Use of tars2 in preparation of heart injury diagnosis product and therapeutic drug

Abstract

The application relates to the field of biological medicine, and discloses application of TARS2 in preparation of a heart injury diagnosis product and a therapeutic drug. The application provides a molecular index capable of diagnosing chemotherapy drug-induced heart mitochondrial oxidative stress and myocardial injury, and the molecular index can be targeted to prevent or treat cardiotoxicity and improve the life quality of tumor chemotherapy patients.

Description

Technical Field

[0001] This application relates to the field of biomedicine, and more specifically, to the application of TARS2 in the preparation of diagnostic products and therapeutic agents for cardiac injury. Background Technology

[0002] With the continuous improvement of oncology diagnosis and treatment, the mortality rate of cancer patients has decreased. However, damage to other organ functions, especially cardiac damage, caused by anti-cancer treatment is gradually becoming a major factor affecting patient survival. Cardiotoxicity is a serious cardiovascular complication of anti-cancer treatment, including heart failure, myocardial ischemia, and arrhythmias, which can be caused by anti-cancer drugs, such as chemotherapy drugs and targeted therapies. As the survival time and treatment cycle of cancer patients lengthen, the incidence of short-term and long-term adverse reactions related to anti-cancer treatment has increased significantly. More importantly, the occurrence and development of cardiotoxicity may lead to adjustments or even interruption of anti-cancer regimens, thus seriously threatening patient survival. Therefore, effectively preventing and treating cardiotoxic side effects caused by anti-cancer drugs helps improve patients' quality of life and prognosis.

[0003] Doxorubicin is a first-line chemotherapy drug with an anthracycline structure. It exerts a broad-spectrum antitumor effect through multiple mechanisms, including insertion into the DNA double helix, inhibition of topoisomerase II activity, and generation of reactive oxygen species (ROS). It is widely used in the treatment of various malignant tumors, including breast cancer, lymphoma, and osteosarcoma. However, due to its low tissue selectivity, it can damage normal tissues while exerting its antitumor effects. Clinical data show that when the cumulative dose of doxorubicin exceeds 400-550 mg / m²... 2 At this time, patients have a significantly increased risk of developing congestive heart failure, and the incidence shows a clear cumulative dose-dependent characteristic. Therefore, this limits the dosage of chemotherapy drugs used.

[0004] Anthracycline-induced cardiotoxicity is progressive and irreversible, making effective management of chemotherapy-related cardiotoxicity a practical clinical challenge. Studies have shown that optimizing chemotherapy regimens and dosages is a relatively effective way to reduce cardiotoxicity without affecting antitumor efficacy. For example, continuous infusion of the drug for 48 to 96 hours can reduce peak drug concentration, and dosing can be changed from once every three weeks to once a week. However, these strategies only aim to reasonably reduce cardiotoxicity but cannot completely eliminate this risk and fail to fundamentally reverse the myocardial damage caused by chemotherapy drugs.

[0005] Therefore, developing a drug that can repair heart damage caused by chemotherapy drugs is particularly important for improving the quality of life of cancer chemotherapy patients. Summary of the Invention

[0006] The purpose of this invention is to propose a molecular indicator that can diagnose mitochondrial oxidative stress and myocardial damage induced by chemotherapy drugs, and to prevent or treat cardiotoxicity by targeting this molecule, thereby improving the quality of life of cancer chemotherapy patients.

[0007] To achieve the above-mentioned objectives, this application employs the following methods:

[0008] a) Exploring the diagnostic and therapeutic value of TARS2 in chemotherapy-induced cardiotoxicity from the perspective of mitochondrial oxidative stress. It was found that TARS2 transcription and protein expression were significantly increased in doxorubicin-induced mouse and human cardiomyocyte models, and were positively correlated with mitochondrial oxidative stress levels. Therefore, TARS2 can be used as a biomarker for the diagnosis and efficacy assessment of chemotherapy-induced cardiotoxicity.

[0009] b) A TARS2 gene knockdown strategy was employed to investigate its therapeutic effect on doxorubicin cardiotoxicity. This invention used small interfering RNA (siRNA) to knock down the TARS2 gene in cultured human cardiomyocytes, finding that it reduced mitochondrial oxidative stress and apoptosis levels. Using adeno-associated virus serotype 9 (AAV9) to deliver short hairpin RNA (shRNA) to knock down the TARS2 gene in mouse hearts, it was found that this reduced mitochondrial oxidative stress levels in cardiomyocytes and improved cardiac remodeling and contractile function. Therefore, targeting TARS2 can effectively alleviate doxorubicin cardiotoxicity.

[0010] Specifically, this application adopts the following technical solution: In one aspect, this application provides the use of reagents for detecting the expression level of TARS2 or its encoding gene in the preparation of diagnostic products for cardiac injury.

[0011] Secondly, this application provides a diagnostic kit for cardiac injury, including reagents for detecting the expression level of TARS2 or its encoding gene.

[0012] Thirdly, this application provides the use of substances that inhibit TARS2 gene expression in the preparation of drugs for treating heart injury.

[0013] Furthermore, the substance that inhibits TARS2 gene expression includes small interfering RNA, short hairpin RNA, or their coding sequence that targets the TARS2 gene.

[0014] Fourthly, this application provides a pharmaceutical composition comprising a substance that inhibits TARS2 gene expression, and a pharmaceutically acceptable carrier or excipient.

[0015] Furthermore, the substance that inhibits TARS2 gene expression includes small interfering RNA, short hairpin RNA, or their coding sequence that targets the TARS2 gene.

[0016] Sixthly, this application provides a method for screening candidate drugs for cardiac injury, the method comprising the following steps: Step 1: Contact the test substance with cells expressing the TARS2 gene; Step 2: Detect the expression level of TARS2 in the cells; Step 3: Evaluate whether the test substance can significantly reduce the expression level of TARS2. If it can significantly reduce the expression level, it indicates that the test substance is a candidate drug for treating cardiac injury.

[0017] The above-mentioned technical solution of this application is based on the following principles: a) Previous studies have shown that mitochondrial oxidative stress overload is one of the core mechanisms of chemotherapy-induced myocardial injury. However, there is currently a lack of specific interventions that can directly target mitochondria and effectively improve their function. Based on this, this invention identifies and proposes TARS2 as a key molecule regulating mitochondrial oxidative stress in cardiomyocytes. By inhibiting the expression of the TARS2 gene, mitochondrial dysfunction can be alleviated, oxidative stress levels can be reduced, thereby reversing or alleviating chemotherapy-induced cardiac damage.

[0018] (b) RNA therapy, as a rapidly developing cutting-edge technology in recent years, has significant translational potential and clinical application value. For example, Inclisiran (trade name: Lecovir) has been successfully used in the treatment of hypercholesterolemia, exerting its lipid-lowering effect by inhibiting PCSK9 gene expression, thus verifying the effectiveness and feasibility of siRNA therapy. Based on this principle, this invention employs an RNA intervention strategy, designing siRNA or shRNA targeting TARS2 to achieve specific inhibition of its expression. This strategy does not require permanent modification of the DNA genome, has higher biosafety, and is superior to traditional small molecule drugs in terms of targeting precision.

[0019] c) Furthermore, AAV virus-mediated gene delivery technology is one of the important development directions in the current field of gene therapy. AAV9, in particular, has high affinity and selectivity for cardiac tissue. As an siRNA delivery vector, it can efficiently infect cardiomyocytes and achieve stable expression, while avoiding significant immune responses. Therefore, using AAV9 to deliver RNA intervention molecules targeting TARS2 can help further improve the tissue specificity and cellular intervention efficiency of drugs, thereby enhancing the overall therapeutic effect.

[0020] In summary, this application has the following beneficial effects: a) Although chemotherapy-induced myocardial injury exhibits significant heterogeneity, mitochondrial oxidative stress overload is considered a common key pathological mechanism. Compared to traditional drugs, TARS2, as a mitochondrial-targeting molecule, can directly locate within the mitochondria and precisely regulate oxidative stress levels, thus potentially achieving higher specificity and better therapeutic effects.

[0021] b) In vivo RNA delivery technology based on AAV vectors has developed rapidly in recent years, and clinical trials have confirmed its safety and reliability in drug delivery. This technology has good biocompatibility and low toxicity risk, while significantly improving the targeted delivery efficiency to specific tissues, providing strong technical support for long-term therapeutic applications.

[0022] c) TARS2 is highly expressed primarily in cardiomyocytes, while its expression level is relatively low in other cell types (such as endothelial cells, fibroblasts, and immune cells). Therefore, changes in its transcriptional and protein levels more directly reflect the mitochondrial oxidative stress state of cardiomyocytes. Compared to related molecules in previous studies, TARS2 is more cardiomyocyte-specific and holds promise as a reliable biomarker and therapeutic target, potentially reducing interference from immune inflammatory responses and other systemic comorbidities to some extent. Attached Figure Description

[0023] Figure 1 TARS2 is mainly expressed in cardiomyocytes in the heart. (A) Classification diagram of cardiomyocytes and non-cardiomyocytes; (B) Expression distribution diagram of TARS2 in different cardiac cell types; (C) Isolation and verification process of cardiomyocytes and non-cardiomyocytes in adult mice; (D) Detection of TARS2 protein expression level in mouse cardiomyocytes and non-cardiomyocytes by Western blotting.

[0024] Figure 2 Knockdown of TASR2 inhibits mitochondrial oxidative stress and apoptosis in human cardiomyocytes. (A) Flowchart of cell experiments; (B) Results of TASR2 protein expression levels; (CD) Graphs of functional experimental results.

[0025] Figure 3Knocking down the TASR2 gene can improve doxorubicin-induced cardiotoxicity. (A) Animal experiment flowchart; (B) TARS2 protein expression level in the heart tissue of mice in each group; (CD) Heart weight and heart failure gene expression results in mice in each group; (EF) Echocardiography results; (GH) Mitochondrial oxidative stress level and cell viability in cardiomyocytes. Detailed Implementation

[0026] The technical solutions and effects of this application will be further described in detail below with reference to the embodiments and accompanying drawings. It should be understood that the specific embodiments described herein are merely for explaining the invention and are not intended to limit the invention.

[0027] Example a) Research Methodology 1. Experimental Materials 1.1 Cells The human AC16 cells used in this experiment were purchased from the American Type Culture Collection (ATCC) and cultured using high-glucose DMEM and 10% fetal bovine serum.

[0028] 1.2 Animals Wild-type male C57BL / 6 mice, aged 6–8 weeks, used in this experiment were purchased from Vital River Pharmaceuticals, Beijing. The animals were housed in the animal facility of Zhongshan Hospital affiliated with Fudan University, under a 12-hour light / dark cycle, at a temperature of 22°C–24°C and a relative humidity of 40%–70%, with free access to water and standard feed. All experimental protocols were reviewed and approved by the Laboratory Animal Ethics Committee of Zhongshan Hospital affiliated with Fudan University before implementation.

[0029] 2. Modeling and Intervention 2.1 Animal modeling and intervention To establish a mouse model of doxorubicin-induced cardiomyopathy, mice were randomly divided into two groups, receiving doxorubicin (Dox, 5 mg / kg; catalog number HY-15142A, MedChemExpress, USA) or a solvent control (dimethyl sulfoxide [DMSO], 200 µL) via intraperitoneal injection, respectively. Body weight was monitored weekly, and the injection dose was adjusted accordingly for 4 weeks, with a cumulative dose reaching 20 mg / kg.

[0030] To evaluate the therapeutic effect of inhibiting the TARS2 gene in vivo, mice were injected with AAV9 encoding shRNA targeting TARS2 (shTARS2, sequence 5′-GCGGCUAUGUUAUCCAAUATT-3′, SEQ ID NO:1) under the control of the cTnT promoter. Six-week-old mice were administered 100 μL of AAV9-shTARS2 or AAV9-shNC via tail vein injection at a dose of 1 × 10⁻⁶ per mouse. 12 vg. AAV9 injection was performed one week prior to the start of the doxorubicin model.

[0031] 2.2 Cell Modeling and Intervention Human AC16 cardiomyocytes were grown to 50%–70% confluence for modeling and intervention. After identification and confirmation of mycoplasma-free contamination, cells were cultured under standard cell culture conditions (37°C, 5% CO2) in DMEM medium (catalog number 8121728, Gibco, USA) supplemented with 10% fetal bovine serum (FBS, catalog number A5669701, Gibco, USA). The medium was changed every 48 hours, and cells were cultured for the specified experimental duration. To induce mitochondrial dysfunction, cells were treated with 1 μM doxorubicin for 24 hours.

[0032] The specific siRNA targeting TARS2 (siTARS2, sequence 5'-CCAAGTACAGAATATGGCTTT-3', SEQ ID NO:2) and control siRNA were chemically synthesized by Hanheng Biotechnology (Shanghai, China). The siRNA was diluted in serum-free Opti-MEM medium (catalog number 11058021, Gibco, USA) and then mixed with Lipofectamine RNAiMAX (catalog number 13778075, Thermo Fisher, USA) according to the manufacturer's instructions. After incubation at room temperature for 5 minutes, the siRNA-Lipofectamine complex was added to cells containing complete culture medium and incubated at 37°C, 5% CO2 for 24–48 hours.

[0033] 3. Main observation indicators 3.1 Detection of cardiac function in mice Transthoracic echocardiography was performed using a Vevo 2100 imaging system (VisualSonics, Canada) equipped with an MS-400 probe. Mice were placed in a supine position on a 37°C thermostatically heated platform and anesthetized with 1.5–2.0% isoflurane administered intranasally. Heart rate was continuously monitored and maintained at 450–550 bpm. M-mode ultrasound images were acquired at the papillary muscle level. In addition, myocardial motion was assessed using speckle-tracking-based strain analysis (via the VevoStrain module, based on B-mode recording). All echocardiographic measurements were performed in a double-blind manner and analyzed using VevoLAB software (v2.1.0, VisualSonics, Canada). Left ventricular fractional shortening (FS) [(LVIDd – LVIDs) / LVIDd] and left ventricular ejection fraction (EF) [(LVVol;d – LVVol;s) / LVVol;d × 100%] were calculated from these M-mode measurements.

[0034] 3.2 Detection of TARS2 levels in tissues and cells 3.2.1 Detection of TARS2 protein levels by Western blot Left ventricular tissue homogenate lysis buffer was prepared on ice using RIPA lysis buffer (Catalog No.: P0013C, Beyotime, China) with a protease inhibitor mixture (Catalog No.: 78443, 1:100, ThermoFisher, USA). The lysis buffer was centrifuged at 12,500g for 20 min at 4°C, and the protein concentration in the supernatant was determined using a BCA protein quantification kit (Catalog No.: P0010, Beyotime, China). Protein samples were mixed with 5× loading buffer, denatured at 95°C for 10 min, and 10–20 µg of protein was loaded into each well. After separation by 10–12% SDS-PAGE gel electrophoresis, the samples were transferred to PVDF membranes (Catalog No.: IPVH00010, Millipore, USA). The membrane was blocked in Tris-buffered saline containing 5% bovine serum albumin (BSA) at room temperature for 1 hour, followed by overnight incubation at 4°C with the following primary antibodies: anti-TARS2 antibody (catalog number: A12853, 1:1000, ABclonal, China) and anti-β-actin antibody (catalog number: KC-5A08, Kangcheng Biotechnology, China). After washing, the membrane was incubated at room temperature for 1 hour with horseradish peroxidase (HRP)-labeled anti-rabbit secondary antibody (1:5000). Protein bands were visualized using enhanced chemiluminescence (ECL) reagent (catalog number: WBLUF0500, Millipore, USA), and images were acquired using a ChemiDoc Touch imaging system (Bio-Rad, USA). Band intensities were quantified using ImageLab and ImageJ software for statistical analysis.

[0035] 3.2.2 Detection of TARS2 transcription levels using real-time quantitative polymerase chain reaction (RT-qPCR) Total RNA was extracted from mouse heart tissue using the UNIQ-10 Trizol Total RNA Extraction Kit (Catalog No.: B511321-0100, Sangon Biotech, China) according to the manufacturer's instructions. Complementary DNA (cDNA) was synthesized from the high-quality RNA using the PrimeScript RT Kit (Catalog No.: RR036A, Takara, Japan). Real-time quantitative PCR (RT-qPCR) was performed on a CFX96 real-time quantitative PCR system (Bio-Rad Laboratories, USA) using qPCR SYBR premix (Catalog No.: SGD386, Vazyme, China). The thermal cycling parameters were as follows: denaturation at 95°C for 10 seconds, followed by annealing / extension at 60°C for 30 seconds, for a total of 39 cycles. 2 The ΔΔCt method is used to quantify gene expression.

[0036] The primer sequences used are shown below: Mouse TARS2, upstream primer TTGGCAGAACGATTTGGCCTT, SEQ ID NO:3; downstream primer GTTGTGTTCCATGCAACAGCA, SEQ ID NO:4; Human TARS2, upstream primer CCGGCTCCAAGGTTTACAGG, SEQ ID NO:5; downstream primer TGTGCCATGCTTGCTAATCTC, SEQ ID NO:6.

[0037] 3.3 Detection of mitochondrial oxidative stress levels Mitosolic reactive oxygen species (ROS) levels were assessed using MitoSOX Red fluorescent indicator (catalog number: M36008, Invitrogen, USA) according to the manufacturer's instructions. Briefly, the stock solution was diluted with calcium-magnesium HBSS buffer to prepare the working solution. Cultured human AC16 cardiomyocytes or adult mouse ventricular myocytes (AMVMs) were maintained in the appropriate culture medium and incubated with the dye at 37°C for 10 minutes. Fluorescence was captured using a confocal laser scanning microscope (FV3000, Olympus, Japan), with a maximum excitation / emission wavelength of approximately 396 / 610 nm.

[0038] b) Research Results 1. TARS2 is mainly expressed in cardiomyocytes in the heart. First, we analyzed the expression distribution of TARS2 in different cardiac cell types using human heart single-cell transcriptome sequencing data. Based on cell type, we divided cardiac cells into cardiomyocytes (CMs) and non-cardiomyocytes (Non-CMs). Figure 1 A). The results showed that TARS2 was enriched in the cardiomyocyte population ( Figure 1 B). To further verify the above results, we isolated cardiomyocytes and non-cardiomyocytes from adult mice (B). Figure 1 C), and the protein expression level of TARS2 was detected by Western blotting. The results showed that TARS2 protein expression was significantly increased in cardiomyocytes compared with non-cardiomyocytes (C). Figure 1 D).

[0039] 2. Knockdown of TASR2 can inhibit mitochondrial oxidative stress and apoptosis in human cardiomyocytes. We treated human AC16 cardiomyocytes with doxorubicin (Dox) and assessed their function by intervening in TARS2 expression. Figure 2 A). After 24 hours of treatment with Dox (1 μM), TARS2 expression levels increased; however, transfection with siRNA targeting TARS2 effectively inhibited its upregulation. Figure 2 B). Functional experiments further showed that Dox treatment significantly induced mitochondrial oxidative stress in cardiomyocytes and promoted apoptosis; while knockdown of TARS2 significantly alleviated the above-mentioned damage (B). Figure 2 These results suggest that knocking down TASR2 can inhibit mitochondrial oxidative stress and apoptosis in human cardiomyocytes.

[0040] 3. Knocking down the TASR2 gene can improve doxorubicin-induced cardiotoxicity. To further validate the role of TARS2 in vivo, we constructed a mouse model of doxorubicin-induced cardiomyopathy. We administered AAV9-mediated shRNA intervention targeting TARS2 to some mice one week prior to the intervention, followed by weekly intraperitoneal injections of Dox (5 mg / kg) for a cumulative dose of 20 mg / kg. Figure 3 A). We examined the protein level of TARS2 in myocardial tissue and found that Dox induced an increase in TARS2 expression, while knocking down TARS2 significantly downregulated its protein level. Figure 3 B). Simultaneously, knocking down TARS2 alleviated Dox-induced cardiac weight loss and upregulation of the heart failure gene Nppb ( Figure 3CD). Echocardiography results showed that in the Dox-treated group, mice exhibited impaired cardiac systolic function and cardiac dilation, manifested as decreased left ventricular ejection fraction (LVEF) and fractional shortening (FS), as well as increased intraventricular diameter during systole and diastole; while knockdown of TARS2 significantly improved cardiac remodeling and dysfunction. Figure 3 EF). To further evaluate the effects of TARS2 knockdown on cardiomyocytes, we isolated cardiomyocytes from these mice and examined mitochondrial oxidative stress levels and cell viability. The results showed that TARS2 knockdown inhibited Dox-induced mitochondrial oxidative stress and enhanced cell viability (EF). Figure 3 GH).

[0041] The technical solution of this application can be implemented through the following process: a) In clinical practice, for patients receiving chemotherapy for cancer, serum TARS2 protein levels can be detected using enzyme-linked immunosorbent assay (ELISA) to assess the degree of cardiac oxidative stress damage induced by chemotherapy drugs. For patients with significant cardiotoxicity, myocardial biopsy can be used to detect changes in the expression of this gene to screen for individuals who may be sensitive to targeted TARS2 therapy.

[0042] b) In addition to the standard doxorubicin chemotherapy regimen, an AAV9-mediated siRNA drug targeting TARS2 can be administered via intravenous infusion or intraperitoneal injection under ultrasound guidance. Intervention is recommended approximately 24 hours before doxorubicin administration to provide prophylactic protection. During treatment, the following indicators should be monitored regularly: (1) echocardiographic cardiac function parameters; (2) serum biomarkers related to heart failure and myocardial injury; and (3) tumor treatment response. This invention is based on a therapeutic strategy of inhibiting TARS2 gene expression to reduce cardiac mitochondrial oxidative stress, aiming to prevent and intervene in chemotherapy-related cardiotoxicity, thereby providing greater flexibility for optimizing chemotherapy regimens and dosages, and improving patients' cardiovascular tolerance.

[0043] c) The above-mentioned diagnostic, testing and treatment measures should be carried out in medical centers with qualifications for the diagnosis and treatment of oncology and cardiology, and relevant clinical research and translational applications should be implemented under the collaborative guidance of clinicians, basic researchers and biotechnology engineers.

[0044] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. Application of reagents for detecting the expression level of TARS2 or its encoding gene in the preparation of diagnostic products for cardiac injury.

2. A diagnostic kit for cardiac injury, characterized in that, This includes reagents for detecting the expression level of TARS2 or its encoding gene.

3. Application of substances that inhibit TARS2 gene expression in the preparation of drugs for the treatment of cardiac injury.

4. The application according to claim 3, characterized in that, The substances that inhibit TARS2 gene expression include small interfering RNA, short hairpin RNA, or their coding sequences that target the TARS2 gene.

5. A pharmaceutical composition, characterized in that, It contains substances that inhibit TARS2 gene expression, as well as pharmaceutically acceptable carriers or excipients.

6. The pharmaceutical composition according to claim 6, characterized in that, The substances that inhibit TARS2 gene expression include small interfering RNA, short hairpin RNA, or their coding sequences that target the TARS2 gene.

7. A method for screening candidate drugs for cardiac injury, characterized in that, The method includes the following steps: Step 1: Contact the test substance with cells expressing the TARS2 gene; Step 2: Detect the expression level of TARS2 in the cells; Step 3: Evaluate whether the test substance can significantly reduce the expression level of TARS2. If it can significantly reduce the expression level, it indicates that the test substance is a candidate drug for treating cardiac injury.

Images