Diagnostic aptamer

Abstract

The present disclosure relates to the field of aptamers. More specifically, the present disclosure relates to aptamers for specific binding to Group B Streptococcus (GBS) bacteria, such as Streptococcus agalactiae (GBS) Streptococcus agalactiae ). In addition, the present disclosure relates to methods of using such aptamers to diagnose, monitor, or treat a disease, disorder, or condition associated with GBS in a patient.

Description

[0001] Cross-reference to related applications This application claims priority to Australian Provisional Patent Application No. 2023904008, filed on December 11, 2023, the contents of which are incorporated herein by reference in their entirety.

[0002] sequence list This application is filed together with the sequence list, which has been submitted electronically in XML format and is incorporated herein by reference in its entirety. The XML copy, created on December 4, 2024, is named “Diagnostic Aptamer” and is 24,272 bytes in size. Technical Field

[0003] This disclosure relates to the field of aptamers. More specifically, this disclosure relates to aptamers for use with Group B Streptococcus (GBS) bacteria such as agalactiae (Streptococcus agalactiae). Streptococcus agalactiae Aptamers that specifically bind to GBS. Additionally, this disclosure relates to methods for using such aptamers to diagnose or monitor GBS-related diseases, symptoms, or conditions in patients. Background Technology

[0004] agalactococcus ( S. agalactiae) It is a group of Group B streptococci (GBS), belonging to the Gram-positive bacterial class. These bacteria can be found in various parts of the body and cause a variety of diseases. Specifically, pregnant women carrying these bacteria during late pregnancy may transmit them to their newborns. Newborns infected with GBS can develop life-threatening complications, including sepsis, pneumonia, and meningitis. Therefore, early detection of GBS can pave the way for appropriate medical intervention to save the lives of newborns. Currently available methods for detecting GBS include enrichment media, polymerase chain reaction (PCR), nucleic acid amplification tests, or chromogenic media-based detection; these methods are either expensive, require technical expertise, or involve long waiting times.

[0005] Therefore, there is a need to develop molecular recognition elements that can bind to GBS with high sensitivity and selectivity. High sensitivity is required for detecting small numbers of bacteria, while high selectivity is required for accurately identifying GBS strains. Summary of the Invention

[0006] This disclosure is based on the design and development of a series of single-stranded DNA (ssDNA) aptamers that bind to pathogenic GBS bacteria with high specificity and sensitivity. The developed aptamers also exhibit high affinity for GBS bacteria. Therefore, the aptamers of this invention can be used to identify or monitor GBS infection in patients, and more specifically in pregnant women and newborns, in point-of-care clinical settings.

[0007] In a first aspect, this disclosure provides an aptamer for binding to Group B Streptococcus (GBS) bacteria, wherein the aptamer comprises a nucleic acid sequence, fragment thereof, variant thereof, or derivative thereof selected from the group consisting of SEQ ID NO: 1 to 10, or substantially composed of such sequence.

[0008] In a related respect, this disclosure provides an aptamer for binding to GBS bacteria, wherein the aptamer comprises a nucleic acid sequence, fragment thereof, variant thereof, or derivative thereof selected from the group consisting of SEQ ID NO: 14 to 29, or substantially thereof.

[0009] Suitable, the aptamer has a dissociation constant (K0.05) of 500 nM or less for GBS bacteria. D ).

[0010] Suitable, the GBS bacteria are agalactococci (Streptococcus agalactiae). Streptococcus agalactiae ).

[0011] Suitablely, the aptamer is a DNA molecule, or contains a DNA molecule.

[0012] In some instances, the aptamer is single-stranded. For example, the aptamer is a single-stranded DNA molecule, or contains a single-stranded DNA molecule.

[0013] In one instance, the aptamer forms a secondary or tertiary structure including a hairpin loop.

[0014] In some instances, the aptamer contains at least one chemical modification.

[0015] Suitablely, the modification is one or more of the following: chemical substitution at the sugar position, chemical substitution at the internucleotide link, chemical substitution at the base position, and chemical addition at the base position.

[0016] In a second aspect, this disclosure provides a sensor for detecting GBS bacteria, the sensor comprising the aptamer described in the first aspect.

[0017] Appropriately, the aptamer is coupled, bonded, attached, or otherwise connected to the substrate.

[0018] Suitablely, the substrate comprises one or more of the following: beads, matrix, crosslinked polymer, gel, particles, surface, plate, paper, membrane, pore or other solid or semi-solid substrate.

[0019] In some instances, the substrate comprises one or more of the following: a sensor chip surface, an ELISA / ELLBA plate, agarose gel (sepharose), agarose, protein A, protein G, magnetic beads, paramagnetic particles, or nanoparticles.

[0020] In a third aspect, this disclosure provides a method for detecting GBS bacteria in a sample, the method comprising the following steps: (a) bringing the sample into contact with the aptamer according to the first aspect or the sensor according to the second aspect; and (b) Detect the presence or absence of the GBS bacteria:aptamer complex, or measure the level of the GBS bacteria:aptamer complex. This is used to detect GBS bacteria in the sample.

[0021] In a fourth aspect, this disclosure provides a method for detecting GBS bacterial infection in a subject, the method comprising the following steps: (a) bringing a biological sample obtained from the subject into contact with an aptamer according to any one of the first aspects or a sensor according to the second aspect; and (b) Detect the presence or absence of the GBS bacteria:aptamer complex, or measure the level of the GBS bacteria:aptamer complex. This is to detect the GBS bacterial infection in the subject.

[0022] In a fifth aspect, this disclosure provides a method for isolating or purifying GBS bacteria from a sample, the method comprising the following steps: (a) bringing the sample into contact with the aptamer according to the first aspect or the sensor according to the second aspect; and (b) Isolate the GBS bacteria:aptamer complex from the sample. GBS bacteria can thus be isolated or purified from the sample.

[0023] In a sixth aspect, this disclosure provides a method for monitoring GBS bacterial infection in subjects, the method comprising the following steps: (a) bringing a biological sample obtained from the subject into contact with an aptamer according to any one of the first aspects or a sensor according to the second aspect; and (b) Detect the presence or absence of GBS bacteria:aptamer complex, or measure the level of said GBS bacteria:aptamer complex; This is to monitor GBS bacterial infection in the subjects.

[0024] Appropriately, the subject is a pregnant woman or a newborn.

[0025] In a seventh aspect, this disclosure provides a method for preventing, improving, or treating GBS bacterial infection in a subject, the method comprising the step of administering a therapeutically effective amount of treatment against the GBS bacterial infection to the subject, wherein the presence of a GBS bacterial:aptamer complex has been determined in one or more biological samples of the subject.

[0026] In an eighth aspect, this disclosure provides a method for generating a sensor for detecting GBS bacteria, the method comprising the following steps: (a) Provide a base; and (b) The aptamer described in the first aspect is coupled, bonded, attached, or otherwise connected to the substrate. The sensor is thus generated.

[0027] With respect to any of the first to eighth aspects, the GBS bacteria are suitably Streptococcus agalactiae, or the GBS bacterial infection is suitably mediated at least in part by or associated with Streptococcus agalactiae.

[0028] Appropriately, the sensor is the sensor described in the second aspect.

[0029] In a ninth aspect, this disclosure provides a sensor generated according to the method described in the eighth aspect.

[0030] In a tenth aspect, this disclosure provides a kit comprising an aptamer as described in the first aspect or a sensor as described in the second aspect, and optionally instructions for use.

[0031] In an eleventh aspect, this disclosure provides a test reagent comprising an aptamer as described in the first aspect, and optionally one or more acceptable excipients, diluents, or carriers.

[0032] Suitablely, the kit according to aspect nine or the test reagent according to aspect ten is applicable to the method according to any one of aspects three to seven. Attached Figure Description

[0033] The following drawings form part of this specification and are included to further illustrate certain aspects of this disclosure. This disclosure can be better understood by referring to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. Those skilled in the art will understand that many variations and / or modifications can be made to the above embodiments without departing from the broad general scope of this disclosure. Therefore, embodiments of the invention are to be considered illustrative rather than restrictive in all respects.

[0034] Figure 1 Components of the ssDNA random library used in the SELEX process. N44 corresponds to the variable region (44 bases) with 5' and 3' fixed regions. The forward and reverse primers used during PCR amplification are also indicated.

[0035] Figure 2 This method is used to develop a SELEX protocol for developing ssDNA-based anti-GBS aptamers. GBS bacteria are incubated with a randomized single-stranded DNA library (80 nucleotides long) at room temperature for 90 minutes. Unbound ssDNA aptamers are removed by centrifugation, and aptamers bound to GBS are eluted in elution buffer. ssDNA aptamers are then enriched by PCR. PCR amplicons are digested using a lambda (λ) exonuclease to prepare single-stranded DNA for the next round of SELEX.

[0036] Figure 3 The image shows agarose gel electrophoresis images of the anti-GBS aptamers obtained through the SELEX discovery process. The ssDNA aptamers (after rounds 5 and 10 of the SELEX process) and the corresponding dsDNA aptamer products were loaded onto 3% agarose gels and electrophoresed with 1x SYBR. TM Gold staining. Run the gel at 90 V using 1x TAE buffer. The lowest band in the 100 bp ladder corresponds to 100 base pairs.

[0037] Figure 4 Secondary structures of ssDNA-based anti-GBS aptamers identified in Table 1, grading numbers 1-10. (A) Grading number 1; K D A truncated aptamer with a value of 0.1 nM, (B) grade number 2; K D A truncated aptamer with a value of 2 nM, (C) grade number 3; K D An aptamer with a value of 3.7 nM, (D) grade number 4; K D An aptamer with a value of 37 nM, (E) class number 5; K D An adaptor with a value of 65 nM. (F) Rank number 6; K D An aptamer with a value of 115 nM, (G) class number 7; K DA truncated aptamer with a value of 125 nM. (H) Class number 8; K D A truncated aptamer with a value of 250 nM. (I) Class number 9; K D A truncated aptamer with a value of 290 nM. (J) Class number 10; K D A truncated aptamer with a value of 455 nM.

[0038] Sequence List Symbol Explanation Detailed Implementation

[0039] General techniques and definitions Unless otherwise specifically defined, all technical and scientific terms used herein should be regarded as having the same meaning as commonly understood by a person of ordinary skill in the art (e.g., in genomics, immunology, molecular biology, immunohistochemistry, biochemistry, microbiology, oncology, and pharmacology).

[0040] Unless otherwise specified, this disclosure is made using conventional techniques of molecular biology, microbiology, recombinant DNA technology, and immunology without excessive experimentation. Such procedures are described in the following literature: for example, Sambrook, Fritsch, and Maniatis, *Molecular Cloning: A Laboratory Manual*, Cold Spring Harbor Laboratories, New York, 4th edition (2012), Volumes I, II, and III; *DNA Cloning: An Apractical Approach*, Volumes I and II (DN Glover, 2nd edition, 1995), IRL Press, Oxford, full text; *Oligonucleotide Synthesis: An Apractical Approach* (edited by MJ Gait, 1984), IRL Press, Oxford, full text; and specifically, Gait, pp. 1-22; Atkinson et al., pp. 35-81; Sproat et al., pp. 83-115; and Wu et al., Pages 135-151; 4. *Nucleic Acid Hybridization: A Practical Approach* (edited by BD Hames and SJ Higgins, 1985), IRL Publishing, Oxford, full text; *Immobilized Cells and Enzymes: A Practical Approach* (1986), IRL Publishing, Oxford, full text; Perbal, B., *A Practical Guide to Molecular Cloning* (1984) and *Methods in Enzymology* (edited by S. Colowick and N. Kaplan, Academic Press, Inc.), complete set.

[0041] Those skilled in the art will understand that this disclosure is open to variations and modifications beyond those specifically described. It should be understood that this disclosure includes all such variations and modifications. This disclosure also includes all steps, features, compositions, and compounds individually or collectively mentioned or indicated in this specification, and any and all combinations of any two or more of said steps or features.

[0042] The scope of this disclosure is not limited to the specific embodiments described herein, which are intended for illustrative purposes only. As described herein, functionally equivalent products, compositions, and methods are clearly within the scope of this disclosure.

[0043] Any particular aspect or implementation method or each feature of this disclosure may be modified as necessary to suit any other aspect or implementation method of this disclosure.

[0044] Throughout this specification, unless otherwise specified or required by context, references to a single step, composition of matter, group of steps, or group of composition of matter shall be deemed to cover one and a plurality of those steps, compositions of matter, groups of steps, or groups of composition of matter.

[0045] As used herein, unless the context clearly indicates otherwise, the singular forms “a / an” and “the” include the plural forms of these words. For example, a reference to “bacteria” includes multiple such bacteria, and a reference to “allergen” is a reference to one or more allergens.

[0046] The term “and / or”, such as “X and / or Y”, should be understood to mean “X and Y” or “X or Y”, and should be regarded as providing explicit support for both meanings or either meaning.

[0047] As used herein, unless otherwise stated, the term approximately means + / - 10% of the specified value, more preferably + / - 5%, or even more preferably + / - 1%.

[0048] Throughout this specification, various aspects and components of this disclosure may be presented in range form. Range form is included for convenience and should not be construed as a rigid limitation on the scope of this disclosure. Therefore, unless specifically indicated, descriptions of ranges should be considered as having specifically disclosed all possible subranges and individual numerical values ​​within said ranges. For example, unless integers or context-implied integers are required, descriptions of ranges such as 1 to 5 should be considered as having specifically disclosed subranges, such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 5, 3 to 5, etc., and individual and partial numbers within said ranges, such as 1, 2, 3, 4, 5, 5.5, and 6. This applies regardless of the width of the disclosed range. When specific values ​​are required, these values ​​will be indicated in the specification.

[0049] Throughout this specification, the word “comprise” or variations such as “comprises” or “comprising” will be understood to imply inclusion of the stated elements, integers or steps, or groups of elements, integers or steps, but does not exclude any other elements, integers or steps, or groups of elements, integers or steps.

[0050] "consisting essentially of" in the following contexts: (a) amino acid sequence, meaning the listed amino acid sequence together with one, two or three amino acids at its N-terminus and / or C-terminus; or (b) nucleic acid sequence, meaning the listed nucleic acid sequence together with one, two or three nucleic acids at its 5' and / or 3'.

[0051] All computer programs, algorithms, patents, and scientific literature mentioned in this article are incorporated herein by reference.

[0052] For the purposes of this disclosure, the database accession number or unique identifier of the gene or protein provided herein, as well as the gene and / or protein sequence or related sequences, are incorporated herein by reference.

[0053] The fact that any discussion of documents, laws, materials, devices, articles of manufacture, etc., included in this specification existed prior to the priority date of each appended claim should not be construed as an admission that any or all of these matters form part of the prior art or are common general knowledge in the field relating to this disclosure.

[0054] Diagnostic aptamers The inventors have surprisingly discovered a low dissociation constant (K). DAn aptamer that can be used to bind specifically to GBS bacterial strains with high selectivity, thereby rapidly and accurately identifying the presence or absence of GBS bacteria in a sample and / or measuring the level of GBS bacteria in the sample.

[0055] In a broad form, this disclosure provides an aptamer for binding to Group B Streptococcus (GBS) bacteria, wherein the aptamer comprises a nucleic acid sequence, fragment thereof, variant thereof, or derivative thereof selected from the group consisting of SEQ ID NO: 1 to 10 and 14 to 29, or substantially thereof.

[0056] Therefore, in one form, this document provides an aptamer for binding to Group B Streptococcus (GBS) bacteria, wherein the aptamer comprises a nucleic acid sequence, fragment thereof, variant thereof, or derivative thereof selected from the group consisting of SEQ ID NO: 1 to 10, or substantially composed of such sequence.

[0057] In a related form, this document provides an aptamer for binding to GBS bacteria, wherein the aptamer comprises a nucleic acid sequence, fragment thereof, variant thereof, or derivative thereof selected from the group consisting of SEQ ID NO: 14 to 29, or substantially thereof.

[0058] In the context of this disclosure, the term "aptamer" or "aptamers" refers to a non-naturally occurring nucleic acid or peptide structure that folds into a three-dimensional structure and exhibits high affinity for a target antigen, such as GBS bacteria. An aptamer can refer to an oligomer or polymer of ribonucleic acid (RNA), deoxyribonucleic acid (DNA), or an RNA-DNA hybrid, wherein the polymer or oligomer of the nucleotide monomer contains any combination of nucleobases (referred to in the art and herein as "bases"), modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus bridges (also referred to herein as "nucleotide interlinkings").

[0059] As used herein, the term "nucleic acid" refers to single-stranded or double-stranded DNA and RNA. DNA includes genomic DNA and cDNA. RNA includes mRNA, RNA, RNAi, siRNA, cRNA, and autocatalytic RNA. Nucleic acids can also be DNA-RNA hybrids. Nucleic acids comprise a nucleotide sequence, which typically includes nucleotides containing A, G, C, T, or U bases. However, the nucleotide sequence may include other bases, such as modified purines (e.g., inosine, methylinosine, and methyladenosine) and modified pyrimidines (e.g., thiouridine and methylcytosine).

[0060] Aptamers can be single-stranded (ss), double-stranded (ds), or a combination thereof. Single-stranded aptamers may have double-stranded regions, and double-stranded aptamers may have single-stranded regions (e.g., microRNA or shRNA). Aptamers used in the sensors and methods of this disclosure are suitably DNA aptamers. As used herein, the term "DNA aptamer" refers to an aptamer comprising DNA or a modified backbone nucleic acid (e.g., PNA) derived from a DNA base sequence. For example, an aptamer may be a single-stranded DNA aptamer. Aptamers may comprise chemically modified nucleic acids, for example, wherein their sugars and / or phosphate esters and / or bases are chemically modified. Such modifications can improve the stability of the aptamer and / or make it more resistant to degradation, and may include modifications at the 2' position of the ribose.

[0061] Compared to antibodies, aptamers offer numerous advantages, such as tolerance to a wide range of pH and salt concentrations, thermal stability, ease of synthesis, and cost-effectiveness. The specificity and affinity of aptamers are comparable to, if not greater than, those of antibodies. Aptamers can also reversibly denature to release target compounds, making them particularly useful receptors in biosensing applications.

[0062] Aptamers for a given target, including those disclosed herein, can be identified and / or generated by an exponentially enriched ligand systemic evolution (SELEX™) approach. Aptamers and SELEX are described in Tuerk and Gold (Science, 1990, 249:505-10) and WO 91 / 19813.

[0063] This disclosure provides an aptamer for binding to GBS bacteria, wherein the aptamer comprises a nucleic acid sequence, fragment thereof, variant thereof, or derivative thereof selected from the group consisting of SEQ ID NO: 1 to 10 and 14 to 29, or substantially thereof.

[0064] The aptamers described herein may comprise the nucleotide sequence 5'-ACACCAAC-3' (SEQ ID NO: 14), or a variant or derivative thereof. Alternatively or additionally, the aptamers described herein may comprise the nucleotide sequence 5'-ACACCAACA-3' (SEQ ID NO: 15), or a variant or derivative thereof. Alternatively or additionally, the aptamers described herein may comprise the nucleotide sequence 5'-ACACCAACT-3' (SEQ ID NO: 16), or a variant or derivative thereof. Alternatively or additionally, the aptamers described herein may comprise the nucleotide sequence 5'-GATGGCTACTTCGCTACTGG-3' (SEQ ID NO: 17), or a variant or derivative thereof. Alternatively or additionally, the aptamers described herein may comprise the nucleotide sequence 5'-CACCAGTCAGACACCAACAC-3' (SEQ ID NO: 18), or a variant or derivative thereof. Alternatively or additionally, the aptamers described herein may comprise the nucleotide sequence 5'-CACCAGTCAGACACCAACT-3' (SEQ ID NO: 19), or variants or derivatives thereof. In such instances, the nucleotide sequence is suitably located at the 5' end of the aptamer.

[0065] The aptamers described herein may comprise, or consist of substantially the nucleotide sequence ACACCAACAGGATAGATAGGTTAATTGGTT (SEQ ID NO: 1), or fragments, variants, or derivatives thereof. In some instances, the aptamers of this disclosure comprise, or consist of substantially the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1. It is contemplated that one or more of the thymine residues in SEQ ID NO: 1 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise nucleotide sequences exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence shown in SEQ ID NO: 1 or its complementary nucleotide sequence.

[0066] Alternatively, the aptamers described herein may comprise, or consist substantially of, the nucleotide sequence ACACCAACACGCGGTTGAGATGTGAAGTACTTGTATTTAACTCAGTATATGATGGCTACTTCGCTACTGG (SEQ ID NO: 2), or fragments, variants, or derivatives thereof. In some instances, the aptamers of this disclosure comprise, or consist substantially of, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 2. It is contemplated that one or more of the thymine residues in SEQ ID NO: 2 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise a nucleotide sequence exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 2 or its complementary nucleotide sequence.

[0067] Alternatively, the aptamers described herein may comprise, or consist of substantially the nucleotide sequence of CACCAGTCAGACACCAACACGCGGTTGAGATGTGAAGTACTTGTATTTAACTCAGTATATGATGGCTACTTCGCTACTGG (SEQ ID NO: 3), or fragments, variants, or derivatives thereof. In some instances, the aptamers of this disclosure comprise, or consist of substantially the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 3, or fragments, variants, or derivatives thereof. It is contemplated that one or more of the thymine residues in SEQ ID NO: 3 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise nucleotide sequences exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 3 or its complementary nucleotide sequence.

[0068] Alternatively, the aptamers described herein may comprise, or consist of substantially the nucleotide sequence of CACCAGTCAGACACCAACACACACTCACGGTATCATCAATTGTATTCTTCTGTGATAATGCTGGCTACTTCGCTACTGG (SEQ ID NO: 4), or fragments, variants, or derivatives thereof. In some instances, the aptamers of this disclosure comprise, or consist of substantially the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 4, or fragments, variants, or derivatives thereof. It is contemplated that one or more of the thymine residues in SEQ ID NO: 4 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise nucleotide sequences exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 4 or its complementary nucleotide sequence.

[0069] Alternatively, the aptamers described herein may comprise, or consist substantially of, the nucleotide sequence of CACCAGTCAGACACCAACTGCGGACCGACTTTCTTTAATATTTTATTAGACTTTGATTTCCCTGGCTACTTCGCTACTGG (SEQ ID NO: 5). In some instances, the aptamers of this disclosure comprise, or consist substantially of, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 5. It is contemplated that one or more of the thymine residues in SEQ ID NO: 5 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise nucleotide sequences exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 5 or its complementary nucleotide sequence.

[0070] Alternatively, the aptamers described herein may comprise, or consist of substantially the nucleotide sequence of CACCAGTCAGACACCAACTCCTTTCCTCATCATTTTTCGTTTATTCGTCATCTTACCTACGGTGGCTACTTCGCTACTGG (SEQ ID NO: 6), or fragments, variants, or derivatives thereof. In some instances, the aptamers of this disclosure comprise, or consist of substantially the nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 6, or fragments, variants, or derivatives thereof. It is contemplated that one or more of the thymine residues in SEQ ID NO: 6 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise nucleotide sequences exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 6 or its complementary nucleotide sequence.

[0071] Alternatively, the aptamers described herein may comprise, or consist substantially of, the nucleotide sequence ACACCAACACGCGGTTGAGATGTGA (SEQ ID NO:7), a fragment thereof, a variant thereof, or a derivative thereof. In some instances, the aptamers of this disclosure comprise, or consist substantially of, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO:7, a fragment thereof, a variant thereof, or a derivative thereof. It is contemplated that one or more of the thymine residues in SEQ ID NO:7 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise a nucleotide sequence exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO:7 or its complementary nucleotide sequence.

[0072] Alternatively, the aptamers described herein may comprise, or consist substantially comprise, a nucleotide sequence of ACACCAACAGGATAGATAGGTTAATTGGTTTCCTTAAGTGGTTGTTAGAGTGTGGCTACTTCGCTACTGG (SEQ ID NO: 8), or a fragment thereof, variant thereof, or a derivative thereof. In some instances, the aptamers of this disclosure comprise, or consist substantially comprise, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 8, or a fragment thereof, variant thereof, or a derivative thereof. It is contemplated that one or more of the thymine residues in SEQ ID NO: 8 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise a nucleotide sequence exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 8 or its complementary nucleotide sequence.

[0073] Alternatively, the aptamers described herein may comprise, or consist substantially of, the nucleotide sequence ACACCAACGTGCTGTCAATAAGGTATCCCTGTTAAAGACTTATTTCTTCGCATGGCTACTTCGCTACTGG (SEQ ID NO: 9). In some instances, the aptamers of this disclosure comprise, or consist substantially of, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 9. It is contemplated that one or more of the thymine residues in SEQ ID NO: 9 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise a nucleotide sequence exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 9 or its complementary nucleotide sequence.

[0074] Alternatively, the aptamers described herein may comprise, or consist substantially of, the nucleotide sequence CAATAAGGTATCCCTGTTAAAGACTTATTTCTTCG (SEQ ID NO: 10), a fragment thereof, a variant thereof, or a derivative thereof. In some instances, the aptamers of this disclosure comprise, or consist substantially of, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 10, a fragment thereof, a variant thereof, or a derivative thereof. It is contemplated that one or more of the thymine residues in SEQ ID NO: 10 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise a nucleotide sequence exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 10 or its complementary nucleotide sequence.

[0075] Suitable embodiments of this disclosure include secondary and / or tertiary structures as provided herein, such as hairpins (e.g., Figure 4 (One or more of the secondary and / or tertiary structures shown in the document).

[0076] Therefore, the aptamers described herein may comprise, or consist of, or substantially consist of, the nucleotide sequence of SEQ ID NO: 20 (i.e., ACCAACAGGATAGATAGGTTAATTGGT). In some instances, the aptamers of this disclosure comprise, or consist of, or substantially consist of, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 20. It is contemplated that one or more of the thymine residues in SEQ ID NO: 20 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise a nucleotide sequence exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 20 or its complementary nucleotide sequence.

[0077] Alternatively, the aptamers described herein may comprise, or consist of substantially comprise, a nucleotide sequence of SEQ ID NO: 21 (i.e., CAACACGCGGTTGAGATGTGAAGTACTTGTATTTAACTCAGTATATGATGGCTACTTCGC), a fragment thereof, a variant thereof, or a derivative thereof. In some instances, the aptamers of this disclosure comprise, or consist of substantially comprise, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 21, a fragment thereof, a variant thereof, or a derivative thereof. It is contemplated that one or more of the thymine residues in SEQ ID NO: 21 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise a nucleotide sequence exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 21 or its complementary nucleotide sequence.

[0078] Alternatively, the aptamers described herein may comprise, or consist of substantially comprise, a nucleotide sequence of SEQ ID NO: 22 (i.e., CAACACGCGGTTGAGATGTGAAGTACTTGTATTTAACTCAGTATATGATGGCTACTTCGC), a fragment thereof, a variant thereof, or a derivative thereof. In some instances, the aptamers of this disclosure comprise, or consist of substantially comprise, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 22, a fragment thereof, a variant thereof, or a derivative thereof. It is contemplated that one or more of the thymine residues in SEQ ID NO: 22 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise a nucleotide sequence exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 22 or its complementary nucleotide sequence.

[0079] Alternatively, the aptamers described herein may comprise, or consist of substantially comprise, a fragment, variant, or derivative thereof, of the nucleotide sequence of SEQ ID NO: 23 (i.e., CACGGTATCATCAATTGTATTCTTCTGTGATAATGCTGGCTACTTCG). In some instances, the aptamers of this disclosure comprise, or consist of substantially comprise, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 23. It is contemplated that one or more of the thymine residues in SEQ ID NO: 23 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise a nucleotide sequence exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 23 or its complementary nucleotide sequence.

[0080] Alternatively, the aptamers described herein may comprise, or consist of substantially comprise, a fragment, variant, or derivative thereof, of the nucleotide sequence of SEQ ID NO: 24 (i.e., CAGTCAGACACCAACTGCGGACCGACTTTCTTTAATATTTTATTAGACTTTGATTTCCCTGGCTACTTCGC). In some instances, the aptamers of this disclosure comprise, or consist of substantially comprise, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 24, a fragment, variant, or derivative thereof. It is contemplated that one or more of the thymine residues in SEQ ID NO: 24 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise nucleotide sequences exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 24 or its complementary nucleotide sequence.

[0081] Alternatively, the aptamers described herein may comprise, or consist of substantially comprise, a fragment, variant, or derivative thereof, of the nucleotide sequence of SEQ ID NO: 25 (i.e., CGTTTATTCGTCATCTTACCTACGGTGGCTACTTCGCTACTG). In some instances, the aptamers of this disclosure comprise, or consist of substantially comprise, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 25. It is contemplated that one or more of the thymine residues in SEQ ID NO: 25 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise a nucleotide sequence exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 25 or its complementary nucleotide sequence.

[0082] Alternatively, the aptamers described herein may comprise, or consist of, or substantially consist of, the nucleotide sequence of SEQ ID NO: 26 (i.e., CAACACGCGGTTG), a fragment thereof, a variant thereof, or a derivative thereof. In some instances, the aptamers of this disclosure comprise, or consist of, or substantially consist of, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 26, a fragment thereof, a variant thereof, or a derivative thereof. It is contemplated that one or more of the thymine residues in SEQ ID NO: 26 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise a nucleotide sequence exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 26 or its complementary nucleotide sequence.

[0083] Alternatively, the aptamers described herein may comprise, or consist of substantially comprise, a fragment of, a variant of, or a derivative thereof, of the nucleotide sequence of SEQ ID NO: 27 (i.e., ACCAACAGGATAGATAGGTTAATTGGTTTCCTTAAGTGGTTGTTAGAGTGTGGCTACTTCGCTAC). In some instances, the aptamers of this disclosure comprise, or consist of substantially comprise, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 27, a fragment of, a variant of, or a derivative thereof. It is contemplated that one or more of the thymine residues in SEQ ID NO: 27 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise nucleotide sequences exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 27 or its complementary nucleotide sequence.

[0084] Alternatively, the aptamers described herein may comprise, or consist of substantially comprise, a fragment, variant, or derivative thereof, of the nucleotide sequence of SEQ ID NO: 28 (i.e., CACCAACGTGCTGTCAATAAGGTATCCCTGTTAAAGACTTATTTCTTCGCATGGCTACTTCGC). In some instances, the aptamers of this disclosure comprise, or consist of substantially comprise, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 28. It is contemplated that one or more of the thymine residues in SEQ ID NO: 28 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise a nucleotide sequence exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 28 or its complementary nucleotide sequence.

[0085] Alternatively, the aptamers described herein may comprise, or consist of, or substantially consist of, the nucleotide sequence of SEQ ID NO: 29 (i.e., AATAGGTATCCCTGTTAAAGACTTATT). In some instances, the aptamers of this disclosure comprise, or consist of, or substantially consist of, a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 29. It is contemplated that one or more of the thymine residues in SEQ ID NO: 29 or its complementary nucleotide sequence may be uracil residues. In some instances, the aptamers described herein comprise a nucleotide sequence exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 29 or its complementary nucleotide sequence.

[0086] The aptamers described herein may be single-stranded molecules containing at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, 60, 70, 80, 90, or 100 nucleotides, or any range of nucleotide lengths thereof. More specifically, the aptamer, as a single-stranded molecule, is suitably about 25 to about 80 nucleotides in length (e.g., about 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, ...). The aptamer may be 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides, or any range thereof. In other examples, the aptamer as a single-stranded molecule is about 25 to about 35 nucleotides long. In other examples, the aptamer as a single-stranded molecule is about 40 to about 50 nucleotides long. In some examples, the aptamer as a single-stranded molecule is about 50 to about 60 nucleotides long. In other examples, the aptamer as a single-stranded molecule is about 60 to about 70 nucleotides long. In certain instances, the aptamer as a single-stranded molecule is approximately 70 to 80 nucleotides long. In some instances, the aptamer as a single-stranded molecule is approximately 25 nucleotides long. In one instance, the aptamer as a single-stranded molecule is approximately 30 nucleotides long. In another instance, the aptamer as a single-stranded molecule is approximately 35 nucleotides long. In some instances, the aptamer as a single-stranded molecule is approximately 70 nucleotides long. In one instance, the aptamer as a single-stranded molecule is approximately 79 nucleotides long. In one instance, the aptamer as a single-stranded molecule is approximately 80 nucleotides long.

[0087] The aptamers described herein can have discrete nucleic acid structures that promote preferential binding to GBS bacteria. The primary sequence of DNA or RNA is a one-dimensional specific nucleotide string (e.g., A, C, G, T, or U). The primary sequence determines the three-dimensional conformation of the aptamer (e.g., secondary and / or tertiary structure).

[0088] The secondary structure of a DNA or RNA sequence is represented by two-dimensional contacts between specific nucleotides. Secondary structures can contain Watson / Crick base pairs (A:T and C:G) and other less stable base pairs (e.g., G:T, A:C, G:A, and T:T). Secondary structures include stems or hairpin loops, symmetrical and asymmetrical protrusions, pseudoknots, and combinations thereof. In some cases, such structures can form in nucleic acid sequences of no more than about 30 nucleotides. Interactions (typically depicted in two dimensions) that are geographically distant in the primary sequence and not considered to interact via Watson / Crick base pairs or non-Watson / Crick base pairs are also part of the secondary structure. For example, aptamers can form secondary structures containing hairpin loops.

[0089] The tertiary structure of a DNA or RNA molecule (e.g., an aptamer) is a spatial description of the atoms of the DNA or RNA. The primary sequence of the aptamer restricts the possible tertiary structures, as does the fixed secondary structure. The aptamers described herein can have a three-dimensional structure comprising a set of DNA motifs and secondary structures, which confers the ability to bind to GBS bacteria on the aptamer. DNA secondary and tertiary structures encompass all the ways in which the most stable set of conformations that nucleic acid compounds can form can be described in general terms. For example, an aptamer can form a tertiary structure containing a hairpin loop.

[0090] Suitablely, the aptamers described herein include one or more (e.g., 1, 2, 3, 4, 5, etc.) stem regions and / or ring regions.

[0091] The term "stem region" refers to a double-stranded linear region (also known as a "double-stranded" region) in the same molecule that has complementary segments.

[0092] The terms "hairpin loop" or "loop region" are used interchangeably and refer to a single-stranded region of more than one nucleotide or a modified nucleotide that is not hybridized or has not paired with a base pair. Appropriately, the length of the loop region is sufficient to allow for base pairing that enables the formation of hairpin structures and stem regions.

[0093] Consideration has been given to the fact that the loop region can at least partially facilitate the binding of the aptamer described herein to GBS bacteria. In this regard, the loop region may include a portion of the binding site discussed, such as the 5' or 3' end. In other instances, the loop region, together with the stem region, forms a secondary structure capable of binding to or interacting with GBS bacteria.

[0094] The hairpin structure appropriately includes a single-chain loop region located between a first self-complementary region (e.g., a sense chain) and a second self-complementary region (e.g., an antisense chain), the first and second self-complementary regions at least partially defining the stem region.

[0095] Without being bound by theory, it is assumed that the aptamer binds to GBS bacteria through association with its hairpin structure. Therefore, modifications to the flanking portions or sequences at the 5' and / or 3' ends of the hairpin structure are unlikely to substantially affect the binding of the aptamer to GBS bacteria. Such modifications may include extensions of the portions at the 5' and / or 3' ends, nucleotide deletions in the portions at the 5' and / or 3' ends, nucleotide substitutions in the portions at the 5' and / or 3' ends, and / or nucleotide insertions in the portions at the 5' and / or 3' ends.

[0096] The aptamers described herein may comprise single-stranded and / or double-stranded DNA and / or RNA. In some instances, the aptamers described herein (e.g., aptamers of any of SEQ ID NO: 1-10) comprise both single-stranded and double-stranded DNA. In various instances, the aptamers described herein (e.g., aptamers of any of SEQ ID NO: 1-10) comprise single-stranded DNA. In certain instances, the aptamers described herein (e.g., aptamers of any of SEQ ID NO: 1-10) comprise double-stranded DNA. In other instances, the aptamers described herein (e.g., aptamers of any of SEQ ID NO: 1-10) comprise both single-stranded and double-stranded RNA. In some instances, the aptamers described herein (e.g., aptamers of any of SEQ ID NO: 1-10) comprise single-stranded RNA. In certain instances, the aptamers described herein (e.g., aptamers of any of SEQ ID NO: 1-10) comprise double-stranded RNA. In other instances, the aptamers described herein (e.g., aptamers of any of SEQ ID NO: 1-10) comprise single-stranded DNA and single-stranded RNA.

[0097] DNA can refer to genomic DNA and cDNA. RNA can refer to mRNA, RNA, RNAi, siRNA, cRNA, and autocatalytic RNA. In this respect, the aptamer can be a DNA-RNA hybrid. In those instances where the aptamer is an RNA or DNA-RNA hybrid or contains an RNA or DNA-RNA hybrid, one or more thymine residues, such as the thymine residues in SEQ ID NO: 1 to 10, may be replaced or substituted by uracil residues (including chemically modified uracil residues). In those instances where the aptamer is an RNA or DNA-RNA hybrid or contains an RNA or DNA-RNA hybrid, one or more thymine residues, such as the thymine residues in SEQ ID NO: 14 to 29, may be replaced or substituted by uracil residues (including chemically modified uracil residues).

[0098] The aptamers disclosed herein comprise nucleotide sequences that typically include nucleotides containing A, G, C, T, or U bases. However, the nucleotide sequences may include, but are not limited to, other bases such as inosine, methylcytosine, methylinosine, methyladenosine, and / or thiouridine. As those skilled in the art will understand, the T and U bases in the sequences disclosed herein are interchangeable.

[0099] This article considers “variant” aptamers. As used herein, a nucleic acid “variant” has a defined nucleotide sequence relationship to a reference nucleic acid sequence (e.g., an aptamer or nucleotide sequence of any of SEQ ID NO: 1-10 and 14-29). A “variant” nucleic acid may have one or more deletions or substitutions of the reference nucleic acid sequence. It is well understood in the art that some nucleic acids based on DNA / RNA binding or recognition sites can be substituted or deleted without altering (or with only minimal alteration) their affinity for GBS bacteria or components or molecules derived therefrom. Suitablely, the nucleic acid variant has at least 60% or 65%, 66%, 67%, 68%, 69%, preferably at least 70%, 71%, 72%, 73%, 74%, or 75%, more particularly at least 80%, 81%, 82%, 83%, 84%, or 85%, and even more particularly at least 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, or 99.5% nucleotide sequence identity with the isolated nucleic acids of the present invention (e.g., SEQ ID NO: 1-10 and 14-29).

[0100] The terms commonly used in this article to describe the sequence relationship between corresponding proteins and nucleic acids include “comparison window,” “sequence identity,” “percentage of sequence identity,” and “substantial identity.” Because corresponding nucleic acids / proteins can each contain (1) only one or more portions of the complete nucleic acid / protein sequence shared by the nucleic acid / protein, and (2) one or more portions that differ between the nucleic acids / proteins, sequence comparisons are typically performed by comparing sequences within a “comparison window” to identify and compare local regions with sequence similarity. A “comparison window” is a conceptual segment, typically consisting of 6, 9, or 12 consecutive residues, compared to a reference sequence. For optimal alignment of the corresponding sequences, the comparison window may contain approximately 20% or less of additions or deletions (i.e., vacancies) compared to the reference sequence. The optimal alignment for the comparison window can be performed using computerized implementations of the algorithm (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0 of the Genetics Computer Group, 575 Science Drive Madison, WI, USA, which are incorporated herein by reference), or by checking, and by the optimal alignment generated by any of the various methods of choice (i.e., producing the highest percentage of homology within the comparison window). Reference can also be made to the BLAST family of programs, for example, the program disclosed by Altschul et al., 1997, Nucleic AcidsRes. 25 3389, which is incorporated herein by reference. A detailed discussion of sequence analysis can be found in Unit 19.3 of Current Protocols in Molecular Biology, edited by Ausubel et al. (John Wiley & Sons Inc., New York, 1995-1999).

[0101] The term “sequence identity” is used in its broadest sense herein to include the exact number of nucleotide or amino acid matches, taking into account proper alignment using standard algorithms, and the degree to which sequences are identical within a comparison window. Therefore, the “sequence identity percentage” is calculated by comparing two optimally aligned sequences within a comparison window; determining the number of positions in which identical nucleic acid bases (e.g., A, T, C, G, U) or amino acid residues appear in both sequences to obtain the number of matching positions; dividing the number of matching positions by the total number of positions in the comparison window (i.e., the window size); and multiplying the result by 100 to produce the sequence identity percentage. For example, “sequence identity” can be understood as referring to the “match percentage” calculated by the DNASIS computer program (Windows version 2.5; available from Hitachi Software Engineering Co., Ltd., South San Francisco, California, USA).

[0102] This article also considers nucleic acid fragments, such as aptamer fragments. A “fragment” is a segment, domain, portion, or region of a nucleic acid that constitutes less than 100% of the nucleotide sequence. Non-limiting examples are amplification products, primers, or probes. In specific instances, a nucleic acid fragment may contain, for example, at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 of the described nucleic acids. 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 (any range thereof) consecutive nucleotides.

[0103] This article also considers nucleic acid derivatives, including aptamer derivatives. Such aptamer derivatives may contain, for example, one or more modifications and / or conjugates as described herein.

[0104] Appropriately, the aptamers described herein are isolated. For the purposes of this disclosure, "isolated" means material that has been removed from its natural state or otherwise subjected to human processing. Isolated materials (e.g., aptamers) may be substantially or essentially free of the components that normally accompany them in their natural state, or may be processed to place them in an artificial state together with the components that normally accompany them in their natural state. Isolated materials may be in natural, chemically synthesized, or recombinant forms.

[0105] As used herein, the term "binding" refers to the interaction between an aptamer and GBS bacteria (e.g., *Streptococcus agalactiae*, such as ATCC strain number BAA-1138) or components or molecules derived therefrom (e.g., secreted molecules), and means that said interaction depends on the presence of a specific structure (e.g., a binding site with a specific nucleic acid sequence) or combination of structures on the aptamer recognized by the GBS bacteria. For example, the aptamer recognizes and binds to GBS bacteria (including components or molecules derived therefrom) through the binding site, rather than recognizing and binding molecules or proteins in general.

[0106] As used herein, the term "specific binding" should be understood to mean that the binding interaction between the aptamer described herein and the GBS bacteria described herein (e.g., *Streptococcus agalactiae*, such as ATCC strain number BAA-1138) depends on the detection of the GBS bacteria by the aptamer. Therefore, the aptamer preferentially binds to or recognizes GBS bacteria, even when present in a mixture of other molecules, proteins, nucleic acids, or organisms (e.g., other bacteria). For example, the aptamer may bind to GBS bacteria with a higher affinity than it would bind to another different molecule, protein, nucleic acid, or organism (e.g., bacteria other than GBS bacteria).

[0107] As used herein, the term "binding affinity" describes the strength or measure of the affinity between molecules. The binding affinity of the aptamers described herein to GBS bacteria is based on the dissociation constant (K0). D The dissociation constant can be determined by methods known in the art, and even for complex mixtures, it can be calculated by methods shown in, for example, the following literature: Caceci, M. et al., Byte (1984) 9:340-362.

[0108] Examples of measurements of the dissociation constant are described, for example, in U.S. Patent No. 7,602,495 (which describes surface plasmon resonance analysis), U.S. Patent No. 6,562,627, and US 2012 / 00445849. The dissociation constant can also be determined using a dual-filter nitrocellulose filter, as disclosed, for example, by the determination published by Wong and Lohman, (1993). Proceedings of the National Academy of Sciences (Proc. Natl. Acad. Sci. USA) 90, 5428-5432.

[0109] As used herein, the terms “high affinity” and “relatively high affinity” are used interchangeably and refer to the K-axis between the aptamer and the GBS bacteria of interest (e.g., Streptococcus agalactiae, such as ATCC strain number BAA-1138). D Binding affinity less than about 500 nM (e.g., less than about 500 nM, 450 nM, 400 nM, 350 nM, 300 nM, 250 nM, 200 nM, 150 nM, 140 nM, 130 nM, 120 nM, 110 nM, 100 nM, 90 nM, 80 nM, 70 nM, 60 nM, 50 nM, 40 nM, 30 nM, 20 nM, 10 nM, 5 nM, 2.5 nM, 1 nM, 0.5 nM, 0.1 nM and any range thereof), more particularly less than about 130 nM, more particularly less than about 70 nM, more particularly less than about 40 nM, even more particularly less than about 2 nM and even more particularly less than about 0.5 nM. For example, the binding affinity between aptamers and GBS bacteria can be from about 500 nM to about 0.1 nM K. D More specifically, the binding affinity between the aptamer and GBS bacteria can be from approximately 100 nM to approximately 0.5 nM K. D Even more specifically, the binding affinity between the aptamer and GBS bacteria can be from about 50 nM to about 1 nM K. D Even more specifically, the binding affinity between the aptamer and GBS bacteria can be from about 50 nM to about 0.1 nM K. D Even more specifically, the binding affinity between the aptamer and GBS bacteria can be from about 10 nM to about 0.1 nM K. D .

[0110] As may be used interchangeably herein, the terms “specific binding” and “selective binding” with respect to aptamers describe the distinctive binding of the aptamer to a target molecule (e.g., GBS bacteria) such that the aptamer substantially does not cross-react with non-target molecules (e.g., other bacterial species). Therefore, the aptamers of this disclosure suitably do not show obvious binding to or have low affinity for bacterial species other than GBS bacteria, such as Streptococcus pneumoniae (GBS bacteria). Streptococcus pneumoniae Bacillus subtilis ( Bacillus subtilis ), Enterococcus faecalis ( Enterococcus faecalis ), Escherichia coli ( Escherichia coli Staphylococcus aureus ( Staphylococcus aureus ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa Staphylococcus epidermidis ( Staphylococcus epidermidis ), Bacillus cereus ( Bacillus cereus Acinetobacter baumannii ( Acinetobacter baumannii ) and Streptococcus pyogenes ( Streptococcus pyogenes ).

[0111] As used herein, the terms “low affinity” and “relatively low affinity” are used interchangeably and refer to the K-value between the aptamer and non-GBS bacteria (such as those provided above). D Binding affinity greater than about 1 µM, more particularly greater than about 10 µM, more particularly greater than about 20 µM, more particularly greater than about 50 µM, even more particularly greater than about 100 µM and even more particularly greater than about 200 µM.

[0112] Typically, the binding of an aptamer to a target molecule does not involve the formation of a nucleotide base pair between the aptamer and the target molecule. Those skilled in the art will recognize that it is well known in the art that the polynucleotide sequence of an aptamer may contain base pairs not required for the specific binding of the aptamer to a given target molecule, and that smaller fragments of the aptamer, even those with less than 50% sequence identity, may still be able to bind effectively to the target molecule (Alsager et al., Analytical Chemistry 87.8(2015): 4201-4209).

[0113] Affinity can be determined using standard competitive binding immunoassay procedures known in the art, such as electrophoretic mobility variation assay (EMSA), enzyme-linked immunosorbent assay (ELISA), and surface plasmon resonance (SPR). Flow cytometry methods as described in U.S. Patent No. 5,853,984 can also be used.

[0114] As described in WO 2011 / 061351, microarrays, BIAcore assays, differential centrifugation, chromatography, electrophoresis, immunoprecipitation, optical biosensors, and other SPR assays can be used. Other assays that can be used include calorimetry and dot blot assays. Furthermore, just as ELISA is applicable to aptamers in ELASA assays, any other assays involving GBS bacteria can be used to replace antibodies as described herein. Such assays can include immunoassays such as radioimmunoassays, flow cytometry assays, blot applications, anisotropy, membrane assays, biosensors, etc. Any other assays known in the art (e.g., quartz crystal microbalances) can also be used or are suitable for detecting or measuring the binding of aptamers to GBS bacteria. Exemplary methods for detecting the binding of aptamers to GBS bacteria are described herein.

[0115] Modified bases The aptamers disclosed herein may have nucleobase (“base”) modifications, substitutions, or additions. Such modifications may advantageously increase the binding specificity and / or selectivity of the aptamers to GBS bacteria.

[0116] The modifications can be one or more of the following: chemical substitution at the sugar position, chemical substitution at the internucleotide link, chemical substitution at the base position, chemical modification at the base position, and chemical addition at the base position. Modifications, substitutions, or additions can be incorporated anywhere within the aptamer sequence, at the 5' end, 3' end, or internally.

[0117] In specific instances, one or more bases of the aptamer described herein (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 bases, including any range thereof) are modified. One or more nucleotides at the 5' end of the aptamer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, etc.) may be modified. Alternatively or additionally, one or more nucleotides at the 3' end of the aptamer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, etc.) may be modified. For example, all bases of the aptamers described herein may be modified. Alternatively, the bases of the aptamers described herein may be left unmodified. At least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or any range thereof, of the bases of the aptamers may be modified.

[0118] Examples of modified bases include aptamers containing one of the following at the 2' position: OH; F; O-alkyl, S-alkyl, or N-alkyl; O-alken, S-alken, or N-alken; O-ynyl, S-ynyl, or N-ynyl; or O-alkyl-O-alkyl, wherein the alkyl, alken, and ynyl groups can be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alken and ynyl groups. In one example, the aptamer contains one of the following at the 2' position: O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3]2, wherein n and m are 1 to about 10.

[0119] Further examples of modified bases may include any one or more of the following: alkyne or azide modification, thiol modification, amino modification, 5' phosphorylation, and 3' phosphorylation.

[0120] Further examples of modified bases include one or more nucleotides containing one of the following at the 2' position: C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, aryl, aralkyl, O-alkanearyl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocyclic alkyl, heterocyclic alkaneary, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving group, reporter group, intercalator, group for improving the pharmacokinetic properties of the aptamer or group for improving the pharmacodynamic properties of the aptamer, and other substituents having similar properties.

[0121] The modification can be selected from the group consisting of: 2'-O-methyl, 2'-O-methoxyethoxy, 2'-fluoro, 2'-allyl, 2'-O-[2-(methylamino)-2-oxoethyl], 4'-thio, 4'-CH2-O-2'-bridge, 4'-(CH2)2-O-2'-bridge, 2'-LNA, 2'-amino, fluoroarabinonucleotide, threonine, or 2'-O--(N-methylcarbamate). The modified bases may include 2'-O-methyl, 2'-fluoro, 2'-allyl, 2'-O-[2-(methylamino)-2-oxoethyl], 4'-thio, 4'-CH2-O-2'-bridge, 4'-(CH2)2-O-2'-bridge, 2'-amino, fluoroarabinonucleotide, threonine, 2'-O--(N-methylcarbamate), and any combination thereof.

[0122] Suitable modifications include 2'-methoxy (2'-O-CH3 or 2'OMe), i.e., alkoxyalkoxy. The aptamer may contain one or more nucleotides modified with 2'OMe at its 5' end and / or 3' (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, etc. ). The aptamer may contain at least one nucleotide modified with 2'OMe at its 5' end and 3'. The aptamer may contain at least one nucleotide modified with 2'OMe at its 5' end. The aptamer may contain at least one nucleotide modified with 2'OMe at its 3' end.

[0123] Modifications may include 2'-methoxyethoxy (2'-O-CH2CH2OCH3 (also known as 2'-O-(2-methoxyethyl) or 2'-MOE)) (Martin et al., 1995). Modifications may include 2'-dimethylaminooxyethoxy, i.e., the O(CH2)2ON(CH3)2 group (also known as 2'-DMAOE), or 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH3)2. Other modifications include 2'-aminopropoxy (2'-OCH2CH2CH2NH2), 2'-allyl (2'-CH2-CH=CH2), 2'-O-allyl (2'-O-CH2-CH=CH2), and 2'-fluorinated (2'-F). The 2'-modification can be located in either the arabinose (top) or ribose (bottom) position. For example, the 2'-arabinose modification is 2'-F.

[0124] Similar modifications can be made at other positions on the aptamer, particularly at the 3' position of the sugar in the 3'-terminal nucleotide or the 5' position of the 5'-terminal nucleotide in the 2'-5' linked aptamer. The aptamer can also have a sugar mimic, such as replacing the cyclobutyl moiety of the pentofuranosyl sugar. The aptamer can also have a ribose or deoxyribose component (e.g., 1'2'-dideoxyribose modification).

[0125] Representative U.S. patents teaching the preparation of such modified sugar structures include, but are not limited to, US 4,981,957, US 5,118,800, US 5,319,080, US 5,359,044, US 5,393,878, US 5,446,137, US 5,466,786, US 5,514,785, US 5,519,134, US 5,567,811, US 5,576,427, US 5,591,722, US 5,597,909, US 5,610,300, US 5,627,053, US 5,639,873, US 5,646,265, US 5,658,873, and US US5,670,633, US5,792,747 and US5,700,920.

[0126] Further modifications to the sugar can include locked nucleic acids (LNAs), in which a 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. The linking bond can be a methylene (-CH2-) bridging the 2' oxygen atom and the 4' carbon atom. n A group, wherein n is 1 or 2. LNA and its preparation are described in WO 98 / 39352 and WO 99 / 14226.

[0127] Modified nucleobases may include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-CC-CH3)uracil and cytosine, and other alkynyl derivatives of pyrimidine bases, 6-azouracil. Cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deadenine and 7-deadenine, and 3-deadenine and 3-deadenine, m 1 A (1-methyladenosine); m 2 A (2-methyladenosine); Am (2'-O-methyladenosine); ms 2 m 6 A(2-methylthio-N) 6 -methyladenosine); i 6A(N) 6 -Isopentenyl adenosine); ms 2 i 6 A(2-methylthio-N) 6 (isopentenyl adenosine); io 6 A(N) 6 -(cis-hydroxyisopentenyl)adenosine); ms 2 io 6 A(2-methylthio-N) 6 -(cis-hydroxyisopentenyl)adenosine); g 6 A(N) 6 -glycylcarbamoyladenosine); t 6 A(N) 6 -Threonylcarbamoyladenosine); ms 2 t 6 A(2-methylthio-N) 6 -Threonylcarbamoyladenosine); m 6 t 6 A(N) 6 -Methyl-N 6 -Threonylcarbamoyladenosine); hn 6 A(N) 6 -hydroxyn-valinecarbamoyladenosine); ms 2 hn 6 A(2-methylthio-N) 6 -hydroxyvaline carbamoyl adenosine); Ar(p) (2'-O-ribosyl adenosine (phosphate ester)); I (inosine); m 1 I(1-methylinosine); m 1 Im (1,2'-O-dimethylinosine); m 3 C(3-methylcytidine); Cm(2'-O-methylcytidine); s 2 C(2-thiocytidine); ac 4 C(N) 4 -acetylcytidine); f 5 C(5-formylcytidine); m 5 Cm(5,2'-O-dimethylcytidine); ac 4 Cm(N) 4 -acetyl-2'-O-methylcytidine); k 2 C (lysicin); m 1 G(1-methylguanosine); m 2 G(N) 2 -methylguanosine); m 7 G(7-methylguanosine); Gm(2'-O-methylguanosine); m 2 2G(N) 2 N 2-dimethylguanosine); m 2 Gm(N) 2 ,2'-O-dimethylguanosine); m 2 2Gm(N) 2 N 2 ,2'-O-trimethylguanosine); Gr(p) (2'-O-ribosylguanosine (phosphate)); yW (huaistin); o 2 yW (peroxywaitoside); OHyW (hydroxywaitoside); OHyW* (undermodified hydroxywaitoside); imG (waitoside); mimG (methylwaitoside); Q (waitoside); oQ (epoxy resin waitoside); galQ (galactosyl-waitoside); manQ (mannosyl-waitoside); preQo (7-cyano-7-deazoguanosine); preQ1 (7-aminomethyl-7-deazoguanosine); G + (Ancient purine); D (dihydrouridine); m 5 Um(5,2'-O-dimethyluridine); s 4 U (4-thiouridine); m 5 s 2 U (5-methyl-2-thiouridine); s 2 Um (2-thio-2'-O-methyluridine); acp 3 U (3-(3-amino-3-carboxypropyl)uridine); ho 5 U (5-hydroxyuridine); mo 5 U (5-methoxyuridine); cmo 5 U (uridine 5-oxyacetic acid); mcmo 5 U (uridine 5-oxyacetic acid methyl ester); chm 5 U (5-(carboxyhydroxymethyl)uridine); mchm 5 U (5-(carboxyhydroxymethyl)uridine methyl ester); mcm 5 U (5-methoxycarbonylmethyluridine); mcm 5 Um (5-methoxycarbonylmethyl-2'-O-methyluridine); mcm 5 s 2 U (5-methoxycarbonylmethyl-2-thiouridine); nm 5 s 2 U (5-aminomethyl-2-thiouridine); mnm 5 U (5-methylaminomethyluridine); mnm 5 s 2 U (5-methylaminomethyl-2-thiouridine); mnm 5 se 2 U (5-methylaminomethyl-2-selenouridine); ncm 5 U (5-carbamoylmethyluridine); ncm5 Um (5-carbamoylmethyl-2'-O-methyluridine); cmnm 5 U (5-Carboxymethylaminomethyluridine); cmnm 5 Um (5-carboxymethylaminomethyl-2'-O-methyluridine); cmnm 5 s 2 U (5-Carboxymethylaminomethyl-2-thiouridine); m 6 2A(N) 6 N 6 -dimethyladenosine); Im(2'-O-methylinosine); m 4 C(N) 4 -methylcytidine); m 4 Cm(N) 4 ,2'-O-dimethylcytidine); hm 5 C(5-hydroxymethylcytidine); m 3 U (3-methyluridine); cm 5 U(5-carboxymethyluridine); m 6 Am(N) 6 ,2'-O-dimethyladenosine); m 6 2Am(N) 6 N 6 (O-2'-trimethyladenosine); m 2,7 G(N) 2 ,7-Dimethylguanosine); m 2,2,7 G(N) 2 N 2 ,7-Trimethylguanosine); m 3 Um(3,2'-O-dimethyluridine); m 5 D (5-methyldihydrouridine); f 5 Cm (5-formyl-2'-O-methylcytidine); m 1 Gm(1,2'-O-dimethylguanosine); m 1 Am(1,2'-O-dimethyladenosine); τm 5 U(5-taurine); τm 5 s 2 U (5-taurylmethyl-2-thiouridine); imG-14 (4-demethylwoyoside); imG2 (isowoyoside); or ac 6 A(N) 6 -acetyl adenosine.

[0128] Other modified nucleobases include tricyclic pyrimidines, such as phenoxazincytidine (1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one) and phenthiazincytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamp, such as substituted phenoxazincytidine (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazolecytidine (2H-pyrimido[4,5-b]indole-2-one) and pyridoindolecytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimido-2-one).

[0129] Modified nucleobases may also include modified nucleobases in which purine or pyrimidine bases are replaced by other heterocycles, such as 7-deadenine, 7-deadenine, 2-aminopyridine, and 2-pyridone. Other nucleobases include those disclosed in US 3,687,808; those disclosed in JI Kroschwitz (ed.), *The Concise Encyclopedia of Polymer Science and Engineering*, pp. 858-859, John Wiley and Sons (1990); those disclosed in Englisch et al. (1991); and those disclosed in YS Sanghvi, Chapter 15: *Antisense Research and Applications*, pp. 289-302, ST Crooke, B. Lebleu (ed.), CRC Press, 1993.

[0130] Certain nucleobases are particularly useful for increasing the binding affinity of aptamers. These nucleobases can include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase the stability of nucleic acid duplexes by 0.6–1.2 °C. These nucleobase substitutions can be combined with 2'-O-methoxyethyl sugar modifications.

[0131] Representative U.S. patents teaching the preparation of certain of the above-mentioned modified nucleosides and other modified nucleosides include, but are not limited to, US 3,687,808, US 4,845,205, US 5,130,302, US 5,134,066, US 5,175,273, US 5,367,066, US 5,432,272, US 5,457,187, US 5,459,255, US 5,484,908, US 5,502,177, US 5,525,711, US 5,552,540, US 5,587,469, US 5,594,121, US 5,596,091, US 5,614,617, US 5,645,985, and others. 5,830,653, US 5,763,588, US 6,005,096, US 5,681,941 and US 5,750,692.

[0132] Further examples of suitable chemical modifications of the aptamers described in this article can be found in the 'Integrated DNA Technologies Catalog'. https: / / sg.idtdna.com / site / Catalog / Modifications It was found in () and incorporated into this article by reference.

[0133] The aptamer may also include various spacers at the 5' or 3' end. The spacers may be hexanediol spacers capable of blocking DNA polymerase extension, photolytically cleavable spacers that can be placed between the 5' modifying group and the aptamer or within the aptamer sequence to control the assembly and disassembly of the aptamer molecule, various ethylene glycol-based spacers, or any other spacers known in the art.

[0134] Unless otherwise stated, references to the bases A, T, G, U, or C in this document may refer to naturally occurring bases or their modified versions.

[0135] skeleton The aptamers disclosed herein include aptamers having a modified backbone or non-natural internucleotide linkages. Aptamers with a modified backbone include aptamers that retain a phosphorus atom in the backbone and aptamers that do not have a phosphorus atom in the backbone. Such modifications (including phosphate thioester backbones) can advantageously protect the aptamer from nuclease digestion and / or increase the aptamer's affinity for GBS bacteria. This increased affinity may be at least in part due to additional electrostatic and London forces.

[0136] Modified aptamer skeletons containing phosphorus atoms include, for example, thiophosphates, chiral thiophosphates, dithiophosphates, triphosphates, aminoalkyl phosphates, methyl phosphonates, and other alkyl phosphonates (including alkylene phosphonates, alkylene phosphonates, and chiral phosphonates), phosphonites, phosphoramide esters (including 3'-aminophosphatidyl and aminoalkylphosphatidyl), thiophosphatidyl, thioalkylphosphonates, thioalkyl phosphates, selenophosphates, and boran phosphates, their 2'-5' linked analogs, and those esters with reverse polarity, wherein one or more nucleotides are linked by a 3'-to-3', 5'-to-5', or 2'-to-2' linker. Aptamers with reverse polarity contain a single 3'-to-3' linker at the 3' terminal nucleotide linker, which can be a single, baseless, reverse nucleoside residue (with a nucleobase deletion or a hydroxyl group in its place). Various salts, mixed salts, and free acid forms are also included.

[0137] Representative U.S. patents teaching the preparation of the aforementioned phosphorus-containing linkages include, but are not limited to, US 3,687,808, US 4,469,863, US 4,476,301, US 5,023,243, US 5,177,196, US 5,188,897, US 5,264,423, US 5,276,019, US 5,278,302, US 5,286,717, US 5,321,131, US 5,399,676, US 5,405,939, US 5,453,496, US 5,455,233, US 5,466,677, US 5,476,925, US 5,519,126, and US 5,536,821, US 5,541,306, US 5,550,111, US 5,563,253, US 5,571,799, US 5,587,361, US 5,194,599, US 5,565,555, US 5,527,899, US 5,721,218, US 5,672,697 and US 5,625,050.

[0138] Modified aptamer skeletons excluding phosphorus atoms include, for example, skeletons formed by short-chain alkyl or cycloalkyl nucleosides, mixed heteroatoms and alkyl or cycloalkyl nucleosides, or one or more short-chain heteroatoms or heterocyclic nucleosides. These skeletons include those having: morpholino bonds (partially formed from the sugar moiety of the nucleoside); siloxane skeletons; sulfide, sulfoxide, and sulfone skeletons; formylacetyl and thioformylacetyl skeletons; methyleneformylacetyl and thioformylacetyl skeletons; ribose acetyl skeletons; olefin-containing skeletons; aminosulfonate skeletons; methyleneimino and methylenehydrazine skeletons; sulfonate and sulfonamide skeletons; amide skeletons; and other skeletons having mixed N, O, S, and CH2 component moieties.

[0139] Representative U.S. patents teaching the fabrication of such skeletons include, but are not limited to, US 5,034,506, US 5,166,315, US 5,185,444, US 5,214,134, US 5,216,141, US 5,235,033, US 5,264,562, US 5,264,564, US 5,405,938, US 5,434,257, US 5,466,677, US 5,470,967, US 5,489,677, US 5,541,307, US 5,561,225, US 5,596,086, US 5,602,240, US 5,610,289, and US 5,602,240, US 5,608,046, US 5,610,289, US 5,618,704, US 5,623,070, US 5,663,312, US 5,633,360, US 5,677,437, US 5,792,608, US 5,646,269 and US 5,677,439.

[0140] Suitablely, the aptamers described herein at least partially comprise a modified backbone. Exemplary modified backbones that can be used in this invention may include backbones comprising: thiophosphates, non-bridging oxygen atoms substituted with sulfur atoms, phosphonates (e.g., methylphosphonates), phosphate diesters, phosphoromorpholidates, phosphoropiperazidates, amides, methylene (methylamino), methylal, thiomethylal, peptide nucleic acids, or phosphoroamidates (e.g., morpholinophosphoryldiamine ester (PMO)), N3'-P5' phosphoramidite, or thiophosphoroamidite. In a particular example, the aptamer comprises a 5' region and a 3' region, the 5' region comprising one or more modified bases and / or bases having a modified backbone, and the 3' region comprising one or more modified bases and / or bases having a modified backbone. In some instances, all internucleotide links of the aptamers described herein are modified or contain modifications, such as phosphate thioester modifications. In alternative instances, the internucleotide links of the aptamers described herein are not modified or do not contain modifications. In certain instances, the aptamer comprises one or more phosphate thioester internucleotide links. More specifically, all internucleotide links of the aptamer contain phosphate thioester modifications. In some instances, at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or any range thereof, of the internucleotide links of the aptamer are modified or non-natural.

[0141] In specific instances, at least a portion of the aptamer has / is ribonucleic acid, deoxyribonucleic acid, DNA phosphate thioester, RNA phosphate thioester, 2'-O-methyl oligonucleotide, 2'-O-methyl oligodeoxyribonucleic acid, 2'-O-alkyl ribonucleic acid, 2'-O-alkyl DNA, 2'-O-alkyl RNA phosphate thioester, 2'-O-alkyl DNA phosphate thioester, 2'-F-phosphate thioester, 2'-F-phosphodiester, 2'-methoxyethyl phosphate thioester, 2-methoxyethyl phosphodiester. Deoxymethylene (methylimino) (deoxyMMI), 2'-O-alkyl MMI, deoxymethyl phosphate, 2'-O-alkylmethylphosphonate, morpholino, 4'-thioDNA, 4'-thioRNA, peptide nucleic acid, 3'-amidide, deoxy3'-amidide, 2'-O-alkyl3'-amidide, locked nucleic acid, cyclohexane nucleic acid, tricyclic-DNA, 2'-fluoroarabinonucleotide, N3'-P5' phosphoramide ester, carbamate-linked, phosphate-triester-linked, nylon backbone modified, and any combination thereof.

[0142] Group B Streptococcus (GBS) bacteria As used herein, the terms "group B streptococcus," "group B Strep," and "GBS" are used interchangeably and refer to streptococcal bacteria that are Gram-positive, catalase-negative. Group B-specific cell wall carbohydrate antigens are common to all GBS strains, and surface capsular polysaccharides allow for classification into types Ia, Ib, II, III, IV, V, VI, VII, VIII, and IX (Lancefield classification scheme). The surface protein antigen C protein, with both α (alpha) and β (beta) components, is common to all Ib strains, 30% of type Ia strains, 60% of type II strains, and some types IV, V, and VI strains. For example, GBS bacteria can be agalactococci.

[0143] As used herein, the term “GBS bacterial infection” refers to any disease, condition, or situation that is at least partially mediated by or associated with GBS bacteria. For example, GBS bacterial infection can lead to urinary tract infections, bloodstream infections (e.g., bacteremia), pneumonia, inflammation of the membranes and fluids surrounding the brain and spinal cord (e.g., meningitis), infections of the placenta and amniotic fluid (e.g., chorioamnionitis), infections of the endometrium (e.g., endometritis), infections of the heart valves (e.g., endocarditis), skin infections, soft tissue infections, bone infections, joint infections, and / or an uncontrolled immune response to the infection (sepsis). Symptoms of GBS bacterial infection in newborns are readily apparent to technicians and may include, for example, fever, hypothermia, feeding difficulties, lethargy, weakness or hypotonia, respiratory distress, irritability, nervousness, seizures, rash, or jaundice. Symptoms of GBS bacterial infection in adults are readily apparent to technicians and may include, for example, a strong, persistent urge to urinate, burning or pain during urination, frequent, small amounts of urine, hematuria, pelvic pain, fever, chills, confusion or lack of alertness, cough, shortness of breath, chest pain, swelling, fever or redness of the infected area, pain in the infected area, lesions with pus or effusion, or stiffness or inability to use a limb or joint.

[0144] In specific instances, GBS bacterial infection is or includes neonatal infection, or more specifically, neonatal sepsis or includes neonatal sepsis. Based on age of onset, neonatal sepsis is generally classified as early-onset (e.g., infection onset within the first six days after birth and usually within the first 24 hours after birth), late-onset (e.g., infection onset between day 7 and day 89 after birth), and very late-onset (e.g., infection onset in children 3 months or older).

[0145] Referring to other examples, GBS bacterial infection is or includes invasive GBS disease. Invasive GBS disease has morbidity and mortality rates in adults over 65 years of age, Black individuals, adults with diabetes, and pregnant women.

[0146] For example, GBS bacterial infections are at least partially mediated by or associated with Streptococcus agalactiae.

[0147] Sensors and methods for detecting GBS bacteria The aptamers described herein can be used to specifically, qualitatively, and / or quantitatively detect GBS bacteria in the context of clinical diagnosis, treatment, and / or research based on the binding of aptamers to GBS bacteria. For example, the aptamers described herein can be used to detect GBS bacteria in a test sample as an indicator that the test sample contains GBS bacteria. It is envisioned that the methods disclosed herein for detecting GBS bacteria in biological samples can be used to quantitatively determine the quantity of GBS bacteria in a biological sample and / or determine whether a subject has a GBS bacterial infection.

[0148] Therefore, in one form, this document provides a sensor for detecting GBS bacteria, the sensor comprising the aptamer described herein.

[0149] As used herein, the term "sensor" refers to a device that measures a physical quantity and converts it into a signal that can be read by an observer or instrument. As will be understood by those skilled in the art, sensors can be calibrated against known standards. Therefore, sensors can be used to capture GBS bacteria:aptamer complexes by utilizing the affinity of aptamers for GBS bacteria, and can be detected using techniques that will be recognizable to those skilled in the art upon reading this disclosure.

[0150] Referring to specific examples, the sensor described herein comprises a single aptamer comprising a nucleic acid sequence selected from the nucleic acid sequences shown in SEQ ID NO: 1 to 10 and 14 to 29, or fragments thereof, variants thereof, or derivatives thereof, constituted by or substantially constituted by such nucleic acid sequences. In alternative examples, the sensor described herein comprises two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or nine or more aptamers comprising a nucleic acid sequence selected from the nucleic acid sequences shown in SEQ ID NO: 1 to 10 and 14 to 29, or fragments thereof, variants thereof, or derivatives thereof, constituted by or substantially constituted by such nucleic acid sequences.

[0151] In some instances, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 1, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 2 to 10 and 14 to 29. In other instances, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 2, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, 3 to 10 and 14 to 29. In some instances, the sensor comprises a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 3, a fragment thereof, a variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, 2, 4 to 10 and 14 to 29. In other instances, the sensor comprises a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 4, a fragment thereof, a variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 3, 5 to 10 and 14 to 29. In a specific example, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 5, a fragment thereof, a variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 4, 6 to 10, and 14 to 29. In other examples, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 6, a fragment thereof, a variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 5, 7 to 10, and 14 to 29.In various examples, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 7, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 6, 8 to 10, and 14 to 29. In other examples, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 8, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 7, 9, 10, and 14 to 29. In some instances, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 9, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 8, 10, and 14 to 29. In other instances, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 10, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 9 and 14 to 29. In some instances, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 14, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10 and 15 to 29. In some instances, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 15, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10, 14, and 16 to 29.In some instances, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 16, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, the nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10, 14, 15, and 17 to 29. In particular instances, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 17, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, the nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10, 14 to 16, and 18 to 29. For each example, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 18, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10, 14 to 17, and 19 to 29. For other examples, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 19, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10, 14 to 18, and 20 to 29. Referring to certain examples, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 20, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10, 14 to 19, and 21 to 29. Referring to other examples, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 21, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10, 14 to 20, and 22 to 29.In some instances, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 22, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10, 14 to 21, and 23 to 29. In some instances, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 23, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10, 14 to 22, and 24 to 29. In other instances, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 24, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10, 14 to 23, and 25 to 29. In a particular instance, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 25, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10, 14 to 24, and 26 to 29. For each example, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 26, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10, 14 to 25, and 27 to 29. For other examples, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 27, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10, 14 to 26, and 28 to 29.For certain instances, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 28, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10, 14 to 27, and 29. For some instances, the sensor includes a first aptamer comprising, or substantially comprising, the nucleic acid sequence shown in SEQ ID NO: 29, or a fragment thereof, variant thereof, or a derivative thereof; and one or more additional aptamers comprising, or substantially comprising, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10 and 14 to 28.

[0152] The sensor may also include a substrate. The substrate can facilitate the detection of GBS bacteria or GBS bacteria:aptamer complexes. The substrate can be any surface through which aptamers can be directly or indirectly connected by covalent or non-covalent bonds. The substrate material can be naturally occurring, synthetic, or a modified version of a naturally occurring material. The substrate can be beads, a matrix, cross-linked polymer, gel, particles, a surface, a plate, paper, a membrane, a pore, or other solid or semi-solid substrate, or any combination thereof.

[0153] The substrate can be the surface of a sensor chip (e.g., for BIACore or surface plasmon resonance), an ELISA / ELLBA plate, agarose gel (sepharose), agarose, protein A, protein G, magnetic beads, paramagnetic particles, nanomaterials such as nanoparticles, atomic clusters, dots (e.g., quantum dots or carbon dots), or any other substrate known to those skilled in the art.

[0154] As used herein, the term "nanoparticle" refers to particles with a diameter less than 1000 nm. As those skilled in the art will understand, nanoparticles can be classified as 0D (e.g., nanoparticles and quantum dots), 1D (e.g., nanorods, nanofibers, nanopillars, and nanowires), 2D (e.g., nanosheets and nanoplates), and 3D (e.g., nanocomposites and complex hierarchical structures). Nanoparticles can have any suitable shape, including but not limited to spherical or hemispherical, cubic, rod-shaped, polyhedral, sheet-like, circular or semi-circular, angular, irregular, etc.

[0155] Nanoparticles can be any suitable material known to those skilled in the art. For example, noble metal nanoparticles can be used where a colorimetric signal is required. Thus, in some instances, nanoparticles are noble metal nanoparticles. Noble metals include gold (Au), silver (Ag), ruthenium (Ru), rhodium (Rh), palladium (Pd), osmium (Os), iridium (Ir), platinum (Pt), mercury (Hg), rhenium (Re), iron (Fe), and copper (Cu). Nanoparticles can be gold nanoparticles or silver nanoparticles. Nanoparticles can be bimetallic, trimetallic, or multimetallic nanoparticles. For example, nanoparticles can be a hybrid of gold and silver. Alternatively, nanoparticles can be a hybrid of gold, silver, and platinum. Bimetallic gold and silver nanoparticles can be in the form of core-shell nanoparticles or alloy nanoparticles.

[0156] A sensor can be a quantum sensor. For example, a quantum sensor can use quantum states to measure any quantity.

[0157] Aptamers can be coupled, bound, attached, or otherwise connected to a substrate. For example, aptamers can be coupled, bound, attached, or otherwise connected to a substrate that facilitates the detection, isolation, or purification of GBS bacteria:aptamer complexes from biological samples. In this regard, the substrate can be adapted to chromatographic methods (e.g., affinity chromatography), magnetic bead depletion, or other techniques that facilitate the detection, isolation, or purification of GBS bacteria:aptamer complexes from samples. Further consideration is warranted, aptamers can be conjugated or connected to the substrate directly or indirectly (e.g., via linkers).

[0158] In another form, this document provides a method for generating a sensor for detecting GBS bacteria, the method comprising the following steps: (a) Provide a base; and (b) To couple, bind, attach, or otherwise connect the aptamer described herein to the substrate. The sensor is thus generated.

[0159] In yet another form, this article provides a method for detecting GBS bacteria in a sample, the method comprising the following steps: (a) bringing the sample into contact with the aptamer or sensor described herein; and (b) Detect the presence or absence of the GBS bacteria:aptamer complex, or measure the level of the GBS bacteria:aptamer complex. This is used to detect GBS bacteria in the sample.

[0160] In another form, this article provides a method for detecting GBS bacterial infection in a subject, the method comprising the following steps: (a) bringing a biological sample obtained from the subject into contact with the aptamer or sensor described herein; and (b) Detect the presence or absence of the GBS bacteria:aptamer complex, or measure the level of the GBS bacteria:aptamer complex. This is to detect the GBS bacterial infection in the subject.

[0161] Methods for “detection,” “determining binding levels,” or “measuring binding levels” are not particularly limited, as long as they can detect the binding between the aptamer described herein and GBS bacteria present in the sample. Examples include surface plasmon resonance, high-resolution microscopy (e.g., electron microscopy or confocal microscopy), and immunoadsorption assays, in which GBS bacteria and / or GBS bacteria:aptamer complexes can be detected and optionally quantified. According to standard methods known in the art, such binding levels of the aptamer to GBS bacteria (e.g., the level of the GBS bacteria:aptamer complex) can be directly correlated with the level or concentration of GBS bacteria in the sample.

[0162] As used herein, the term "sample" or "biological sample" includes, but is not limited to, fluids that may contain GBS bacteria, solutions that may contain GBS bacteria, and biological samples obtained from human or animal subjects. Biological samples may include, but are not limited to, vaginal swabs, saliva, oral or nasal swabs, serum, blood, urine, skin, cerebrospinal fluid (CSF), or tissues and fluids obtained via biopsy and autopsy. For example, a vaginal swab may contain vaginal fluid. In another instance, a biological sample may be derived from a rectal swab containing rectal fluid. In other instances, a biological sample is CSF or contains CSF, such as CSF obtained via lumbar puncture. Samples may be fresh. It should be understood that fresh samples include, but are not limited to, samples obtained from a subject and subjected to the methods described herein within minutes of sample acquisition (e.g., less than about 5 to about 30 minutes).

[0163] The sample may be a stored sample. It should be understood that a stored sample may have been prepared and / or obtained from the subject and has been stored, for example, in a refrigerator or freezer, prior to being subjected to the methods described herein. Samples may be used where they are not subjected to any treatment (e.g., dilution, filtration, concentration) prior to being used in the methods described herein. Samples may be processed. Sample processing may involve one or more of the following: filtration, dilution, centrifugation, distillation, extraction, concentration, fixation, component inactivation, etc. Samples may be diluted, concentrated, filtered, or centrifuged prior to use.

[0164] With respect to the aspects described herein, the terms “subject,” “patient,” and “individual” include, but are not limited to, mammals, including humans, performing animals (e.g., horses, camels, greyhounds), livestock (e.g., cattle, sheep, horses), and companion animals (e.g., cats and dogs). Appropriately, a subject is a human being. A subject can be anyone, such as a pregnant woman, a child (e.g., from about 1 day to about 16 years of age), such as a newborn (e.g., from about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 14 days, 21 days, 28 days, 35 days, 40 days, 50 days, 60 days, 70 days, 80 days, 90 days, or 100 days of age or any range thereof), an elderly person (e.g., > 65 years of age), or an immunocompromised person.

[0165] Terms such as “contact,” “exposure,” or “apply” are considered to be used interchangeably in the context of this disclosure. The term “contact” requires that the aptamer be brought into contact with a sample to form a detectable complex (e.g., GBS bacteria:aptamer complex). Such binding can be detected using a variety of techniques known in the art. For example, a surface plasmon resonance sensor chip or device incorporating the aptamer described herein can be used. Immunoassays incorporating the aptamer described herein can also be used.

[0166] It is assumed that determining the conditions under which the aptamers described herein bind to GBS bacteria will be entirely within the knowledge of those skilled in the art. Typically, the aptamers of this disclosure are available in suitable solutions and concentrations that enable them to recognize and bind to GBS bacteria in a sample.

[0167] Some methods for detecting GBS bacteria include contacting a sample with the aptamers described herein, and detecting the presence or absence of GBS bacteria and / or GBS bacteria:aptamer complexes in the sample, or measuring the levels of the GBS bacteria and / or GBS bacteria:aptamer complexes. The detection of GBS bacteria:aptamer complexes may indicate the presence of GBS bacteria. The absence of GBS bacteria:aptamer complexes may indicate the absence of GBS bacteria. Measuring the levels of GBS bacteria and / or GBS bacteria:aptamer complexes in a sample can provide a quantitative determination or indication of the number or concentration of GBS bacteria in the sample.

[0168] Samples may be contacted with the aptamer described herein under conditions and for a sufficient amount of time to allow the aptamer to bind with GBS bacteria and form a GBS bacteria:aptamer complex. For example, samples may be incubated with the aptamer. Incubation may be performed at room temperature (e.g., 25°C). Alternatively, incubation may be performed at 4°C. Alternatively, incubation may be performed at higher temperatures (e.g., including but not exceeding and at the aptamer's melting temperature). Alternatively, incubation may be performed at temperatures above the aptamer's melting temperature (e.g., not exceeding 90°C). Incubation may be performed overnight. Alternatively, incubation may be performed for at least about 1 minute (e.g., at least about 1 minute, 2 minutes, 5 minutes, 10 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes or any range thereof), at least about 5 minutes, at least about 10 minutes, at least about 20 minutes, at least about 30 minutes, at least about 45 minutes, at least about 1 hour (e.g., at least about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 8 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 24 hours or any range thereof), at least about 2 hours, at least about 3 hours, at least about 4 hours, at least about 5 hours, at least about 6 hours, at least about 12 hours or at least about 24 hours. Alternatively, incubation may be performed for no more than 1 hour, no more than 45 minutes, no more than 30 minutes, no more than 15 minutes or no more than 10 minutes. Precise incubation time may not be required, and GBS detection may be performed immediately after contact between the aptamer and the GBS bacteria.

[0169] The detection may include methods that include directly labeling the aptamer (e.g., with a modified nucleotide incorporated into the aptamer, a labeled nucleotide, or a tag) or simply binding the aptamer to GBS bacteria to form a GBS bacteria:aptamer complex.

[0170] For example, aptamers can be detectably labeled, e.g., at their 5' and / or 3' ends, or can bind to detectable labels. Aptamers can be linked to enzymes, enzyme substrates, fluorescent or fluorescent substrates, chemiluminescent molecules, chemiluminescent substrates, purification tags, and / or solid supports. In one instance, the GBS bacteria:aptamer complex can be detected directly or indirectly.

[0171] Alternatively or additionally, it is conceivable that the methods described herein may include the addition of an oligonucleotide complementary to the aptamer shown in any of SEQ ID NO: 1-10. Alternatively or additionally, it is conceivable that the methods described herein may include the addition of an oligonucleotide complementary to the aptamer shown in any of SEQ ID NO: 14-29.

[0172] In addition to the aptamers disclosed herein, the sensors described herein may also include one or more binding agents (e.g., antibodies, antibody fragments, nanobodies, aptamers, etc.) that specifically bind to additional analytes (e.g., bacterial species other than GBS bacteria or agalactococci). In this respect, the sensors may form part of a multiplex sensor or detection system in which multiple analytes or bacterial types are simultaneously tested or detected in a single sample, and more particularly, a single biological sample.

[0173] In another form, this disclosure provides a method for isolating or purifying GBS bacteria from a sample, the method comprising the following steps: (a) bringing the sample into contact with the aptamer or sensor described herein; and (b) Isolate the GBS bacteria:aptamer complex from the sample. GBS bacteria can thus be isolated or purified from the sample.

[0174] Methods for isolating or purifying GBS bacteria and / or GBS bacteria:aptamer complexes from samples are obvious to those skilled in the art and / or are described herein.

[0175] In this document, the term "isolation" appropriately refers to the purification, concentration, or removal of GBS bacteria from a sample, at least partially. Affinity-based isolation methods can be used. Tags or markers on aptamers as described herein can also be used to enable the filtering or sorting of GBS bacteria from a sample, for example, by fluorescence-based sorting systems.

[0176] The aptamer may contain additional nucleotide sequences, for example, at its 5' and / or 3' ends. The aptamer may contain a tag sequence, and optionally one or more spacer nucleotide bases at its 5' and / or 3' ends, to facilitate the isolation or purification of GBS bacteria. Alternatively or additionally, the aptamer may contain a linker sequence, and optionally one or more spacer nucleotide bases at its 5' and / or 3' ends, to facilitate conjugation or ligation with a substrate.

[0177] The methods described herein can be performed using an enzyme-linked immunosorbent assay (ELISA). As used herein, the terms “ELISA”, “sandwich ELISA”, “capture ELISA”, or “EIA” refer to immobilizing the aptamer described herein onto a solid support, followed by the addition of a sample volume. The GBS bacteria:aptamer complex can then be detected by a detection molecule that recognizes the GBS bacteria:aptamer complex. The GBS bacteria:aptamer complex can be detected by a detection molecule that can be covalently linked to the enzyme, or it can be detected itself by adding a second detection molecule or nanoparticle linked to the enzyme.

[0178] Alternatively, the methods described herein can be performed using lateral flow chromatography (LFA). LFA, also known as "immunochromatographic strip test," has been a popular platform for rapid immunoassays since its introduction in the mid-1980s.

[0179] LFA is particularly suitable for situations requiring rapid testing or where specialized laboratory equipment is unavailable. In hospitals, clinics, doctors' offices, and clinical laboratories, LF-based tests are used for the qualitative and quantitative detection of the presence of specific analytes in fluid samples.

[0180] LFA works on the same principle as ELISA. Essentially, these tests run a fluid sample along the surface of a membrane or filter paper containing reactive molecules that produce a visually positive or negative result depending on the presence of a specific analyte. An LFA device is configured to receive a sample at a sample area and move the sample laterally from the sample area to the detection area via capillary action, for example, wicking.

[0181] Lateral flow chromatography apparatuses typically have a solid support on which optional sample zones, optional binding zones, detection zones, and optional absorption zones are mounted. The solid support (“backing card”) supports the pad and membrane to be measured but does not otherwise participate in the reaction or flow of the sample and analyte. The backing card is made, for example, of polyvinyl chloride (PVC). The combination of the pad and membrane on the backing card is typically housed in a plastic casing, but this is not required. The casing may have at least one opening (“sample port”) above the sample pad for sample application. Control and test zones are visible (e.g., via the opening or window) to detect or measure binding. The casing prevents the user from applying the sample anywhere other than the sample pad. The casing also protects the strips from accidental splashes onto the membrane. External labels on the casing may also be used to indicate the location of test and control lines and provide other information. The casing may be available as an off-the-shelf box or custom-designed to fit around the strips. Internal pins and rods are used to hold the strip in place relative to the sample port and observation window. They maintain fluid communication between the materials as the test strip runs.

[0182] Suitable materials that can be included in the lateral flow chromatography apparatus described herein for the sample zone, conjugation zone, or detection zone include, but are not limited to, organic or inorganic polymers, as well as natural and synthetic polymers, including glass fiber, cellulose, nylon, cross-linked dextran, various chromatographic papers, and nitrocellulose. It should be understood that suitable materials will allow the sample to flow laterally along the apparatus described herein via capillary action. In some instances, the detection zone is a nitrocellulose membrane. In some instances, the sample zone and conjugation zone may be constructed of the same material. In some instances, the lateral flow chromatography apparatus includes a sample zone in capillary contact with the detection zone. Suitable commercially available materials are known to those skilled in the art. Commercially available materials can be used for the sample zone, conjugation zone, and / or detection zone that can be included in the lateral flow chromatography apparatus described herein.

[0183] Methods for monitoring GBS bacterial infection It is envisioned that the method described in this paper for detecting GBS bacteria:aptamer complexes in biological samples could be used to monitor GBS bacterial infection in subjects and inform clinicians' treatment decisions and patients' responses to treatment.

[0184] Therefore, in one form, this disclosure provides a method for monitoring GBS bacterial infection in a subject, the method comprising the following steps: (a) bringing a biological sample obtained from the subject into contact with the aptamer or sensor described herein; and (b) Detect the presence or absence of GBS bacteria:aptamer complex, or measure the level of said GBS bacteria:aptamer complex; This is to monitor GBS bacterial infection in the subjects.

[0185] The method of the present invention may include comparing the level of GBS bacteria:aptamer complex in a subject's biological sample with the level of a control sample or reference sample. The terms "control sample" or "reference sample" generally refer to a biological sample from a (healthy) non-disease-prone individual without GBS bacterial infection. Alternatively, a control sample may include a biological sample from an individual or group of individuals having the same GBS bacterial infection as the subject in question and / or receiving the same treatment as the subject in question. A control sample may include a biological sample from an individual with the same GBS bacterial infection, taken from a different tissue or fluid expected to be free of GBS bacterial infection. Control samples may be from subjects known to be free of GBS bacterial infection or samples obtained from subjects at an earlier time point (e.g., before the start of treatment in the subject or at a time point when the subject in question was known to be free of GBS bacterial infection). Control samples may be pooled, averaged, or individual samples. Internal controls are biomarkers derived from the same biological sample being tested.

[0186] The level of the GBS bacterial aptamer complex can be compared to a threshold or reference level. The threshold or reference level is typically a quantitative level of the target molecule of this disclosure (i.e., the GBS bacterial aptamer complex). Generally, levels of the GBS bacterial aptamer complex in a biological sample that are above or below the threshold or reference expression level predict a specific disease state or outcome (e.g., the presence or absence of GBS bacterial infection). The nature and numerical value of the threshold or reference level (if any) will generally vary based on a chosen method for determining the level of the GBS bacterial aptamer complex in a sample, used for, for example, determining the diagnosis and / or monitoring of GBS bacterial infection in a subject.

[0187] Those skilled in the art will be able to use any method known in the art for measuring GBS bacterial:aptamer complex levels, such as the methods described herein, to determine a threshold or reference level of GBS bacterial:aptamer complex in a biological sample, which can be used to determine, for example, the diagnosis and / or monitoring of GBS bacterial infection. The concept of a threshold level should not be limited to a single value or result. In this respect, a threshold level can encompass multiple threshold levels that can represent, for example, a high, intermediate, or low probability of a diagnosis of GBS bacterial infection in a subject.

[0188] As will be understood by those skilled in the art, the levels of GBS bacterial:aptamer complexes provided herein may be relatively: (i) higher, increased, or greater; or (ii) lower, decreased, or reduced compared to levels or threshold levels in control or reference samples. For example, if the level of GBS bacterial:aptamer complexes exceeds the mean and / or median levels of GBS bacterial:aptamer complexes in a reference population, the level of said GBS bacterial:aptamer complexes may be classified as higher, increased, or greater. If the level of GBS bacterial:aptamer complexes is lower than the mean and / or median levels in a reference population, the level of said GBS bacterial:aptamer complexes may be classified as lower, decreased, or reduced. In this respect, the reference population may be a group of subjects without GBS bacterial infection or a group of subjects with the same GBS bacterial infection as those subjects whose GBS bacterial:aptamer complex levels have been determined.

[0189] As used herein, terms such as “higher,” “increased,” and “greater” refer to an increased level of GBS bacteria:aptamer complex in a sample compared to a control or reference level or amount. The level of GBS bacteria:aptamer complex can be relative or absolute. A level of GBS bacteria:aptamer complex can be considered higher, increased, or greater if it is approximately 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 300%, 400%, or at least approximately 500% higher than the level of GBS bacteria:aptamer complex in a control or reference level or amount.

[0190] As used herein, the terms “lower,” “reduced,” and “lower” refer to a lower amount or level of GBS bacteria:aptamer complex in a sample compared to a control or reference level or amount. The levels of GBS bacteria:aptamer complex provided herein can be relative or absolute. A level of GBS bacteria:aptamer complex may be considered lower, reduced, or lower if it is approximately 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10% lower than the level or amount of GBS bacteria:aptamer complex in a control or reference level or amount, or even approximately 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.01%, 0.001%, or 0.0001%.

[0191] Monitoring for GBS bacterial infection in subjects may include collecting multiple samples over a period of time (e.g., 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, etc.). In subsequent samples, lower amounts or levels of GBS bacterial:aptamer complexes or the absence of GBS bacterial:aptamer complexes may indicate, for example, a favorable response to treatment. In subsequent samples, higher amounts or levels of GBS bacterial:aptamer complexes or the presence of GBS bacterial:aptamer complexes may indicate, for example, an unfavorable response to treatment or no response.

[0192] Suitablely, the method of the present invention includes the step of administering a treatment for GBS infection to a subject. The treatment can be any treatment known in the art, such as an antimicrobial agent or antibiotic to which GBS bacteria are at least partially sensitive. Exemplary treatments for GBS infection (e.g., neonatal sepsis) include antimicrobial agents (e.g., antibiotics or antiviral agents), intravenous fluids, anti-inflammatory agents (e.g., corticosteroids, NSAIDs), vasopressors (e.g., vasopressin, catecholamines such as phenylephrine, norepinephrine, epinephrine, isoproterenol, dobutamine, and dopamine), insulin or insulin analogs, analgesics, sedatives, positive inotropic agents (e.g., cardiac glycosides such as digoxin; β-agonists such as dobutamine; and phosphodiesterase inhibitors such as milrinone), immune enhancers, and any combination thereof.

[0193] Exemplary antimicrobial agents or antibiotics include aminoglycosides, ansamycin, carbapenems, carbapenems, cephalosporins, glycopeptides, lincosamides, lipopeptides, macrolides, monocyclic lactones, nitrofurans, oxazolidinones, penicillins, antimicrobial peptides, sulfonamides, tetracyclines, and any combination thereof. Specific non-limiting examples of broad-spectrum antibiotics that can be used to treat sepsis include vancomycin, ceftriaxone, piperacillin-tazobactam, cefepime, tobramycin, imipenem-cilastatin, gentamicin, and any combination thereof. In certain instances, the antimicrobial agent is or includes β-lactam antibiotics such as penicillin, ampicillin, and cefazolin, and optionally aminoglycosides such as gentamicin.

[0194] Treatment methods for GBS bacterial infection This disclosure also provides a method for preventing, improving, or treating GBS bacterial infection in a subject, the method comprising administering a therapeutically effective amount of treatment against the GBS bacterial infection to the subject, wherein a biological sample of the subject has been contacted with the aptamer and / or sensor provided herein, and the presence or level of the GBS bacterial:aptamer complex in the biological sample has been determined. In this respect, the presence or level of the GBS bacterial:aptamer complex is suitable for diagnosing a subject with a GBS bacterial infection.

[0195] As used herein, the terms “treating,” “treat,” or “treatment,” and variations thereof, refer to a clinical intervention designed to alter the natural processes of an individual, tissue, organ, or cell being treated during a clinicopathological process. More specifically, these terms refer to a therapeutic intervention, process of action, or protocol that at least improves the symptoms, complications, sequelae, and / or consequences of such disease, condition, or status and / or its symptoms, complications, sequelae, and / or consequences after at least the onset of such disease, condition, or status. Desired therapeutic effects include a reduction in the rate of disease progression, improvement or alleviation of the disease state, and remission or improvement of prognosis. As used herein, the term “improvement” should be understood to mean a reduction in patient mortality, an increase in the magnitude of response, a reduction in treatment time, a reduction in disease progression, and / or a reduction in pathological symptoms.

[0196] As used herein, “preventing”, “prevent”, or “prevention” refers to a therapeutic intervention, process, or program that begins before the onset of GBS bacterial infection and / or its symptoms, complications, sequelae, and / or consequences, in order to prevent, suppress, or delay the development or progression of GBS bacterial infection or its symptoms, complications, sequelae, and / or consequences.

[0197] As used herein, the term "therapeutic effective amount" describes an amount of the agent sufficient to achieve the desired effect in a subject treated with the specified agent. For example, this could be an amount of a composition comprising one or more agents necessary to reduce, improve, and / or prevent GBS bacterial infection. In some embodiments, a "therapeutic effective amount" is sufficient to alleviate or eliminate the symptoms of GBS bacterial infection. In other embodiments, a "therapeutic effective amount" is an amount sufficient to achieve the desired biological effect, such as an amount that effectively reduces or prevents GBS bacterial infection and / or overcomes resistance to GBS bacterial infection.

[0198] Ideally, the therapeutically effective amount of a drug is sufficient to induce the desired outcome in a subject without causing significant cytotoxic effects. The effective amount of a drug that can be used to alleviate, improve, and / or prevent GBS bacterial infections will depend on the subject being treated, the type and severity of any associated disease, condition, and / or status, and the manner of administration of the therapeutic composition.

[0199] The methods described herein may also include the following initial steps: contacting one or more biological samples obtained from a subject with the aptamers and / or sensors described herein, and / or determining the presence or absence of GBS bacteria:aptamer complexes in one or more biological samples of the subject, or measuring the level of the GBS bacteria:aptamer complexes, for example by those methods described herein.

[0200] Appropriately, treatment for GBS infection may be any treatment known in the art, such as those described above.

[0201] Kits and test reagents This disclosure also provides kits comprising the aptamers or sensors described herein, and optionally instructions for use. Such kits can be used, for example, to perform the aforementioned detection and diagnostic methods.

[0202] The kit may also include a label. The kit typically also includes instructions for use. A label generally refers to any written or recorded material affixed to or otherwise accompanying the kit at any time during its manufacture, transport, sale, or use. For example, the term "label" encompasses advertising leaflets and brochures, packaging materials, instructions, audio or video tapes, computer CDs, and text printed directly on the kit. Such kits may also provide a positive control, such as a purified solution of GBS bacteria or a solution containing biomolecules isolated from GBS bacteria. The kit may also include a negative control, such as a solution containing the aptamers described herein but not in contact with the sample. The kit may further provide a solid support on which the aptamers are placed, such as a material comprising glass fiber, polyester, cellulose, or rayon.

[0203] This disclosure further provides test reagents comprising the aptamers described herein and optionally one or more acceptable excipients, diluents, or carriers. Such test reagents can be used, for example, to perform the detection and diagnostic methods described above.

[0204] The kit may also provide test reagents for specific types of assays. Therefore, the kit may comprise a group of nanoparticles, beads (e.g., for agglutination assays or lateral flow chromatography), or plates (e.g., for ELISA assays). The kit may comprise devices, such as the sensors, lateral flow chromatography devices, analytical rotors, or electrochemical, optical, or photoelectric sensors described herein. A group of nanoparticles, beads, plates, and devices can be used for immunoassays. In examples where the kit includes a lateral flow chromatography device, the aptamer of this disclosure may be included in a kit separate from the device, or the aptamer may be included within the device itself, for example, the aptamer may be dried and fixed onto a conjugated area within the device.

[0205] Additionally, the kit may contain various diluents and buffers, labeled conjugates or other reagents for performing the methods described above, and other signal-generating reagents such as enzyme substrates, cofactors, chromogens, and fluorophores. Those skilled in the art can readily identify other components of the kit. These components may include coating reagents, indicator charts for colorimetric and fluorescence comparisons, disposable gloves, decontamination instructions, smear sticks or containers, sample preparation cups, etc. The kit may contain buffers or other reagents suitable for constituting a reaction medium in which the aptamers described herein come into contact with the sample.

[0206] The kit may include instructions on how to use the kit to detect GBS bacteria. The kit may include instructions on how to prepare the sample. The kit may provide instructions on contacting the sample with the aptamers described herein in any order before analyzing for the presence of GBS bacteria in the sample. The kit may also provide instructions on optimizing the buffer, optimizing the proportions of the various components, optimizing sample dilution, and optimizing the order of mixing and application steps (e.g., mixing all components before application, mixing only some components and applying the others separately).

[0207] The kit may also contain components for obtaining, containing, preparing, measuring, and / or mixing samples. For example, the kit may contain pipettes for transferring a specific volume of sample or other solutions in the kit. Alternatively or additionally, the kit may contain devices for processing biological samples and delivering a specific volume of sample or other solutions in the kit.

[0208] The methods, kits, and test reagents disclosed herein offer numerous advantages. For example, they enable simple, inexpensive, rapid, sensitive, and accurate detection of GBS bacteria without significant false positives or background signals. This allows for accurate and sensitive diagnosis in point-of-care settings.

[0209] To enable the preferred embodiments of this disclosure to be fully understood and put into practice, reference is made to the following non-limiting embodiments.

[0210] Example Example 1: The SELEX scheme for GBS aptamer selection Preparation of random ssDNA libraries To prepare an ssDNA library pool containing 80 random nucleotide sequences (5'-GTCTTGACTAGTTACGCC-(N44)-TCATTCAGTTGGCGCCTC-3') (SEQ ID NO: 11), an asymmetric polymerase chain reaction (PCR) was performed using the forward primer 5'-phosphate-GTCTTGACTAGTTACGCC-3' (SEQ ID NO: 12) and the reverse primer 5'-GAGGCGCCAACTGAATGA-3' (SEQ ID NO: 13). Figure 1 ) Use PCR to amplify template DNA to obtain ssDNA.

[0211] Preparation of GBS bacteria The GBS strain was obtained from ATCC (strain number BAA-1138) and grown on BHI medium to an OD value of 0.6, which is equivalent to 0.5 × 10⁻⁶. 8 Cells / ml and corresponding to the mid-log phase of GBS bacteria.

[0212] Evolution through exponentially enriched ligand systems (SELEX) In short, 2 nanomoles of ssDNA randomized library and 0.5 × 10 8 Group B Streptococci with 1 cell / ml were incubated in 500 µl of 1x binding buffer (i.e., 50 mM Tris-HCl (pH 7.4), 5 mM KCl, 10 mM NaCl, 1 mM MgCl2, and 0.1% yeast tRNA) at room temperature for 1.5 h with gentle mixing. To remove unbound or poorly bound ssDNA, the cells were washed twice with 1 ml of washing buffer (i.e., 50 mM Tris-HCl (pH 7.4), 5 mM KCl, 10 mM NaCl, and 1 mM MgCl2).

[0213] Aptamers bound to cells were collected in 100 µl of DNase-free water by heating at 94 °C for 10 min followed by incubation on ice for 10 min. Cells without aptamers were then centrifuged at 6000 × g for 10 min. The supernatant containing the eluted DNA aptamers was used as a template for PCR amplification to obtain an aptamer pool for the next round of selection. Before completing the next round of SELEX, the PCR products from each step were purified by ethanol precipitation and digested with λ exonuclease to produce ssDNA.

[0214] The stringency of the selection reaction was increased by increasing the washing frequency from 2 to 5 times, reducing the incubation time from 90 minutes to 15 minutes, and reducing the volume of the binding buffer from 500 µl to 200 µl. Three rounds of reverse SELEX were performed to eliminate nonspecific aptamers from the random library pool and directly select the target.

[0215] Fit optimization The ssDNA aptamer pools from rounds three, five, and nine were combined with 0.5 × 10 8 Incubate together a CFU / ml non-target bacterial mixture (cocktail). The preparation of the bacterial mixture for anti-SELEX is similar to that for target cells. Use 1 mL aliquots (0.5 × 10⁻⁶ CFU / ml) of each of the following bacteria: Streptococcus pneumoniae, Bacillus subtilis, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Staphylococcus epidermidis, Bacillus cereus, Acinetobacter baumannii, and Group A Streptococcus (ATCC 10403 and 19615). 8 The ssDNA pools (each CFU / ml) were pooled together and washed twice with washing buffer, then resuspended in 10 ml of PBS and used as the bacterial mixture. 1 ml of this bacterial mixture was used in the reverse SELEX process. The ssDNA pools were incubated with the bacterial mixture. After 1 hour, the supernatant was collected for the next round of selection.

[0216] aptamer characterization Finally, the enriched pool was sequenced using next-generation sequencing (NGS) on the Illumina NGS platform (Australian Genome Research Facility). The top 10 ssDNA sequences with the highest frequency observed during NGS were selected for subsequent characterization, including determining their K+. D Value (dissociation constant). 5'-FAM-tagged aptamers were synthesized by custom synthesis, and these aptamers were subsequently exposed at different known concentrations to fixed concentrations of bacteria (e.g., 0.5 × 10⁻⁶). 8 (cells / ml) to determine the K of aptamers D Value. The degree of binding between aptamers and bacteria was assessed by fluorescence spectroscopy to determine the K value of different aptamers. D Values ​​(Table 1).

[0217] Table 1: Sequences of ssDNA anti-GBS aptamers obtained from the SELEX process after next-generation sequencing and their K values ​​in nanomoles. D value.

Claims

1. An aptamer for binding to Group B Streptococcus (GBS) bacteria, wherein the aptamer comprises a nucleic acid sequence, fragment thereof, variant thereof, or derivative thereof selected from the group consisting of SEQ ID NO:1 to 10 and 14 to 29, or substantially composed of such sequence.

2. The aptamer according to claim 1, wherein the aptamer has a dissociation constant (K0.05) of 500 nM or less for the GBS bacteria. D ).

3. The aptamer according to claim 1 or claim 2, wherein the GBS bacteria is agalactococcus (…). Streptococcus agalactiae ).

4. The aptamer according to any one of claims 1 to 3, wherein it is a DNA molecule or comprises a DNA molecule.

5. The aptamer according to any one of claims 1 to 4, wherein the aptamer is single-chained.

6. The aptamer according to claim 5, wherein the aptamer is a single-stranded DNA molecule or comprises a single-stranded DNA molecule.

7. The adapter according to any one of claims 1 to 6, wherein the adapter forms a secondary or tertiary structure including a hairpin ring.

8. The aptamer according to any one of claims 1 to 7, wherein the aptamer comprises at least one chemical modification.

9. The aptamer according to claim 8, wherein the modification is one or more of the following: chemical substitution at the sugar position, chemical substitution at the internucleotide link, chemical substitution at the base position, and chemical addition at the base position.

10. A sensor for detecting GBS bacteria, comprising an aptamer according to any one of claims 1 to 9.

11. The sensor of claim 10, wherein the aptamer is coupled, bonded, attached, or otherwise connected to the substrate.

12. The sensor of claim 11, wherein the substrate comprises one or more of the following: beads, matrix, cross-linked polymer, gel, particles, surface, plate, paper, membrane, pore or other solid or semi-solid substrate.

13. The sensor according to claim 11 or claim 12, wherein the substrate comprises one or more of the following: a sensor chip surface, an ELISA / ELLBA plate, an agarose gel, agarose, protein A, protein G, magnetic beads, paramagnetic particles, or nanoparticles.

14. A method for detecting GBS bacteria in a sample, the method comprising the following steps: (a) bringing the sample into contact with the aptamer according to any one of claims 1 to 9 or the sensor according to any one of claims 10 to 13; and (b) Detect the presence or absence of the GBS bacteria:aptamer complex, or measure the level of the GBS bacteria:aptamer complex. This is used to detect GBS bacteria in the sample.

15. A method for detecting GBS bacterial infection in a subject, the method comprising the following steps: (a) bringing a biological sample obtained from the subject into contact with an aptamer according to any one of claims 1 to 9 or a sensor according to any one of claims 10 to 13; and (b) Detect the presence or absence of the GBS bacteria:aptamer complex, or measure the level of the GBS bacteria:aptamer complex. This is to detect the GBS bacterial infection in the subject.

16. A method for isolating or purifying GBS bacteria from a sample, the method comprising the following steps: (a) bringing the sample into contact with the aptamer according to any one of claims 1 to 9 or the sensor according to any one of claims 10 to 13; and (b) Isolate the GBS bacteria:aptamer complex from the sample. GBS bacteria can thus be isolated or purified from the sample.

17. A method for monitoring GBS bacterial infection in a subject, the method comprising the following steps: (a) bringing a biological sample obtained from the subject into contact with an aptamer according to any one of claims 1 to 9 or a sensor according to any one of claims 10 to 13; and (b) Detect the presence or absence of GBS bacteria:aptamer complex, or measure the level of said GBS bacteria:aptamer complex; This is to monitor GBS bacterial infection in the subjects.

18. The method according to any one of claims 14 to 17, wherein the subject is a pregnant woman or a newborn.

19. The method according to any one of claims 14 to 18, wherein the GBS bacteria is agalactococcus, or the GBS bacterial infection is at least partially mediated by or associated with agalactococcus.

20. A method for preventing, improving, or treating GBS bacterial infection in a subject, the method comprising administering to the subject a therapeutically effective amount of treatment against the GBS bacterial infection, wherein a biological sample of the subject has been contacted with an aptamer according to any one of claims 1 to 9 or a sensor according to any one of claims 10 to 13, and the presence or level of a GBS bacterial:aptamer complex in the biological sample has been determined.

21. A method for generating a sensor for detecting GBS bacteria, the method comprising the steps of: (a) Provide a base; as well as (b) To couple, bond, attach, or otherwise connect the aptamer according to any one of claims 1 to 9 to the substrate. The sensor is thus generated.

22. The method of claim 21, wherein the sensor is the sensor according to any one of claims 10 to 13.

23. A sensor generated by the method according to claim 21 or claim 22.

24. A kit comprising an aptamer according to any one of claims 1 to 9 or a sensor according to any one of claims 10 to 13, and optionally instructions for use.

25. A test reagent comprising an aptamer according to any one of claims 1 to 9, and optionally one or more acceptable excipients, diluents or carriers.

26. The kit according to claim 24 or the test reagent according to claim 25, used in the method according to any one of claims 14 to 20.

Images