Use of a molecular marker associated with body length traits in sheep

By applying molecular markers at specific SNP sites in grassland short-tailed sheep, the problem of low efficiency in traditional phenotypic selection was solved, enabling precise breeding of sheep body length traits and improving the body length trait of offspring.

CN122428048APending Publication Date: 2026-07-21INNER MONGOLIA AGRICULTURAL UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INNER MONGOLIA AGRICULTURAL UNIVERSITY
Filing Date
2026-06-23
Publication Date
2026-07-21

AI Technical Summary

Technical Problem

In current technologies, the selection of body length traits in grassland short-tailed sheep relies on traditional phenotypic selection, which is inefficient, time-consuming, and easily affected by the environment. It is difficult to meet the needs of modern high-efficiency breeding and lacks molecular markers that are significantly associated with the specific genetic background of grassland short-tailed sheep and body length.

Method used

Four molecular markers associated with sheep body length traits are provided, located at SNP loci on different chromosomes (chr2: 9222735, chr3: 87552137, chr15: 44953329, chr20: 28298919). By detecting the genotypes at these loci, sheep carrying specific genotypes can be selected as parents for breeding to improve the body length of offspring.

Benefits of technology

This has enabled precise and efficient breeding of sheep body length traits, improved the body length traits of offspring, and met the needs of modern breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122428048A_ABST
    Figure CN122428048A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of livestock molecular genetic breeding, and particularly relates to application of a molecular marker related to a sheep body length trait. The molecular marker comprises four SNP sites on sheep chromosome 2, 3, 15 and 20, the base sequences of which are shown in SEQ ID NO. 1-4, and the base at the 101th position of each sequence is T / C, T / C, G / A and T / A polymorphism respectively. Through whole genome association analysis, the above sites are significantly related to the body length trait. In breeding, by detecting the genotypes of the sites and preferentially selecting individuals with TT, TT, GG and / or AA genotypes as parents, the average body length of the offspring population can be effectively improved, and a reliable tool is provided for molecular assisted breeding of grassland short-tailed sheep.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of livestock molecular genetics breeding technology, specifically providing an application of molecular markers related to the body length trait of sheep. Background Technology

[0002] The steppe short-tailed sheep is a superior meat sheep breed unique to the Inner Mongolian Plateau region. It possesses excellent advantages such as cold resistance, tolerance to roughage, and a short tail, playing a vital role in the region's livestock development. Body length, as a key body shape trait, directly affects production performance and economic benefits.

[0003] Currently, the breeding of body length traits in grassland short-tailed sheep still mainly relies on traditional phenotypic selection, which has limitations such as long cycle, low efficiency, and susceptibility to environmental influences, making it difficult to meet the needs of modern high-efficiency breeding. Although some studies have reported on molecular markers related to sheep body size traits, there is a lack of functional SNP markers that are systematically population-validated and significantly associated with body length for the specific genetic background of grassland short-tailed sheep.

[0004] Therefore, developing molecular markers suitable for early and accurate prediction of body length traits in sheep in the Inner Mongolia Plateau region is of great significance for promoting the genetic improvement of this breed and the construction of a molecular breeding system. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides an application of molecular markers related to sheep body length traits.

[0006] This invention is achieved through the following technical solution: Application of a molecular marker associated with sheep body length trait, said molecular marker being at least one of the following 1) to 4): 1) The base sequence of the molecular marker is shown in SEQ ID NO.1, and the base at position 101bp is T or C.

[0007] 2) The base sequence of the molecular marker is shown in SEQ ID NO.2, and the base at position 101bp is T or C.

[0008] 3) The base sequence of the molecular marker is shown in SEQ ID NO.3, and the base at position 101bp is G or A.

[0009] 4) The base sequence of the molecular marker is shown in SEQ ID NO.4, and the base at position 101bp is T or A.

[0010] The application refers to any one of the following (1) and (2): (1) Identify the body length of the sheep: The body length when the base at position 101bp of SEQ ID NO.1 is T is greater than the body length when it is C; the body length when the base at position 101bp of SEQ ID NO.2 is T is greater than the body length when it is C; the body length when the base at position 101bp of SEQ ID NO.3 is G is greater than the body length when it is A; and / or the body length when the base at position 101bp of SEQ ID NO.4 is A is greater than the body length when it is T.

[0011] (2) To increase the body length of sheep offspring: individuals with the base T at position 101bp of SEQ ID NO.1, individuals with the base T at position 101bp of SEQ ID NO.2, individuals with the base G at position 101bp of SEQ ID NO.3, and / or individuals with the base A at position 101bp of SEQ ID NO.4 are selected as parents for breeding, in order to increase the body length of sheep offspring.

[0012] Preferably, the method for determining the body length of a sheep is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced.

[0013] Determine the genotype of the sheep at the 101 bp site of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and / or SEQ ID NO.4.

[0014] If the genotype is at least one of A) to D), then the sheep is a large-body long sheep, where large-body long means a body length of 71.086cm to 71.800cm.

[0015] A) The genotype at position 101bp of SEQ ID NO.1 is TT.

[0016] B) The genotype at position 101bp of SEQ ID NO.2 is TT.

[0017] C) The genotype at position 101bp of SEQ ID NO.3 is GG.

[0018] D) The genotype at position 101bp of SEQ ID NO.4 is AA.

[0019] Preferably, the method for increasing the body length of sheep offspring is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced.

[0020] Determine the genotype of the sheep at the 101 bp site of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and / or SEQ ID NO.4.

[0021] By selecting sheep individuals carrying at least one of the genotypes shown in a) to d) as parents for breeding, the body length of sheep offspring can be increased. a) The genotype at position 101bp of SEQ ID NO.1 is TT; b) The genotype at position 101bp of SEQ ID NO.2 is TT; c) The genotype at position 101 of SEQ ID NO.3 is GG; d) The genotype at position 101bp of SEQ ID NO.4 is AA.

[0022] Preferably, the genomic DNA is derived from sheep blood.

[0023] Preferably, the sequencing method is high-throughput sequencing.

[0024] Preferably, the genomic DNA is extracted using the magnetic bead method.

[0025] Preferably, the sheep is a steppe short-tailed sheep.

[0026] Compared with the prior art, the present invention has the following beneficial effects: This invention provides the application of molecular markers related to sheep body length traits. The molecular markers are located on sheep chromosome 2, in the reference genome Oar_v4.0, at physical location chr2:9222735, and their base sequence is shown in SEQ ID NO.1, with the base at the 101 bp site being either T or C. The molecular markers are also located on sheep chromosome 3, in the reference genome Oar_v4.0, at physical location chr3:87552137, and their base sequence is shown in SEQ ID NO.2, with the base at the 101 bp site being either T or C. Finally, the molecular markers are located on sheep chromosome 15, in the reference genome Oar_v4.0, at physical location chr15:44953329, and their base sequence is shown in SEQ ID NO.3, with the base at the 101 bp site being either G or A. The molecular marker is located on sheep chromosome 20, in the reference genome Oar_v4.0, at physical location chr20:28298919. Its local base sequence is shown in SEQ ID NO.4, with the base at position 101 bp being either T or A. Genome-wide association analysis and multi-model cross-validation confirmed that all the above-mentioned sites reached genomic significance (P < 1 × 10⁻⁶). -6Genotype-phenotype association analysis showed that individuals with the genotype TT at the 101bp locus of SEQ ID NO.1, the genotype TT at the 101bp locus of SEQ ID NO.2, the genotype GG at the 101bp locus of SEQ ID NO.3, and / or the genotype AA at the 101bp locus of SEQ ID NO.4 had significantly longer body lengths than those with other genotypes. P <0.05.

[0027] By detecting the above SNP sites, homozygous individuals with genotype TT at the 101bp site of SEQ ID NO.1, genotype TT at the 101bp site of SEQ ID NO.2, genotype GG at the 101bp site of SEQ ID NO.3, and / or genotype AA at the 101bp site of SEQ ID NO.4 are preferentially selected as parents to improve the body length of offspring and achieve precise and efficient breeding. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0029] Figure 1 This is a distribution diagram of the SNPs after quality control in a 1Mb window of the chromosome. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size.

[0030] Figure 2 This is a visualization of the genomic kinship matrix, or G matrix, of sheep populations in the Inner Mongolia Plateau region according to this invention.

[0031] Figure 3 Manhattan plot of genome-wide association analysis of body length trait in sheep from the Inner Mongolia Plateau region in this invention; Figure 3 In the diagram, A represents the analysis results of the fastGWA-mlm model; B represents the analysis results of the FarmCPU model; and C represents the analysis results of the Fast3VmrMLM model. Red dots indicate SNP sites that have reached genomic significance. Detailed Implementation

[0032] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0033] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0034] The technical solution of the present invention will be further described below with reference to specific embodiments.

[0035] Manhattan Plot.

[0036] SNP: Single nucleotide polymorphism.

[0037] GWAS: Genome-wide association analysis.

[0038] Example 1 1. Experimental animals and phenotypic sources: This invention pertains to 300 adult grassland short-tailed sheep from the Aiyiti Sheep Breeding Farm in Inner Mongolia Autonomous Region. The body length of each sheep was measured using a measuring stick. Detailed phenotypic records are shown in Table 1.

[0039] Table 1. Description of body length traits in grassland short-tailed sheep

[0040] 2. Genomic DNA extraction and quality control Blood samples were collected, and genomic DNA was extracted from the blood samples using the magnetic bead method. The concentration of DNA, the ratio of the absorption wavelengths of the highest absorption peaks of nucleic acids, proteins, and phenolic substances (260 nm / 280 nm), and the ratio of the absorption wavelengths of the highest absorption peaks of carbohydrates (260 nm / 230 nm) were detected using a NanoDrop2000 spectrophotometer. The DNA quality was assessed by 1% w / v agarose gel electrophoresis.

[0041] 3. Library construction and sequencing The quality-tested DNA was randomly fragmented into approximately 350 bp fragments using a Covaris ultrasonic disruptor. The DNA fragments underwent end repair, poly A addition, sequencing adapter addition, purification, and PCR amplification to complete the entire library preparation process. After library construction, preliminary quantification was performed using Qubit 2.0, and qPCR was used to accurately quantify the effective concentration of the library to ensure library quality. After passing quality testing, sequencing was performed using the BGI MGI-T7 sequencing platform in PE150 mode.

[0042] 4. Identification, screening, and annotation of variant sites Raw sequencing data was quality-controlled using FASTP software to obtain Clean reads. A genome index was built on the reference genome. The quality-controlled Clean reads were aligned with the sheep reference genome Oar_v4.0, GCF_000298735.2 using Burrows-Wheeler Aligner software version 0.7.17. The aligned SAM files were converted to BAM files and sorted using SAMtools software version 1.8-20. Duplicates were removed from the sorted BAM files using the MarkDuplicates program in Genome Analysis Toolkit version 3.8. An index was built on the final BAM file. SNP variant detection was performed using the HaplotypeCaller module in GATK software, and the resulting VCF file was filtered using the VariantFiltration module. Functional annotation of the detected gene variants was performed using the ANNOVAR software package.

[0043] 5. Group stratification correction Whole-genome resequencing was performed on 300 sheep individuals from the Inner Mongolian Plateau region, generating a total of 15768.1 Gb of raw reads and identifying 56,632,165 SNPs. The genotyping data were quality controlled using Plink software version 1.90, removing individuals with a genotype detection rate <98%, SNPs with a detection rate <98%, SNPs with a minimum allele frequency <5%, and SNPs with a Hardy-Weinberg equilibrium p-value <10. -6 A total of 23,751,522 high-quality SNPs were identified in sheep populations in the Inner Mongolian Plateau region. These loci are evenly distributed across the 26 pairs of autosomes in sheep from the Inner Mongolian Plateau region. Figure 1 As shown.

[0044] The first three principal components were calculated using the "--pc3" parameter in Plink software version 1.90. These three principal components were then used as covariates to correct for population stratification in sheep populations in the Inner Mongolian Plateau region. Genomic phylogenetic analysis based on the G-matrix was performed on this population using Plink v1.90, and the results are as follows: Figure 2 As shown, Figure 2 Each small square in the diagram represents the kinship value between any two individuals from the first to the last sample. The smaller the value, the closer it is to light green, indicating a more distant kinship between the two individuals, and vice versa. The results show that the average kinship between sheep individuals in the Inner Mongolian Plateau region is relatively distant.

[0045] 6. Genome-wide association analysis The association between SNPs and body length traits was analyzed using the fastGWA-mlm model in GCTA software version V1.94.0beta.

[0046] y=X snp β snp +X c β c +g+e.

[0047] Where y is the phenotypic vector; X snp It is a genotype vector, and its effect is β. snp ;X c It is an association matrix with gender, age, and the first three principal components (PCA) as fixed covariates, and its corresponding coefficient is β. c ;g is the vector of total genetic effects captured by the genetic relationship matrix derived from SNPs, g~N(0, ); π is a genetic relation matrix vector derived from SNP, where all off-diagonal elements are set to 0; e is the residual vector, e ~ N(0, ).

[0048] To avoid false negatives caused by the overly strict Bonferroni correction method of 0.05 / SNP, this invention adjusts the threshold for genome-wide significant association to P=1×10⁻⁶. -6 The genome expansion factor λ, i.e., the slope of the linear regression between the observed quantile and the theoretical quantile, was calculated using R software version V3.6.0. The λ value for the body length trait was 0.960, indicating no significant genome expansion. Based on resequencing data from 300 sheep from the Inner Mongolian Plateau region, 178 significant SNP loci associated with the body length trait were detected. These loci are located on chromosomes 1, 2, 3, 4, 5, 10, 15, 18, 20, and 22, as shown in Table 2. Figure 3 As shown in Figure A.

[0049] Table 2. SNP loci significantly associated with sheep body length traits identified based on the fastGWA-mlm model.

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056] Association analysis between SNPs and body length traits was performed using the FarmCPU model integrated in the rMVP package of R software. Based on resequencing data from 300 sheep from the Inner Mongolian Plateau region, a total of 140 SNP loci significantly associated with body length traits were detected. These significant loci were distributed on chromosomes 1, 2, 3, 4, 10, 15, 20, and 22. (See Table 3 and...) Figure 3 As shown in B in the figure. This model effectively controls the false positive rate by iteratively optimizing the fixed and random effects, further verifying the complexity of the genetic structure of body length traits.

[0057] Table 3. SNP loci significantly associated with sheep body length traits identified based on the FarmCPU model.

[0058]

[0059]

[0060]

[0061]

[0062] Association analysis between SNPs and body length traits was performed using the Fast3VmrMLM model. Based on resequencing data from 300 sheep from the Inner Mongolian Plateau region, 18 SNP loci significantly associated with body length were detected. These significant loci were located on chromosomes 1, 2, 3, 5, 6, 11, 12, 13, 15, 20, and 25. (See Table 4). Figure 3 As shown in C in the figure. This multi-locus association analysis model can simultaneously detect multiple QTNs, improving the detection efficiency for complex trait genetic loci and revealing a wider range of chromosomal regions associated with the formation of body length traits in sheep in the Inner Mongolia Plateau region.

[0063] Table 4. Significant SNP loci associated with body length traits in sheep from the Inner Mongolia Plateau region.

[0064] In summary, by employing three different association analysis models—GCTA-fastGWA, rMVP-FarmCPU, and Fast3VmrMLM—this invention systematically identified SNP loci significantly associated with body length traits in sheep populations in the Inner Mongolian Plateau region. The loci revealed by the different models overlap in both number and distribution, yet each model has its own emphasis, collectively outlining a complex genetic network controlling body length traits in sheep from the Inner Mongolian Plateau region. This provides a solid data foundation and diverse candidate targets for subsequent molecular marker development and breeding applications.

[0065] A comprehensive analysis of the results of the three models revealed an SNP site located at position 9222735 on chromosome 2, namely chr2_9222735, which corresponds to a T→C mutation at the 101st base in SEQ ID NO.1. This mutation was significant in all models and was stably associated with body length traits.

[0066] A SNP site exists at position 87552137 on chromosome 3, namely chr3_87552137, which corresponds to a T→C mutation at base 101 in SEQ ID NO.2. This mutation is significant in different models and is stably associated with body length traits.

[0067] A SNP site exists at position 44953329 on chromosome 15, namely chr15_44953329, which corresponds to a G→A mutation at base 101 in SEQ ID NO.3. This mutation is significant in different models and is stably associated with body length traits.

[0068] A SNP site exists at position 28298919 on chromosome 20, namely chr20_28298919, which corresponds to a T→A mutation at base 101 in SEQ ID NO.4. This mutation is significant in different models and is stably associated with body length traits.

[0069] 7. Validation and effect analysis of key SNP sites Genotyping and phenotypic association analysis was performed on the key locus chr2_9222735, and the results are shown in Table 5.

[0070] Table 5. Association analysis between different genotypes of the key SNP locus chr2_9222735 and body length.

[0071] Note: Different lowercase letters indicate significant differences. P <0.05.

[0072] As shown in Table 5, individuals with the TT genotype have the largest body length, which can serve as a genetic marker for taller individuals; while individuals with the CC genotype have the smallest body length. The allele frequencies and genotype frequencies at this locus are shown in Table 6.

[0073] Table 6. Allele frequencies and genotype frequencies of key SNP loci.

[0074] The base sequence containing this mutation site is shown in SEQ ID NO.1, where position 101 is represented by [T / C]: Specifically: GGAATCACCCGGGAGCCTGTGAGAAGCTTAGAACGCCAGGTCCCATCTCGGATCTCCATCTGAGGTCTACTTGTAACAGGTGCCTGGGAGATTCCCGCG[T / C]GTGTGTGTGAGAAGCCCTGCCCAACCAGGCTGCTTGAATTTGAGTCCCTCTGCCACCTGTCTGAGGGAAGGACCCTGAGCAAGTCATCATACTCTTTCAA.

[0075] Genotyping and phenotypic association analysis was performed on the key locus chr3_87552137, and the results are shown in Table 7.

[0076] Table 7. Association analysis between different genotypes and body length of the key SNP locus chr3_87552137.

[0077] Note: Different lowercase letters indicate significant differences. P <0.05.

[0078] As shown in Table 7, individuals with the TT genotype have the largest body length and can serve as a genetic marker for taller individuals; individuals with the CC genotype have the smallest body length. The allele frequencies and genotype frequencies at this locus are shown in Table 8.

[0079] Table 8 Allele frequencies and genotype frequencies of key SNP loci

[0080] The base sequence containing this mutation site is shown in SEQ ID NO.2, where position 101 is represented by [T / C], specifically: TCAATCAGTAAATAAATTGTCAACTAATATTTAACAATTTAAAAATAACTGCATAATTGCACTAAAATGCTCAGTAACATCTTGTTGCATACTCTGAGCA[T / C]TGCTTAAAAGAACATTTATTCAGCCAAGAAAGTTTGGGTGGTATAAAATATCTAGAACAATAGCCTGAACTTTGTGATTTCTTAAACACTCAGGTTTTCC.

[0081] Genotyping and phenotypic association analysis was performed on the key locus chr15_44953329, and the results are shown in Table 9.

[0082] Table 9. Association analysis between different genotypes of the key SNP locus chr15_44953329 and body length.

[0083] Note: Different lowercase letters indicate significant differences. P <0.05.

[0084] As shown in Table 9, individuals with the GG genotype have the largest body length, which can serve as a genetic marker for taller individuals; individuals with the AA genotype have the smallest body length. The allele frequencies and genotype frequencies at this locus are shown in Table 10.

[0085] Table 10 Allelic and Genotype Frequencies of Key SNP Loci

[0086] The base sequence containing this mutation site is shown in SEQ ID NO.3, where position 101 is represented by [G / A], specifically: AATTTTAACTTTAACACAGTAAAATATGTCAATGATGCTTATTAAAGGTGTATTTATGTCATGTGTTAAATTCTTTCCTATCCCAGTGTCATATTCTGC[G / A]ATATTTTCTTCTCAAATTTTTAAGTTTTTAACATTTATATTGTAATGCACCAAGAACTTACTTATTTTATGTATATTGTGAGAAAAACACTCTCATTTTT.

[0087] Genotyping and phenotypic association analysis was performed on the key locus chr20_28298919, and the results are shown in Table 11.

[0088] Table 11 Association analysis of different genotypes and body length of the key SNP locus chr20_28298919

[0089] Note: Different lowercase letters indicate significant differences. P <0.05.

[0090] As shown in Table 11, individuals with the AA genotype have the largest body length, which can serve as a genetic marker for taller individuals; individuals with the TT genotype have the smallest body length. The allele frequencies and genotype frequencies at this locus are shown in Table 12.

[0091] Table 12 Allelic and Genotype Frequencies of Key SNP Loci

[0092] The base sequence containing this mutation site is shown in SEQ ID NO.4, where position 101 is represented by [T / A], specifically: CACCTGTTTTGAAGACCTAAAAACTGACCATTTAGAGGTACAAATTCTCATAACTGCGTTTCTTAGTCTTTGCAAGTTAATAGTGTAAAGACACTGATAA[T / A]TTCAACATAACTGACTTTAGGGAAGGTCACTGGATTGCATTAGTGGCATGAACTCTTGTAATAAAACTACGCTAAAGCATATGAACTATTCATGTCATAT.

[0093] The above results indicate that all four SNP sites are significantly associated with body length traits.

[0094] When the base at the 101bp site of the molecular marker in SEQ ID NO.1 is T, it is significantly correlated with the gross length trait of sheep; When the base at the 101bp site of the molecular marker in SEQ ID NO.2 is T, it is significantly correlated with the gross length trait of sheep; When the base at the 101bp site of the molecular marker in SEQ ID NO.3 is G, it is significantly correlated with the gross length trait of sheep; When the base at the 101bp site of the molecular marker SEQ ID NO.4 is A, it is significantly correlated with the gross length trait of sheep.

[0095] Therefore, in breeding practice, by detecting four SNP loci and selecting individuals with the genotype TT at the 101bp site of the molecular marker SEQ ID NO.1, the genotype TT at the 101bp site of the molecular marker SEQ ID NO.2, the genotype GG at the 101bp site of the molecular marker SEQ ID NO.3, and / or the genotype AA at the 101bp site of the molecular marker SEQ ID NO.4 as parents, the average body length of the offspring population can be effectively increased.

[0096] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0097] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0098] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.

Claims

1. The application of a molecular marker related to sheep body length traits, characterized in that, The molecular marker is at least one of the following 1) to 4): 1) The base sequence of the molecular marker is shown in SEQ ID NO.1, and the base at position 101 bp is either T or C; 2) The base sequence of the molecular marker is shown in SEQ ID NO.2, and the base at position 101 bp is either T or C; 3) The base sequence of the molecular marker is shown in SEQ ID NO.3, and the base at position 101bp is G or A; 4) The base sequence of the molecular marker is shown in SEQ ID NO.4, and the base at position 101bp is either T or A; The application refers to any one of the following (1) and (2): (1) Identify the body length of sheep: The body length when the base at position 101bp of SEQ ID NO.1 is T is greater than the body length when it is C; the body length when the base at position 101bp of SEQ ID NO.2 is T is greater than the body length when it is C; the body length when the base at position 101bp of SEQ ID NO.3 is G is greater than the body length when it is A; and / or the body length when the base at position 101bp of SEQ ID NO.4 is A is greater than the body length when it is T. (2) To increase the body length of sheep offspring: individuals with the base T at position 101bp of SEQ ID NO.1, individuals with the base T at position 101bp of SEQ ID NO.2, individuals with the base G at position 101bp of SEQ ID NO.3, and / or individuals with the base A at position 101bp of SEQ ID NO.4 are selected as parents for breeding, in order to increase the body length of sheep offspring; The sheep in question are steppe short-tailed sheep.

2. The application as described in claim 1, characterized in that, The methods for determining the body length of a sheep are as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at the 101 bp site of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and / or SEQ ID NO.4; If the genotype is at least one of A) to D), then the sheep is a large-body long sheep, where large body length refers to a body length of 71.086cm to 71.800cm; A) The genotype at position 101bp of SEQ ID NO.1 is TT; B) The genotype at position 101bp of SEQ ID NO.2 is TT; C) The genotype at position 101bp of SEQ ID NO.3 is GG; D) The genotype at position 101bp of SEQ ID NO.4 is AA.

3. The application as described in claim 1, characterized in that, Methods to increase the body length of sheep offspring include: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at the 101 bp site of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and / or SEQ ID NO.4; By selecting sheep individuals carrying at least one of the genotypes shown in a) to d) as parents for breeding, the body length of sheep offspring can be increased. a) The genotype at position 101bp of SEQ ID NO.1 is TT; b) The genotype at position 101bp of SEQ ID NO.2 is TT; c) The genotype at position 101 of SEQ ID NO.3 is GG; d) The genotype at position 101bp of SEQ ID NO.4 is AA.

4. The application as described in claim 2 or claim 3, characterized in that, The genomic DNA was derived from sheep blood.

5. The application as described in claim 2 or claim 3, characterized in that, The sequencing method is high-throughput sequencing.

6. The application as described in claim 2 or claim 3, characterized in that, The genomic DNA was extracted using the magnetic bead method.