KASP molecular marker primer sets, kits and uses associated with cotton nuclear male sterility

Abstract

The application discloses a KASP molecular marker primer group, a kit and a use associated with cotton nuclear male fertility, and belongs to the technical field of molecular biology. Based on the precise positioning of a genetic mapping population constructed by a GA18 derived line of a dong A nuclear sterile system, a key SNP site is obtained which is closely linked to the sterile trait. Based on the site, a corresponding KASP molecular marker primer group is designed and developed. The genotyping method established by using the primer group can accurately distinguish three genotypes of MsMs, Msms and msms at one time, and solves the technical bottleneck of the limitation of traditional phenotypic identification at the flowering stage and the inability to distinguish between homozygous and heterozygous fertile plants. The method has the advantages of high throughput, low cost, short cycle, simple operation, accurate and stable results and the like, and provides a core tool for genotyping, molecular marker assisted selection and efficient breeding improvement of the cotton dong A nuclear sterile line and the derived line thereof.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a set of KASP molecular marker primers, a kit, and their uses that are associated with male fertility in cotton nuclei. Background Technology

[0002] Cotton is an important economic crop with significant hybrid vigor. Studies have shown that hybrid cotton has a clear advantage over its parents in key agronomic traits such as yield, quality, and resistance. Currently, hybrid cotton production mainly relies on four methods: artificial emasculation, chemical emasculation, the two-line method based on nuclear male sterility, and the three-line method based on cytoplasmic male sterility. Among these, the crossbreeding technology utilizing male sterility (two-line / three-line method) is widely used because it eliminates the need for artificial emasculation, saves costs, and has high seed production efficiency.

[0003] Dong A is a widely used male-sterile cotton line in my country. The GA18 line, a derivative of Dong A male-sterile cotton, possesses an excellent genetic background and is a key germplasm resource for the genetic improvement of many cotton varieties. However, in breeding practice, the aforementioned inefficiency of manual identification and removal of fertile plants is still encountered. If precise, large-scale identification of sterile and fertile plants can be achieved at the seedling stage, and homozygous fertile plants (MsMs) can be eliminated, the breeding results will be stable and controllable, greatly shortening the breeding cycle and significantly reducing labor costs. This is of vital importance for promoting the precision and efficiency of cotton male-sterile two-line breeding. Summary of the Invention

[0004] To address the aforementioned shortcomings of existing technologies, the present invention aims to provide a KASP molecular marker primer set, kit, and application associated with male fertility in cotton. This kit enables large-scale screening of breeding populations (such as F2, BC1F1, and other segregating populations) during the seedling stage, rapidly and accurately identifying sterile plants with the genotype msms and fertile heterozygous plants (maintainers) with the genotype Msms, while eliminating fertile homozygous plants with the genotype MsMs. This accelerates the conversion, purification, and hybridization of sterile lines.

[0005] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: The purpose of this invention is to provide a KASP molecular marker associated with male fertility in cotton. This molecular marker is located in the 65-85 Mb region of cotton chromosome A02 (http: / / cotton.zju.edu.cn / browse.html), corresponding to locus 74959405 on cotton chromosome A02, and the SNP polymorphism of this locus is T / C.

[0006] Furthermore, when the SNP locus genotype is T / T, it is a homozygous fertile material (MsMs); when the SNP locus genotype is T / C (Msms), it is a heterozygous fertile material; and when the SNP locus genotype is C / C, it is a homozygous sterile material (msms).

[0007] Furthermore, the molecular marker is located at the 25th base of the nucleic acid sequence shown in SEQ ID NO.4, and has a polymorphism of T / C.

[0008] Another object of the present invention is to provide a KASP molecular marker primer set for identifying male fertility in cotton, comprising primer sequences as shown in SEQ ID NO. 1-3, and nucleic acid sequences of its PCR products as shown in SEQ ID NO. 4.

[0009] Another object of the present invention is to provide a kit comprising the above-described KASP molecular marker primer set for identifying male fertility in cotton.

[0010] Another object of the present invention is to provide the use of the above-described KASP molecular marker primer set or kit for identifying male fertility in cotton in the preparation of products for identifying male fertility in cotton.

[0011] Another object of the present invention is to provide a method for identifying the male fertility of cotton, characterized by comprising the following steps: (1) Extract genomic DNA from the cotton sample to be tested; (2) Amplify using the KASP molecular marker primer set or kit described above for identifying male fertility of cotton nuclei, obtain the genotype of the SNP site, and then determine the male fertility of cotton nuclei based on the genotype.

[0012] Furthermore, when the SNP locus genotype is T / T, it is a homozygous fertile material; when the SNP locus genotype is T / C, it is a heterozygous fertile material; and when the SNP locus genotype is C / C, it is a homozygous sterile material.

[0013] Furthermore, the PCR amplification system included: 1 μL DNA, 0.05 μL F-primer-T, 0.05 μL F-primer-c, 0.15 μL R-primer, 2.5 μL 2×KASP master mix, and 1.25 μL double-distilled water. Furthermore, the PCR amplification program includes: pre-denaturation: 95℃ for 10 mins; landing PCR: 95℃ for 15 s, 62℃ for 1 min, 10 cycles, with a decrease of 0.5℃ per cycle; template amplification: 95℃ for 15 s, 57℃ for 1 min, 35 cycles; fluorescence acquisition: 37℃ for 10 s.

[0014] Another object of the present invention is to provide the use of the above-mentioned KASP molecular marker in cotton-assisted breeding or variety improvement.

[0015] Another object of the present invention is to provide an improved method for KASP molecular marker-assisted high-quality nuclear male-sterile dual-use lines, comprising the following steps: (1) Provide initial parental material containing the bloodline of the hole A nuclear sterile line (such as GA18); (2) Using the genotyping method described in the fourth aspect of the present invention, the parental materials in step (1) are tested to screen out sterile plants with the genotype msms (Allele X type, corresponding to the SNP locus genotype C / C); (3) Using the sterile plants selected in step (2) as the female parent, cross them with the male parent varieties that have excellent target agronomic traits (such as high yield, high quality, disease resistance, etc.) to obtain F1 generation seeds; (4) Plant F1 generation plants and allow them to self-pollinate to obtain F2 generation segregating population; (5) During the seedling stage of the F2 generation population, the genotyping method described in the fourth aspect of the present invention was used to test all individual plants; (6) Based on the typing results, select fertile heterozygous plants with genotype Msms (Both Alleles type, corresponding to SNP locus genotype T / C) and sterile plants with genotype msms (Allele X type, corresponding to SNP locus genotype C / C); (7) The Msms type single plants selected in step (6) are paired with msms type single plants for test cross or sister cross. The sterile plants and fertile heterozygous plants in their offspring population will be separated in a 1:1 ratio, thereby quickly obtaining a new nuclear sterile line population with improved genetic background that can be directly used for hybrid seed production.

[0016] By implementing the various technical solutions of the present invention, early and accurate identification of the fertility genotype of cotton nuclear male sterile lines can be achieved, and the efficiency and accuracy of cotton hybridization breeding can be significantly improved.

[0017] The present invention has the following beneficial effects: 1. Precise genotyping: The competitive allele-specific PCR (KASP) marker obtained in this invention is a co-dominant marker. This technology is based on fluorescence signal detection and does not require gel electrophoresis. It has the advantages of rapid, high-throughput and automated genotyping. It can accurately distinguish between three genotypes, MsMs, Msms and msms, in one go. It breaks through the technical bottleneck of traditional dominant markers being unable to distinguish between homozygous and heterozygous fertile plants, and provides a key molecular tool for the efficient use of nuclear male sterility two-line method.

[0018] 2. Early and efficient identification: Enables accurate identification of seedling genotypes without waiting for phenotypic observation at the flowering stage, significantly shortening the identification cycle, reducing the scale of field planting and labor input, reducing the interference of environmental factors on fertility judgment, and significantly improving selection accuracy and breeding efficiency.

[0019] 3. Optimize the breeding process: Support the optimal “msms×Msms” 1:1 segregation seed production mode, replace the inefficient “msms×MsMs” and “msms×Msms” fully fertile hybrid mixing mode, so that the offspring fertility is stable and advanced, and the breeding generation process is significantly accelerated.

[0020] 4. Simple and stable operation: KASP marker detection is simple to operate, highly stable, reproducible, and low in cost. It does not require a high-throughput sequencing platform, making it suitable for grassroots breeding units and more versatile and practical.

[0021] 5. Promote molecular breeding: Based on BSA and genetic mapping, functional markers are obtained through precise localization of populations. These markers are closely linked to sterility genes, resulting in high selection efficiency and low false positives. They can be efficiently used for backcrossing and conversion of sterility genes and the creation of new materials, thus promoting the molecular, standardized, and engineered breeding of cotton nuclear male sterile lines. Attached Figure Description

[0022] Figure 1 A gene localization map of the male-sterile line in cotton cell nuclei; Figure 2 The image shows the KASP molecular marker results for the F2 (GA18s×RM288) population; Figure 3 The image shows the KASP molecular marker results for the F2 (GA18s×RJLC7-8) population; Figure 4 A flowchart comparing the process of conventional breeding and the KASP molecular marker-assisted breeding constructed in this invention. Detailed Implementation

[0023] The examples given below are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, conditions in the examples are performed under standard conditions or as recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0024] The male-sterile line GA18 used in this invention has been disclosed in the article "Study on the heterosis utilization of the cotton insect-resistant male-sterile line GA18 (Mou Fangsheng et al.)", RM288 has been disclosed in the article "Breeding of the new insect-resistant hybrid cotton variety Chuanzamian 76 (Ji Peicheng, Zhong Wenjuan, Zhou Yonghang et al.)", and the superior upland cotton RJLC7-8 has been disclosed in the article "Breeding and cultivation techniques of the insect-resistant male-sterile hybrid cotton Chuanzamian 62 (Liao Rui, Chen Siwei, Zhong Wenjuan, Ji Peicheng, & Mou Fangsheng. (2025))".

[0025] Example 1: Gene localization of male-sterile lines in cotton cells (1) Experimental materials GA18s (sterile lines in the GA18 sterile line), RM288, and the F2 population of GA18s×RM288.

[0026] (2) Experimental methods Using BSA (Bulked Segregant Analysis), leaves from 30 sterile plants and 30 fertile plants were collected from the F2 population of GA18s×RM288 to form two pools. DNA was extracted from the two parents and the two pools, and whole-genome resequencing was performed. The data were aligned to the reference cotton genome TM-1 (T2T genome of TM-1, http: / / cotton.zju.edu.cn / download.html) using hista2. SNP and indel detection were performed using GATK4, and Euclidean Distance Values ​​(ED values) at various genomic positions in the two pools were calculated using QTLseqr to identify candidate regions.

[0027] (3) Experimental results Depend on Figure 1 A significant and continuous association peak was observed in the 65-85Mb region of chromosome A02, with an ED value significantly higher than the background level, making it a candidate region for the sterility trait. The locus located at chrA02:74959405 showed high co-segregation with the sterility phenotype (ED value = 0.58). This locus is C / C in homozygous sterile materials, T / T in homozygous fertile materials, and T / C in heterozygous fertile materials, making it a key SNP locus closely linked to the sterility trait.

[0028] Example 2: Genetic locus analysis and KASP molecular marker design of the cotton nuclear male sterile line GA18 (1) Experimental materials Same as Example 1.

[0029] (2) Experimental methods KASP molecular marker design: A universal reverse primer R-primer was designed upstream of the SNP site; for the SNP site itself (T / C), two competitive allele-specific forward primers were designed immediately adjacent to its 5' end: F-primer-T (corresponding to the T allele) and F-primer-c (corresponding to the C allele). HEX and FAM fluorescent recognition sequences were added to the 5' ends of the F-primer-T and F-primer-c primers, respectively, to obtain two competitive binding primers (see Table 1). The PCR product sequence is shown in SEQ ID NO.4, located on chromosome A02 at positions 74959381~74959503, with the SNP site located at the 25th base of the nucleic acid sequence shown in SEQ ID NO.4.

[0030] Table 1 KASP primer sequences

[0031] ATGATTGATGTCACTTGGTTAATTTATAGCATGGTTTAAAGTAAGGAAATGTTTTGAATGATCCTAGTAAGTTATGGTGTCCCAAATATGTATACTAGCAAACATTCCCCTTGAGCCGCTAT (SEQ ID NO. 4).

[0032] Example 3: KASP Molecular Marker Validation Experiment (1) Experimental materials Same as Example 1.

[0033] (2) Experimental methods ①PCR amplification DNA was extracted from 324 individual plants using the CTAB method and used as template DNA. The DNA was then sequentially added to a 384-well real-time PCR plate. Three individual plants were randomly selected as replicate controls, and three wells were filled with double-distilled water as negative controls.

[0034] PCR amplification system: 1 μL DNA, 0.05 μL F-primer-T, 0.05 μL F-primer-c, 0.15 μL R-primer, 2.5 μL 2×KASP master mix, 1.25 μL double-distilled water. After mixing the amplification solution, add 5 μL of PCR mixture to each well, centrifuge, and seal the 384-well plate with a sealing film for real-time PCR.

[0035] PCR Program Setup and Data Analysis: Using Roche LightCycler ®PCR reactions were performed using a LightCycler 480 real-time quantitative PCR instrument. The program was as follows: pre-denaturation: 95℃ for 10 min; landing PCR: 95℃ for 15 s, 62℃ for 1 min, 10 cycles, with a 0.5℃ decrease per cycle; template amplification: 95℃ for 15 s, 57℃ for 1 min, 35 cycles; fluorescence acquisition: 37℃ for 10 s. Genotyping was obtained by automatically analyzing the data using the endpoint-based quantitative PCR method in the LightCycler 480 software.

[0036] ②Experimental Results Data shows (see) Figure 2 (As shown in Table 2), among the 324 samples, all samples were clearly divided into three clusters: Green clusters (located near the Y-axis): showing strong HEX signal and weak or no FAM signal, identified as AlleleY type. Corresponding field phenotype is fertile (F), and analysis shows homozygous genotype MsMs (corresponding SNP genotype T / T), totaling 82 plants.

[0037] Blue clusters (located near the X-axis): showing strong FAM signal and weak or no HEX signal, identified as AlleleX type. The corresponding field phenotype is sterile (S), and analysis shows that they are homozygous genotype msms (corresponding to SNP genotype C / C), totaling 69 plants.

[0038] The red cluster (located between the X and Y axes) shows strong FAM and HEX signals and is identified as the BothAlleles type. The corresponding field phenotype is fertile (F), and analysis shows that it is the heterozygous genotype Msms (corresponding to the SNP genotype T / C), totaling 173 plants.

[0039] The gray samples served as negative controls. There were three gray samples, and their signals were basically the same. Therefore, they were overlapping sites on the graph.

[0040] Statistical analysis revealed that the Allele X genotype corresponds to field-sterile plants (S), while fertile plants (F) include Allele Y genotype (homozygous MsMs) and Both Alleles genotype (heterozygous Msms). Genotyping results for the three genotypes showed an Allele Y:Allele X:Both Alleles segregation ratio of 1:0.8:2.1. Chi-square test showed that the segregation results conformed to the theoretical segregation ratio of 1:1:2 for a single gene-controlled qualitative trait (P>0.05), consistent with Mendelian recessive inheritance (see Table 3). Therefore, the KASP molecular marker primers designed in this invention can not only accurately distinguish between fertile and sterile plants, but also differentiate between homozygous MsMs and heterozygous Msms genotypes within fertile plants. They exhibit high efficiency, stability, and specificity, providing a reliable technical tool for subsequent marker-assisted selection.

[0041] Table 2. KASP molecular marker results for the F2 (GA18s×RM288) population.

[0042] Table 3. Results of genetic regularity test of KASP molecular marker segregation ratio in the F2 (GA18s×RM288) population.

[0043] Example 4: Application of KASP molecular marker-assisted improvement of cotton nuclear male sterility lines This embodiment demonstrates how the typing method constructed in this invention can be applied to specific breeding practices to quickly introduce the sterility trait of GA18 into the superior upland cotton variety RJLC7-8 (see...). Figure 4 ).

[0044] RJLC7-8 is a conventional high-quality cotton breeding material, but its yield is low. Crossing it with the cotton nuclear male sterile line GA18s can yield a high-quality, high-yielding sterile line. However, conventional sterile line selection primarily relies on phenotypic identification, which requires waiting until flowering and cannot distinguish between homozygous (MsMs) and heterozygous (Msms) fertile materials. Multiple generations of sister crosses are needed to obtain new, stable sterile lines. Using KASP molecular markers allows direct identification of fertile material genotypes in the F2 segregating population, accelerating breeding progress while preventing the loss of sterility genes during sister crosses.

[0045] (1) Experimental materials GA18s, a standard high-quality upland cotton variety, RJLC7-8.

[0046] (2) Experimental methods ① Group building Using GA18s as the female parent and conventional high-quality upland cotton RJLC7-8 as the male parent, the F1 generation of hybrids was obtained. The F1 generation was self-pollinated to obtain the segregating population F2 generation, which consisted of 152 individual plants.

[0047] ② Genotyping of F2 generation segregating population Leaves were harvested from the F2 generation population during the seedling stage, and DNA was extracted from each individual plant using the CTAB method. Using the F2 generation population DNA as a template, the materials were genotyped using the KASP molecular marker primer set listed in Table 3, following the experimental method described in Example 3.

[0048] ③ Fertility phenotype identification During the peak flowering period, the fertility of the F2 generation population was assessed again to identify fertile and sterile materials, and the results were compared with those from the KASP analysis.

[0049] (3) Experimental results Of the 152 samples, 30 green samples were Allele Y type (MsMs, corresponding to SNP genotype T / T), 37 blue samples were Allele X type (msms, corresponding to SNP genotype C / C), 85 red samples were Both Alleles type (Msms, corresponding to SNP genotype T / C), and gray samples were negative controls (see...). Figure 3 (and Table 4).

[0050] Molecular marker genotyping results showed that the Allele X genotype corresponded to field-sterile plants (S), while fertile plants (F) included Allele Y genotype (homozygous MsMs) and Both Alleles genotype (heterozygous Msms). The segregation ratio of the three genotypes, Allele Y: Allele X: Both Alleles, was 1:1.2:2.8. The chi-square test showed that the segregation results conformed to the theoretical segregation ratio of 1:1:2 for a single gene-controlled qualitative trait (P>0.05), consistent with Mendelian recessive inheritance (see Table 5). This marker can effectively distinguish between homozygous Allele Y, homozygous Allele X, and heterozygous Both Alleles. In the subsequent breeding process, we directly select homozygous Allele X type (sterile) and heterozygous Both Alleles (hybrid fertile) for sister crosses to obtain the F2-sibF1 generation population, which is Allele X type and heterozygous Both Alleles with a segregation ratio of 1:1. This removes the interference of homozygous Allele Y type (MsMs) and quickly obtains the improved sterile line to accelerate the breeding progress.

[0051] Table 4. KASP molecular marker results for the F2 (GA18s×RJLC7-8) population

[0052] Table 5. Results of genetic regularity analysis of KASP molecular marker segregation ratio in the F2 (GA18s × RJLC7-8) population.

[0053] In summary, this invention, using the A-cell nuclear male sterile line GA18 as an example, constructed a segregating population and successfully located a specific SNP locus closely associated with fertility using BSA-seq technology. Based on this key locus, a KASP molecular marker detection system for the A-cell nuclear male sterile line and its derivatives was designed and developed. This molecular marker detection method overcomes the limitations of traditional identification methods that rely on flowering time phenotypes, and possesses significant advantages such as low cost, high throughput, short detection cycle, simple operation, and accurate and stable results. Furthermore, this invention not only provides a core tool for the molecular identification of the A-cell nuclear male sterile line and its derivatives, but also provides a complete technical solution for its efficient molecular marker-assisted breeding and genetic improvement, possessing significant application value.

[0054] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The use of KASP molecular markers in identifying male fertility in cotton, characterized in that, The molecular marker is located in the 65-85 Mb region of cotton A02 chromosome. The molecular marker corresponds to the 74959405th site of cotton A02 chromosome, and the SNP polymorphism of this site is T / C. The nucleotide sequences of the KASP molecular marker primer set designed based on the SNP site are shown in SEQ ID NO. 1-3. When the SNP locus genotype is T / T, it is a homozygous fertile material; When the SNP locus genotype is T / C, it is a heterozygous fertile material; When the SNP locus genotype is C / C, it is a homozygous sterile material.

2. The use of the KASP molecular marker primer set as described in claim 1 in the preparation of products for identifying the male fertility of cotton nuclei.

3. The use according to claim 2, characterized in that, The product in question is a reagent kit.

4. A method for identifying the male fertility of cotton, characterized in that, Includes the following steps: (1) Extract genomic DNA from the cotton sample to be tested; (2) Amplify using the KASP molecular marker primer set described in claim 1 or the kit described in claim 3 to obtain the genotype of the SNP site, and then determine the male fertility of cotton based on the genotype; When the SNP locus genotype is T / T, it is a homozygous fertile material; When the SNP locus genotype is T / C, it is a heterozygous fertile material; When the SNP locus genotype is C / C, it is a homozygous sterile material.

5. The use of the KASP molecular marker as described in claim 1 in cotton-assisted breeding or variety improvement, characterized in that, Assisted breeding or variety improvement targets the male fertility of cotton.

Images