Molecular marker related to alkylresorcinols content in wheat and its application
By using SNP site AX-110456402 and KASP marker technology, the problem of difficult identification of alkyl resorcinol content in wheat grains was solved, achieving efficient breeding and improving the nutritional quality of wheat.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2026-06-01
- Publication Date
- 2026-07-21
AI Technical Summary
Existing technologies are insufficient for efficiently identifying and screening the content of alkyl resorcinol in wheat grains, which affects the improvement of wheat nutritional quality.
Using the SNP site AX-110456402 as a molecular marker, and combined with KASP labeling technology, specific fluorescent marker primers F1, F2 and R were designed. The content of alkyl resorcinol in wheat grains was identified by PCR amplification and fluorescence detection, and molecular marker-assisted breeding was carried out.
This method enables efficient and accurate identification of alkyl resorcinol content in wheat grains, improving the precision and efficiency of breeding selection and enabling the cultivation of wheat varieties with high alkyl resorcinol content.
Smart Images
Figure FT_1 
Figure SMS_1 
Figure SMS_2
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant breeding and relates to molecular markers related to the content of alkyl resorcinol in wheat and their applications. Background Technology
[0002] The nutritional and health benefits of whole grain diets have gradually gained widespread recognition. Compared to refined grains, whole grains retain the endosperm, germ, bran, and other natural nutrients of the whole grain, thus directly improving grain utilization. Increasing whole grain intake can reduce the risk of a range of chronic diseases, including type II diabetes and obesity. Wheat is one of my country's most important grain crops and a vital source of energy. With economic and social development and in-depth research on whole grains, the dietary fiber, vitamins, flavonoids, and phenolic compounds in whole wheat flour, among other health-beneficial components, have gained attention, making it an important research direction in wheat nutritional quality breeding. Among these, alkyl resorcinols, a special type of phenolic lipid, have attracted considerable attention because wheat crops are almost the only source of these substances in our daily diet. Its content is an important standard for determining the quality of whole wheat flour (LS / T 3244-2015 Whole Wheat Flour). It has also been found to possess antioxidant, anti-inflammatory, anticancer, and antibacterial physiological activities. Therefore, research on alkyl resorcinols in wheat grains is of great significance for improving the nutritional quality of wheat and enhancing dietary health. The content of alkyl resorcinols varies widely among different species and wheat varieties. Therefore, identifying wheat varieties with high ARs content and superior alleles that help increase grain ARs content is of great significance for the genetic improvement of wheat nutritional quality.
[0003] In recent years, with the rapid development of molecular biology and genomics technologies, wheat quality breeding has shifted from traditional phenotypic selection to precision breeding at the molecular level. Genetic analysis techniques, such as QTL mapping and GWAS, have become the main means of identifying genes and QTLs associated with superior traits. Furthermore, KASP (Kompetitive Allele-Specific PCR) markers, as an efficient, low-cost, and high-throughput molecular marker technology, have been widely used in wheat quality breeding. KASP markers can rapidly and accurately identify allelic variations of target genes, significantly improving the efficiency and precision of breeding selection. Through KASP marker-assisted selection, researchers have successfully bred several high-quality wheat varieties, which exhibit significant advantages in yield, stress resistance, and processing quality. The application of KASP markers has not only accelerated the process of wheat quality breeding but also provided strong technical support for wheat genetic improvement. Summary of the Invention
[0004] The problem to be solved by this invention is how to identify or assist in the identification of alkyl resorcinol content in wheat and to carry out wheat breeding.
[0005] To address the aforementioned technical problems, the first aspect of this invention provides a method for detecting SNP sites in the wheat genome. AX- 110456402 The application of genotype-specific substances in any of the following: A1) Identification or auxiliary identification of alkyl resorcinol content in wheat grains; A2) Screening or assisted screening of wheat with high levels of alkyl resorcinol in the grains; A3) Selecting wheat varieties with high alkyl resorcinol content in their grains; A4) Wheat genetics and breeding; The SNP site AX-110456402 It is a site on wheat chromosome 6B, and its nucleotide type is G or C. It is the 81st nucleotide of SEQ ID No:4.
[0006] The genome sequence IWGSC_RefSeq_v1.0 of the common wheat variety Chinese Spring was used as the reference genome, and the SNP site was located at 590802468 bp on wheat chromosome 6B.
[0007] In this article, the detection of SNP sites in the wheat genome is described. AX-110456402 The genotype material can be reagents and / or instruments required to determine the polymorphism or genotype of the SNP site using at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP microarrays. SNP microarrays include microarrays based on nucleic acid hybridization reactions, microarrays based on single-base extension reactions, microarrays based on allele-specific primer extension reactions, microarrays based on one-step reactions, microarrays based on primer ligation reactions, microarrays based on restriction endonuclease reactions, microarrays based on protein-DNA binding reactions, and microarrays based on fluorescent molecule-DNA binding reactions.
[0008] In the above applications, the substance may be D1), D2), or D3). D1) The substance is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).
[0009] Furthermore, the primer composition may consist of primer F1, primer F2, and primer R; In the above applications, primers F1 and F2 may or may not be tagged with a marker.
[0010] The label refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The label can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The label can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the label is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading).
[0011] In one specific embodiment, primer F1 is a DNA molecule whose nucleotide sequence is SEQ ID No:1 or DNA whose nucleotide sequence is positions 22-43 of SEQ ID No:2; The primer F2 is a DNA molecule whose nucleotide sequence is SEQ ID No:2 or a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:3, positions 22-43. The primer R nucleotide sequence is a single-stranded DNA molecule of SEQ ID No:3.
[0012] The primer composition described above also falls within the scope of protection claimed in this invention.
[0013] This invention also provides a method for identifying or assisting in the identification of alkylresorcinol content in wheat grains, comprising the following steps: detecting the SNP sites described above in the wheat genome. AX-110456402 Genotype, used to identify or assist in the identification of alkyl resorcinol content in wheat grains; SNP sites AX-110456402 It is a site on wheat chromosome 6B, and its nucleotide type is G or C. It is the 81st nucleotide of SEQ ID No:4.
[0014] The genotype of the SNP locus is GG, TC, or CC, where GG is homozygous for the SNP locus G, CC is homozygous for the SNP locus C, and GC is heterozygous for both the SNP locus G and C. The alkyl resorcinol content in the grains of the wheat sample with the genotype GG at the SNP locus is lower than that of the wheat sample with the genotype CC at the SNP locus.
[0015] In one specific embodiment, the method for identifying or assisting in the identification of alkyl resorcinol content in wheat grains may include the following steps: (1) Using the genomic DNA of the wheat to be tested as a template, KASP marker detection was performed using a primer composition; the primer composition consisted of primer F1, primer F2 and primer R; (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP in the wheat to be tested; (3) Identify the alkyl resorcinol content in the grains of the wheat to be tested based on the genotype results: The alkyl resorcinol content in the grains of the wheat to be tested with the SNP genotype CC is higher than that of the wheat to be tested with the SNP genotype GG.
[0016] This invention also provides the application of the method described above in breeding related to the alkylresorcinol content in wheat grains.
[0017] The present invention also provides a method for wheat breeding, the method comprising detecting the genotype of the SNP locus mentioned above in the wheat genome, selecting wheat with the genotype CC at the SNP locus as a parent for breeding, wherein CC is a homozygous type of the SNP locus C.
[0018] In this article, the breeding objectives may include developing wheat varieties with high alkyl resorcinol content in the grains.
[0019] In this article, the wheat described can be a pure line or a self-pollinated line.
[0020] The wheat can be selected from the 197 wheat materials in Table 2.
[0021] This invention identifies a wheat alkyl resorcinol content site and its linked molecular marker, which is named... QARC.caas-6B2 It is located on chromosome 6B at approximately 579.3–602.3 Mb; its closely linked SNP marker is... AX- 110456402， In a BLUE environment, 15% of phenotypic variation can be explained. KASP primers were developed based on corresponding markers for marker-assisted screening of alkylresorcinol content. This invention is of great significance for breeding wheat varieties with increased alkylresorcinol content. Attached Figure Description
[0022] Figure 1 for KASP mark K_AX-110456402 Genotyping results for 197 wheat varieties. Blue represents the GG genotype (FAM primers), corresponding to low alkyl resorcinol content, while red represents the CC genotype (HEX primers), corresponding to high alkyl resorcinol content. Detailed Implementation
[0023] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0024] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0025] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0026] The RIL population (273 families) of Linmai 2 / Zhong 892 in the following examples has been described in: Liu, J., He, Z., Wu, L. et al., 2016. Genome-wide linkage mapping of QTL for black pointreaction in bread wheat (Triticum aestivum L.). Theor Appl Genet 129, 2179–2190. https: / / doi.org / 10.1007 / s00122-016-2766-3. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.
[0027] The 161 wheat varieties in the following examples are described in: Cong Zhao, Jingyang Tong, Zhiyuan Gao, Jindong Liu, Yuanfeng Hao, Xianchun Xia, Zhonghu He, Yan Zhang, Wenfei Tian, 2023, Genome-wide association study of alkylresorcinols content in 161 wheat cultivars, Journal of Cereal Science, Volume 111, 103679. https: / / doi.org / 10.1016 / j.jcs.2023.103679. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.
[0028] The 197 wheat varieties from the Huang-Huai region described in the following examples are documented in: Lei Zhi, Xue Gong, Hongyu Zhang, Jindong Liu, Shuanghe Cao, Yong Zhang, Jun Yan, Wenfei Tian, and Zhonghu He., 2024, Journal of Agricultural and Food Chemistry, 72 (31), https: / / doi.org / 10.1021 / acs.jafc.4c04674. This biological material is available to the public from the applicant and is intended solely for the purpose of replicating experiments of this invention; it may not be used for any other purpose.
[0029] The following examples used statistical software to process the data. The experimental results are expressed as mean ± standard deviation, and a one-way ANOVA test was used. P <0.05 (*) indicates a significant difference. P <0.01 (**) indicates a highly significant difference. P <0.001 (***) indicates a highly significant difference.
[0030] Example 1: Discovery of SNP site AX-110456402 related to alkylresorcinol content and design of KASP-labeled primers I. SNP sites related to alkyl resorcinol content AX-110456402 The discovery A natural population of 161 wheat accessions was used, planted in five environments: Xinxiang, Henan (37°27'N, 116°18'E), Gaoyi, Hebei (37°37'N, 114°34'E), and Gaocheng, Hebei (37°27'N, 113°37'E) in 2020–2021 and in Xinxiang, Henan and Gaoyi, Hebei in 2022.
[0031] The content of alkyl resorcinols (ARs) in the material under various environmental conditions was determined by high performance liquid chromatography (HPLC). The specific method is as follows: After harvesting wheat materials in the field, wheat grains (2g) were ground using a SPEX 2010 GenoGrinder high-throughput mill to obtain whole wheat flour. Arsenic sulfoxides (ARs) in 1g of whole wheat flour were extracted with 30mL of ethyl acetate at 25°C with shaking for 12h. The extract was centrifuged at 3500rpm for 3min, and the supernatant was collected. The extract was dried by rotary evaporation, redissolved in 3mL of HPLC-grade methanol, and filtered through a 0.22μm filter into a chromatographic sample vial to obtain the sample extract. The sample extract was analyzed using a Waters Corporation UPLC-PDA system (Waters Corporation, Milford, MA, USA). Mobile phase A consisted of chromatographic-grade ultrapure water containing 0.1% formic acid (FA), and mobile phase B consisted of chromatographic-grade ultrapure water containing 0.1% FA and methanol. The chromatographic column was an ACQUITYUPLC BEH C18 column (1.7μm, 2.1 mm × 100 mm). The flow rate of the mobile phase was maintained at 0.4mL / min, with mobile phase A accounting for 2% and mobile phase B for 98%. The sample injection volume was 0.8 μL, and the column temperature was maintained at 50 °C. Alkylresorcinols (ARs) were determined by comparing their retention times with analytical standards, and quantification was performed using an external calibration curve of absorbance at 276 nm. Qualitative analysis of alkylresorcinols (ARs) was performed by comparing their retention times with those of the standards. The standards used included 5-n-heptadecylresorcinol (C17:0, CAS: 41442-57-3), 5-n-nonadecylresorcinol (C19:0, CAS: 35176-46-6), 5-n-heneicosylresorcinol (C21:0, CAS: 70110-59-7) and 5-n-tricosylresorcinol (C23:0, CAS: 70110-60-0), all purchased from Sigma-Aldrich (Merck, Darmstadt, Germany), with corresponding catalog numbers 97001 (C17:0), 57981 (C19:0), 50851 (C21:0) and 03422 (C23:0), respectively.
[0032] Association analysis was performed in TASSEL v5.2.81. GWAS analysis used a general linear model (GLM) with PCA matrix (K = 3) correction. GWAS analysis results showed a significant SNP locus associated with thousand-grain ARs content within the 579.3–602.3 Mb (23 Mb) interval on wheat chromosome 6B, named [SNP name missing]. AX-110456402 The association between this locus and the content of ARs per thousand grains was statistically significant, indicating that it may play a role in the genetic control of this trait.
[0033] SNP site AX-110456402 Located at 590802468 bp in the wheat reference genome (chromosome 6B) Chinese Spring RefSeqv1.0 (reference genome URL: https: / / urgi.versailles.inra.fr / blast_iwgsc / ). [This is related to...] QARC.caas-6B2 Closely linked markers AX-110456402 (The positive chain) SNP variants and their surrounding nucleotides are shown in SEQ ID No: 4 (S represents C or G). SEQ ID No.4: 5'- CTAAGACAATACAACAATTCATCAGGGGATTTGATAGATCACTGTTGTTACTATTTGCATGAGGGAATATGAGACGGTCTSCTATATGGTCGCAAGTAGTACTACTAGTCATCAGGAGCCACACTGCCGTTCGGATCCGCACACGCACAGCCAAAGGCAAA-3'.
[0034] AX-110456402 Wheat varieties with the CC genotype at the locus have an alkyl resorcinol content greater than AX- 110456402 The content of alkyl resorcinol in wheat varieties with the genotype GG at the locus is shown in Table 1.
[0035] Table 1 AX-110456402 Statistical results of locus genotype and alkyl resorcinol content traits
[0036] II. Used for detecting SNP sites AX-110456402 Design of KASP primers Based on SNP sites AX-110456402 Design the KASP marker primer sequence as follows: Primer F1: 5'- GAAGGTGACCAAGTTCATGCT tgagggaatatgagacggtctg-3' (SEQ ID No:1, the underlined part is the specific fluorescent tag sequence FAM); Primer F2: 5'- GAAGGTCGGAGTCAACGGATT tgagggaatatgagacggtctc-3' (SEQ ID No:2, the underlined part is the specific fluorescent tag sequence HEX); Primer R: 5'-cagtgtggctcctgatgact-3' (SEQ ID No:3).
[0037] The amplification products show the color of the FAM fluorescent tag (blue), corresponding to the SNP site in wheat. AX-110456402 The genotype is GG; The amplification products show the color of the HEX fluorescent tag (red), corresponding to the SNP site in wheat. AX-110456402 The genotype is CC.
[0038] III. Used for detecting SNP sites AX-110456402 Genotyping method 1. Extract genomic DNA from wheat leaves to be tested; 2. Using the extracted DNA as a template, PCR amplification was performed using the KASP primers shown in SEQ ID No: 1-3; (1) Preparation of KASP primer working solution First, dilute the three KASP primers shown in SEQ ID No: 1-3 to 100 μM with ddH2O. Then, prepare the primer working solution as follows: 12 μL of primer A, 12 μL of primer B, 30 μL of primer C, and 46 μL of ddH2O. Store at -20 ℃ for later use.
[0039] (2) KASP reaction system and procedure The KASP reaction system can be as follows: 2.0 μl KASP 2× Master Mix (LGC, catalog number: 13448166), 0.048 μl KASP primer working solution, 1.952 μl template DNA (50 ng / μl), and then add sterile ultrapure water to make up the reaction system to 5.0 μL.
[0040] KASP reaction can be performed on a regular PCR amplification instrument. The reaction program can be as follows: 94℃ for 15 min; 94℃ for 20 s, 63-55℃ for 1 min (decreasing by 1℃ per cycle), 10 cycles; 94℃ for 20 s, 55℃ for 60 s, 32 cycles; extension at 72℃ for 3 min, storage at 4℃.
[0041] 3. Use an automated focusing fluorescence multi-functional microplate reader (PHERAstar Plus, BMG Labtech GmbH, Germany) to scan and read the fluorescence values using the FAM and HEX beams. (For FAM fluorescent tag sequences, the values are observed at an excitation wavelength of 485 nm and an emission wavelength of 520 nm, and the signal is displayed in blue during interpretation. For HEX fluorescent tag sequences, the values are observed at an excitation wavelength of 528 nm and an emission wavelength of 560 nm, and the signal is displayed in red during interpretation.) Determine the genotype of the wheat SNP locus to be tested based on the fluorescence signal color.
[0042] If the fluorescence signal of the amplification product is FAM fluorescence (blue), then the wheat SNP site to be tested... AX-110456402 The genotype is GG; if the fluorescence signal of the amplified product is a HEX fluorescence signal (red), then the wheat SNP site to be tested... AX- 110456402 The genotype is CC.
[0043] SNP site AX-110456402 Wheat with genotype CC has a higher content of alkyl resorcinol than at SNP sites. AX- 110456402 The content of alkyl resorcinol in wheat with genotype GG.
[0044] Genotype CC is a genotype with excellent alkyl resorcinol content, indicating that this marker can play an auxiliary selection role in wheat alkyl resorcinol content, providing a molecular-assisted selection method for breeding varieties with high alkyl resorcinol content.
[0045] Example 2: Application of SNP site AX-110456402 related to alkylresorcinol content The experimental materials consisted of 197 wheat varieties from the Huang-Huai region, as detailed in Table 2.
[0046] 1. Detection of Alkyl Resorcinol Content in Wheat The plants were planted in Zibo, Shandong and Shijiazhuang, Hebei in 2022-2023, and in Zibo, Shandong in 2023-2024. The content of alkyl resorcinols (ARs) in the materials under each environment was determined by high performance liquid chromatography (HPLC), and the BLUE values for the three environments were calculated. The results are shown in Table 2.
[0047] 2. SNP sites AX-110456402 Genotyping Genomic DNA was extracted from 197 family pedigree young leaves using a modified CTAB method as templates and amplified according to the method in Example 1, Section 3 to obtain the genotypes of each sample.
[0048] See results Figure 1As shown in Tables 2 and 3: Of the 197 wheat varieties, 115 varieties exhibited the superior genotype CC (red), with an average alkylresorcinol content of 669.7 μg / g; 82 varieties exhibited the GG genotype (blue), with an average alkylresorcinol content of 643.2 μg / g; statistical tests showed... AX-110456402 The gene effects reached a significant difference ( P <0.05).
[0049] In conclusion, when breeding wheat varieties with high alkyl resorcinol content, SNP sites can be selected. AX- 110456402 Wheat with the CC genotype is used as a parent in breeding to accelerate the selection of high-quality varieties.
[0050] Table 2. Genotypes and Alkyl Resorcinol Content Detection Results of 173 Wheat Varieties
[0051] Table 3. Statistical results of genotype and alkyl resorcinol content detection in 197 wheat varieties.
[0052] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. Detection of SNP sites in the wheat genome AX-110456402 The use of genotyped substances in any of the following or in the preparation of products having any of the following characteristics: A1) Identification or auxiliary identification of alkyl resorcinol content in wheat grains; A2) Screening or assisted screening of wheat with high levels of alkyl resorcinol in the grains; A3) Selecting wheat varieties with high alkyl resorcinol content in their grains; A4) Wheat genetics and breeding; The SNP site AX-110456402 It is a site on wheat chromosome 6B, and its nucleotide type is G or C. It is the 81st nucleotide of SEQ ID No:
4.
2. The application according to claim 1, characterized in that: The substance is either D1), D2), or D3). D1) The substance is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).
3. The application according to claim 2, characterized in that: The primer composition consists of primer F1, primer F2 and primer R; The primer F1 is a DNA molecule whose nucleotide sequence is SEQ ID No:1 or a DNA molecule whose nucleotide sequence is positions 22-43 of SEQ ID No:2; The primer F2 is a DNA molecule whose nucleotide sequence is SEQ ID No:2 or a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No:3, positions 22-43. The primer R nucleotide sequence is a single-stranded DNA molecule of SEQ ID No:
3.
4. The substance according to claim 2 or 3.
5. A method for identifying or assisting in the identification of alkylresorcinol content in wheat grains, comprising the following steps: detecting the SNP sites described in claim 1 in the wheat genome. AX-110456402 Genotype, used to identify or assist in the identification of alkyl resorcinol content in wheat grains; SNP sites AX-110456402 It is a site on wheat chromosome 6B, and its nucleotide type is G or C. It is the 81st nucleotide of SEQ ID No:
4.
6. The method according to claim 5, characterized in that: The genotype of the SNP locus is GG, TC, or CC, where GG is homozygous for the SNP locus G, CC is homozygous for the SNP locus C, and GC is heterozygous for both the SNP locus G and C. The alkyl resorcinol content in the grains of the wheat sample with the genotype GG at the SNP locus is lower than that of the wheat sample with the genotype CC at the SNP locus.
7. The application of the method of claim 5 or 6 in breeding related to the alkylresorcinol content in wheat grains.
8. A method for wheat breeding, characterized by: The method includes detecting the genotype of the SNP locus in claim 1 in the wheat genome, selecting wheat with the genotype CC at the SNP locus as a parent for breeding, wherein CC is the homozygous type of the SNP locus C.