, 1 μmol / L, 10 μmol / L). Cells were then cultured for 48 hours, and cell viability was assessed using the Cell Counting Kit-8 (CCK-8) assay kit (Beyotime). 10 μL of CCK-8 reagent was added to each well, and after 4 hours, the absorbance peaks at 450 nm and 650 nm were detected using a microplate reader. The IC50 of acetamiprid was calculated. 50 The value is calculated as follows: Cell viability = (OD) / (OD) drug -OD blank ) / (OD control -OD blank )*100%, plotted using Graphad Prism, the result is as follows Figure 6 As shown, IC 50 =0.43 μmol / L.

[0070] 3.2 Screening for functional genes that induce resistance in Sf9 cells to acetamiprid.

[0071] 120 flasks of Sf9 cell library SfGCKLib were randomly and uniformly selected and plated at a density of 4 × 10⁶ cells / mL. 6 240 cells / flasks were evenly divided into two groups: a control group and a drug screening group, and cultured overnight. One group of cell culture flasks was replaced with complete culture medium, while the other group was replaced with complete culture medium containing 400 nM acetamiprid for screening. The culture medium was changed every two days during the screening process. By day 10, the cell death rate reached 80-90%. By day 21, after significant enrichment of the cell library, half of the surviving cells were collected, and genomic DNA was extracted for high-throughput sequencing. The acetamiprid concentration of the other half was increased to 2 μM, and after 7 days of screening, half of the surviving cells were collected again, and genomic DNA was extracted for high-throughput sequencing. The acetamiprid concentration of the other half was increased again to 10 μM, and after 5 days of screening, the cell library again showed a 50% cell death rate. All surviving cells were collected again, and genomic DNA was extracted for high-throughput sequencing.

[0072] 3.3 High-throughput analysis and validation of candidate gene functions

[0073] Cell samples obtained from screening at a low concentration of acetamiprid (400 nmol / L) in step 3.2 were labeled T1, those obtained from screening at a medium concentration of acetamiprid (2 μmol / L) were labeled T2, and those obtained from screening at a high concentration of acetamiprid (10 μmol / L) were labeled T3. After high-throughput sequencing and MAGeCK analysis, 13 candidate acetamiprid sensitivity genes were obtained. The specific screening conditions were as follows: (1) the ranking continuously increased after each round of acetamiprid screening; (2) the p-value was <0.01 after the third round of screening; (3) at least three effective sgRNAs were present after the third round of screening; (4) at least two sgRNAs had a log2 (fold change) ≥3 after the third round of screening (see...). Figure 7 ).

[0074] To verify the reliability of the above 13 candidate genes, the sgRNA with the highest sgRNA enrichment in each gene was selected for single-gene knockout verification. Furthermore, in this invention, knockout of the Sfn270461 gene resulted in significant resistance to acetamiprid. Based on this, three sgRNAs were used for the Sfn270461 gene: SfB4-g1, SfB4-g2, and SfB4-g3. Specifically: single-gene knockout primers are shown in Table 3. The specific plasmid construction method is consistent with the plasmid library construction method. The single-gene knockout cell line construction method is as follows: 1) Sf9 cells were seeded in 6-well plates at a density of 5 × 10⁻⁶ cells / well. 5 1) Cell / well, overnight culture; 2) Using FuGENE ® HD transfection reagent was used to co-transfect 0.3 μg of single gene plasmid and 0.3 μg of A3 helper; 3) 48 hours after transfecting Sf9 cells with single gene plasmid, the library cells were cultured in complete medium containing 500 μg / mL of Zeocin antibiotic. The culture medium was changed every two days. Cell passage was performed if necessary. The cells were cultured continuously for 15 days to obtain stable single gene knockout Sf9 cells.

[0075] Table 3. 13 candidate sensitivity genes and their corresponding sgRNA sequences

[0076]

[0077] 3.4 Screening for the most drug-resistant Sf9 knockout cell line among single-gene knockout cell lines

[0078] Based on the dose-response relationship of acetamiprid with Sf9 cells, the cell viability of single-gene knockout cell lines was detected using a lethal concentration (1 μmol / L). Specific methods: Sf9 cells were seeded in 96-well plates at a density of 5 × 10⁻⁶ cells / well. 4After incubating the cells in one well for 2 hours, the supernatant of Sf9 cells was removed, and the medium was replaced with 1 μmol / L acetamiprid medium. After 48 hours of culture, the cell viability of (Beyotime) cells was assessed using the Cell Counting Kit-8 (CCK-8) assay. 10 μL of CCK-8 reagent was used per well. After 4 hours, the absorbance peaks at 450 nm and 650 nm were detected using a microplate reader. Cell viability was calculated as follows: Cell viability = (OD0.05)0.05 drug -OD blank ) / (OD control -OD blank )*100%. For example... Figure 8 The percentages of NO sgRNA were 8.41%, NC1 16.71%, NC2 19.39%, NC3 17.01%, Sfn270461 (Sf9B4-g1) 92.50%, Sfn270461 (Sf9B4-g2) 88.97%, Sfn270461 (Sf9B4-g3) 96.84%, Sfn250326 12.33%, Sfn250117 13.46%, and Sf The percentages for n120653 are 12.77%, Sfn240417 is 7.15%, Sfn280283 is 8.31%, Sfn110319 is 10.52%, Sfn110579 is 14.47%, Sfn210133 is 7.77%, Sfn170294 is 9.62%, Sfn040115 is 10.65%, Sfn010702 is 4.15%, and Sfn290453 is 9.91%.

[0079] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A method for constructing a Spodoptera frugiperda CRISPR / Cas9 whole genome knockout plasmid library, characterized in that, Includes the following steps: Design and synthesize a whole genome knockout sgRNA library chip for fall armyworm; The sgRNA library chip was amplified using specific primer pairs; the CRISPR / Cas9 knockout vector of fall armyworm was digested into a linearized vector; the amplified product was ligated with the linearized vector, and after ligation, it was transformed into competent cells, plasmids were extracted, and finally the whole genome knockout plasmid library of fall armyworm was obtained.

2. The construction method of claim 1, wherein, The CRISPR / Cas9 knockout vector for the fall armyworm contains a pB-CRISPR vector, a piggyBac transposon, an SfU6 promoter, a target site sgRNA, a Cas9 protein expression cassette, and a selection marker.

3. The construction method according to claim 1, characterized in that, The sequences of the specific primer pairs are shown in SEQ ID NO.5~SEQ ID NO.

6.

4. A method for constructing a CRISPR / Cas9 whole-genome knockout cell library of fall armyworm, characterized in that, The procedure includes the following steps: co-transfecting fall armyworm CRISPR / Cas9 whole genome knockout plasmid library constructed according to any one of claims 1 to 3 with transposase helper plasmid into fall armyworm ovarian cells, and continuously screening with antibiotics for 15 days to obtain fall armyworm CRISPR / Cas9 whole genome knockout cell library.

5. The construction method according to claim 4, characterized in that, The antibiotic was Zeocin, and the screening concentration was 500 μg / ml.

6. The application of a fall armyworm CRISPR / Cas9 whole genome knockout cell library constructed according to any one of claims 4 to 5 in screening for sensitive genes of insecticides, Bt toxins, nucleic acid pesticides, viruses, and bacteria.

7. A method for screening genes susceptible to acetamiprid, comprising the following steps: The fall armyworm CRISPR / Cas9 whole-genome knockout cell library constructed according to any one of claims 4-5 was cultured in a medium containing acetamiprid. A concentration gradient method was used for continuous screening for 33 days, with low concentrations from day 1 to day 21, medium concentrations from day 22 to day 28, and high concentrations from day 29 to day 33. Live cells were collected after each increase in screening concentration, and genomic DNA was extracted for high-throughput sequencing. By analyzing the genes targeted by sgRNA in the enriched cells, candidate sensitive genes for acetamiprid in fall armyworm were screened. Single-gene knockout cell lines were constructed to verify whether the enriched target genes were sensitive genes, ultimately determining the key sensitive genes for acetamiprid in fall armyworm.

8. The screening method according to claim 7, characterized in that, The specific steps of the concentration gradient method are as follows: the concentration of acetamiprid in the culture medium from day 1 to day 21 is 400 nmol / L, the concentration of acetamiprid in the culture medium from day 22 to day 28 is 2 μmol / L, and the concentration of acetamiprid in the culture medium from day 29 to day 33 is 10 μmol / L.

9. The screening method according to claim 7, characterized in that, The candidate susceptibility genes of fall armyworm to acetamiprid include Sfn270461, Sfn250326, Sfn250117, Sfn120653, Sfn240417, Sfn280283, Sfn110319, Sfn110579, Sfn210133, Sfn170294, Sfn040115, Sfn010702, and Sfn290453.

10. The screening method according to claim 7, characterized in that, The sgRNA sequences of the candidate susceptibility gene Sfn270461 to acetamiprid are shown in SEQ ID NO.14~SEQ ID NO.16, respectively; the sgRNA sequences of Sfn250326, Sfn250117, Sfn120653, Sfn240417, Sfn280283, Sfn110319, Sfn110579, Sfn210133, Sfn170294, Sfn040115, Sfn010702, and Sfn290453 are shown in SEQ ID NO.17~SEQ ID NO.28, respectively.

Images