Use of transcription factor znf753 in non-small cell lung cancer

Abstract

The application discloses application of a transcription factor ZNF753 in non-small cell lung cancer and belongs to the field of biological medicine. Specifically, the application relates to application of a substance for inhibiting expression or activity of the transcription factor ZNF753 in preparation of a drug for treating non-small cell lung cancer. The substance for inhibiting expression or activity of the transcription factor ZNF753 can be an shRNA targeting ZNF753. Compared with the prior art, the application provides a new treatment target for non-small cell lung cancer, solves the limitation of traditional treatment of non-small cell lung cancer by targeting downstream kinases, clarifies a molecular mechanism of ZNF753 in promoting development of non-small cell lung cancer, and lays a theoretical foundation for clinical drug development.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to the application of transcription factor ZNF753 in non-small cell lung cancer. Background Technology

[0002] Currently, treatment options for non-small cell lung cancer include surgery, radiotherapy and chemotherapy, targeted therapy and immunotherapy. Among these, targeted therapy is an important treatment for improving the survival and prognosis of patients with intermediate and advanced stages. However, some patients still cannot benefit from targeted therapy, mainly due to insensitivity to the treatment target.

[0003] Previous improvement plans mainly focused on improving the limitations of existing targets and exploring other unknown targets, but they generally suffer from problems such as weak targeting, unclear mechanism analysis, and poor clinical translation.

[0004] Transcription factor ZNF753 is a gene located at position 8q24.3 on human chromosome. This gene encodes a protein belonging to the C2H2 type zinc finger protein family, which typically plays a key role in gene regulation. ZNF753's primary function is focused on regulating gene expression. Members of the zinc finger protein family usually bind to DNA through their zinc finger domains, thereby regulating the transcription of specific genes. ZNF753 may be involved in regulating genes related to cell proliferation, differentiation, and apoptosis, and is essential for normal cellular physiological function.

[0005] Given that existing technologies have revealed that some transcription factors can affect NSCLC by maintaining tumor stemness, the question arises as to how to provide an upstream transcription factor target for non-small cell lung cancer based on a novel pathological mechanism (especially one that can specifically block the classic MAPK oncogenic signaling pathway at its source), thereby offering a new alternative for overcoming the resistance of existing downstream kinase-targeting drugs and effectively inhibiting the direct proliferation and distant metastasis of tumors. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention proposes the application of transcription factor ZNF753 in non-small cell lung cancer.

[0007] The objective of this invention can be achieved through the following technical solutions: A first aspect of the present invention relates to the use of a substance that inhibits the expression or activity of transcription factor ZNF753 in the preparation of a medicament for treating non-small cell lung cancer.

[0008] Optionally, the substance that inhibits the expression or activity of transcription factor ZNF753 includes: shRNA, siRNA, small molecule inhibitors, or monoclonal antibodies targeting ZNF753.

[0009] Optionally, the shRNA is formed by annealing the forward strand SEQ ID No. 7 and the reverse strand SEQ ID No. 8.

[0010] Optionally, the drug further includes a vector for delivering the shRNA.

[0011] Optionally, the vector is a lentivirus.

[0012] A second aspect of the invention relates to a medicament comprising shRNA for inhibiting the expression or activity of transcription factor ZNF753, said shRNA being formed by annealing the forward strand SEQ ID No. 7 and the reverse strand SEQ ID No. 8.

[0013] Optionally, the drug further includes a lentiviral vector for delivering the shRNA.

[0014] A third aspect of the present invention relates to the use of a detection reagent for transcription factor ZNF753 in the preparation of products for the diagnosis or prognostic assessment of non-small cell lung cancer.

[0015] A fourth aspect of the invention relates to a kit for the diagnosis or prognostic assessment of non-small cell lung cancer, the kit comprising a detection reagent capable of specifically recognizing the transcription factor ZNF753.

[0016] A fifth aspect of the present invention relates to a method for in vitro screening of drugs against non-small cell lung cancer, comprising the following steps: Treat cultured non-small cell lung cancer cells with candidate drugs; The expression level of ZNF753 in cells after treatment was detected, and / or the activation level of the MAPK signaling pathway was measured. If the candidate drug can reduce the expression level of ZNF753 and / or inhibit the activation level of the MAPK signaling pathway, it will be selected as a candidate drug for anti-non-small cell lung cancer.

[0017] The beneficial effects of this invention are: (1) To provide new therapeutic targets for the treatment of non-small cell lung cancer; (2) Overcoming the limitations of traditional targeted downstream kinase therapy for non-small cell lung cancer; (3) To elucidate the molecular mechanism by which ZNF753 promotes the development of non-small cell lung cancer, laying a theoretical foundation for clinical drug development; (4) There are many strategies for targeting transcription factors, which have great potential for clinical translation. Attached Figure Description

[0018] The invention will now be further described with reference to the accompanying drawings.

[0019] Figure 1The study aimed to investigate the impact of ZNF753 expression in non-small cell lung cancer (NSCLC) tissues on survival. (A) Survival analysis of ZNF753 in NSCLC was performed based on the TCGA (Cancer Genome Atlas) database. (B) Immunohistochemical results showed the expression of ZNF753 in NSCLC tissues and adjacent normal tissues.

[0020] Figure 2 The diagram illustrates the effects of ZNF753 on the proliferation, migration, and invasion of non-small cell lung cancer (NSCLC). (A) qPCR validates the interference efficiency of ZNF753 in NSCLC H1299 and A549 cells; (B) Western blot validates the interference efficiency of ZNF753 in NSCLC H1299 and A549 cells; (C) CCK8 assay shows that ZNF753 knockdown inhibits the proliferation of NSCLC; and (D) Transwell assay shows that ZNF753 knockdown inhibits the migration and invasion of NSCLC.

[0021] Figure 3 ZNF753 promotes the growth and metastasis of non-small cell lung cancer tumors; (A) Subcutaneous tumor formation and tumor anatomy in mice in the control group and ZNF753 knockdown group; (B) Tumor volume growth curves in mice in the control group and ZNF753 knockdown group; (C) Weight statistics of tumors in mice in the control group and ZNF753 knockdown group; (D) Tumor anatomy in mice in the control group and ZNF753 knockdown group; (E) Statistics on the number of lung tumors in mice in the control group and ZNF753 knockdown group.

[0022] Figure 4 ZNF753 activates the MAPK signaling pathway in non-small cell lung cancer; (A) differential gene volcano plot; (B) schematic diagram of KEGG signaling pathway enrichment analysis results; (C) Western blot results of stable knockdown of ZNF753 (ZNF753sh) and non-targeted control (NonT sh) in H1299 and PC9 cell lines; (D) Western blot results of stable overexpression of ZNF753 (ZNF753) and empty vector control (Control) in H1299 and PC9 cell lines. Detailed Implementation

[0023] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0024] Nucleotide sequence information involved in this application: ZNF753: NCBI Gene ID: 286128.

[0025] Explanation of cell sources involved in the examples: The cells used in the following embodiments of this application were all purchased from Wuhan Pronosai Life Science Technology Co., Ltd. H1299: Item No.: CL-0165; A549: Item No.: CL-0016; PC9: Item No.: CL-0668; LLC-1: Product No.: CL-0140.

[0026] Example 1: Expression of ZNF753 in non-small cell lung cancer tissues (all clinical trial samples in this example were from the Pathology Department of the North Campus of the First Affiliated Hospital of Anhui Medical University, belonging to research paraffin blocks, and authorized by the clinical trial ethics committees of the university and hospital, totaling 13 cases) and its correlation with patient survival. This embodiment involves immunohistochemistry, including the following steps: (1) Dewaxing paraffin sections to water washing: The tissue sections were placed in environmentally friendly dewaxing solution I for 20 min; environmentally friendly dewaxing solution II for 20 min; anhydrous ethanol I for 5 min; anhydrous ethanol II for 5 min; 95% ethanol for 5 min; 85% ethanol for 5 min; 75% ethanol for 5 min; 50% ethanol for 5 min; pure water for 5 min; PBS-TritonX-100 for 5 min.

[0027] (2) Antigen retrieval: Place the slides in pH 6.0 sodium citrate retrieval solution for antigen retrieval (microwave heating first at P100 for 5 min, then cooling and heating again at P80 for 5 min, repeating this process 4 times). Pay special attention to prevent excessive evaporation of the buffer solution during this process. After natural cooling, place the slides in PBS-Triton X-100 and wash them three times on a decolorizing shaker for 5 min each time.

[0028] (3) Use an immunohistochemistry pen to draw circles on the outside of the tissue, then add endogenous peroxidase blocking solution to the histological circle and incubate at 37°C for 10 min; wash 3 times with PBS-TritonX-100 for 5 min each time.

[0029] (4) Serum blocking: Add 5% BSA-PBS to the histochemistry zone and cover the tissue evenly. Block at room temperature for 45 minutes.

[0030] (5) Add primary antibody: Gently shake off the blocking solution, add the primary antibody prepared with 1% BSA-PBS solution to the slide, place the slide flat in a humidified box and incubate overnight at 4°C; the next day, place the slide in PBS-Triton X-100 and wash it three times on a decolorizing shaker for 5 minutes each time.

[0031] (6) Add secondary antibody: After slightly drying the sections, add 1% BSA-PBS solution of the same species as the primary antibody (HRP-labeled) to the inner circle to cover the tissue, and incubate at room temperature for 1.5 h. Place the sections in PBS-Triton X-100 and wash them three times on a decolorizing shaker for 5 min each time.

[0032] (7) DAB staining: After the section is slightly dried, add freshly prepared DAB staining solution to the circle (add 20 μL of DAB stock solution to every 1 mL of diluent). Control the staining time under the microscope. When the color of the positive part is brownish-yellow, rinse the section with tap water to stop the staining.

[0033] (8) Counterstaining cell nuclei: Add hematoxylin staining solution to the slides one by one for 3 min, rinse with tap water to stop staining; differentiate with hydrochloric acid ethanol differentiation solution for 10 s, rinse with tap water to stop; hematoxylin blue solution for 3 s, rinse with tap water to stop.

[0034] (9) Dehydration and mounting: Place the sections in 50% ethanol for 5 min; 75% ethanol for 5 min; 85% ethanol for 5 min in sequence; Dehydrate and clear the sections in 95% ethanol for 5 minutes; anhydrous ethanol for 5 minutes; anhydrous ethanol for 5 minutes; and environmentally friendly dewaxing solution for 20 minutes. Remove the sections and allow them to air dry slightly. Mount them with neutral resin. Microscopic examination: Interpret the results under a white light microscope.

[0035] like Figure 1 A in and Figure 1 As shown in Figure B, immunohistochemical (IHC) staining results indicated that ZNF753 protein was significantly overexpressed in tumor tissues of non-small cell lung cancer (NSCLC) patients compared to normal adjacent normal tissues. Further survival analysis curves from the TCGA database showed that NSCLC patients in the high ZNF753 expression group had significantly shorter overall survival (OS) than those in the low expression group.

[0036] ZNF753 is abnormally highly expressed in NSCLC and is closely associated with poor patient prognosis, making it an independent biomarker for the diagnosis and prognostic assessment of NSCLC.

[0037] Example 2: Lentiviral interference with ZNF753 expression to verify its promotion of proliferation, migration, and invasion in non-small cell lung cancer. I. Construction of knockdown plasmids 1. Enzyme digestion and recovery of vector (1) PLKO.1 was used as the original vector (this plasmid is resistant to puromycin and can be used for subsequent screening of stable cell lines). AgeI and EcoRI restriction endonucleases were used to digest the plasmid to form a linearized plasmid.

[0038] (2) Double enzyme digestion and gel recovery of plasmid vectors 1) Prepare the double enzyme digestion reaction system according to the table below into a 50 μL PCR tube, gently pipette to mix, and then centrifuge briefly.

[0039] Table 1. Double enzyme digestion reaction system 2) Place the PCR tube in the PCR instrument and react at 37°C for 1 hour, followed by reaction at 85°C for 20 minutes to inactivate the restriction endonuclease.

[0040] 3) Separate the enzyme digestion products by 1% agarose gel electrophoresis, and observe the target bands under a UV gel imaging system using DNA marker as the molecular weight standard.

[0041] 4) After confirming the band size is correct, cut the target band and recover the linearized pLKO.1 vector using a gel extraction kit. The specific steps are as follows: ① Weigh the agarose gel block containing the target band that was cut off, add the sol solution according to the ratio, and incubate in a water bath at about 50-60℃ for 5-10 minutes, gently mixing during the process until the gel is completely dissolved.

[0042] ② Transfer all the dissolved gel solution to the adsorption column, centrifuge at 12,000 rpm at room temperature for 1 minute to allow the DNA to bind to the column membrane, and then discard the waste liquid.

[0043] ③ Add washing solution to clean the adsorption column, centrifuge at 12000 rpm for 1 minute, and discard the waste liquid; repeat this washing step once to thoroughly wash away impurities.

[0044] ④ Centrifuge the empty adsorption column at 12,000 rpm for 2 minutes to remove any residual ethanol and avoid ethanol affecting subsequent enzymatic experiments.

[0045] ⑤ Transfer the adsorption column to a new sterile centrifuge tube, add elution buffer to the middle of the column membrane, and let stand at room temperature for 2 minutes to allow the DNA to dissolve completely.

[0046] ⑥ Centrifuge at 12000 rpm at room temperature for 2 minutes, collect the liquid at the bottom of the tube, which is the purified linearized pLKO.1 vector, and use Nanodrop to measure the concentration and mass of the linearized vector.

[0047] 2. Design shRNA sequences specifically targeting ZNF753. 1) Genetic information for ZNF753 was searched from the NCBI GEO website, and shRNA sequences were designed using the BroadInstitute (https: / / www.broadinstitute.org / ), an online shRNA design website. The designed shRNA sequences are as follows: Table 2 shRNA sequences After designing the primers, I ordered them from Qingke Biotechnology Company.

[0048] 2) shRNA annealing Configure the shRNA annealing system according to the following system (the actual primer concentration is 100 μM, please convert proportionally). Table 3 shRNA annealing system The reaction system was placed in a PCR instrument and annealed according to the following procedure: 95℃ for 5 min → 70℃ for 10 min → 37℃ for 30 min → 4℃ for storage, to form double-stranded shRNA fragments. The annealed products were stored at -20℃ for later use.

[0049] 3. Enzyme-linked reaction 1) Add the double-stranded shRNA and linearized pLKO.1 vector and other components to a 200 μL PCR tube according to the table below: add 50 ng of linearized pLKO.1 vector, 5 μL of annealing product, 2 μL of 10× T4 DNA ligase buffer, 1 μL of T4 DNA ligase, and make up to 20 μL with nuclease-free water.

[0050] Table 4 Enzyme ligation reaction system 2) Gently aspirate and mix well, then centrifuge briefly and incubate overnight (12-16 hours) at 16°C in a PCR instrument.

[0051] 3) Thaw DH5a competent cells on ice, add 10 μL of ligation product to 50 μL of competent cells, incubate on ice for 30 minutes, then heat shock in a 42°C water bath for 90 seconds, and quickly transfer to ice to cool for 2 minutes.

[0052] 4) Add 1 mL of antibiotic-free LB medium and shake at 37°C and 200 rpm for 1 hour to revive the bacteria.

[0053] 5) Spread 100 μL of bacterial culture onto an LB agar plate containing ampicillin (100 μg / mL) and incubate upside down at 37°C for 16 hours.

[0054] 6) Select a single colony and send it to a sequencing company for Sanger sequencing using U6-F (SEQ ID No. 10: 5'-GAGGGCCTATTTCCCATGATT-3') as primers. The sequencing results match the aforementioned sequence, and the plasmid was successfully constructed.

[0055] 4. Plasmid extraction and sequencing verification 1) Take the above sequencing sample bacterial culture and inoculate it into 20 ml of LB liquid medium containing ampicillin (100 μg / mL), and incubate at 37℃ and 200 rpm for 12-16 hours.

[0056] 2) Centrifuge at 4000 for 10 minutes to collect the bacterial precipitate and discard the supernatant.

[0057] 3) Extract recombinant plasmids using a plasmid extraction kit. The specific steps are as follows: ① Add the bacterial resuspension solution from the kit to the bacterial pellet, and pipette until the bacterial cells are completely resuspended and there are no obvious bacterial clumps.

[0058] ② Add the lysis buffer from the kit, and gently invert the centrifuge tube 4-6 times until the solution becomes clear (the lysis time should be controlled within 5 minutes to avoid genomic DNA contamination).

[0059] ③ Add the neutralizing solution from the kit, and immediately gently invert the centrifuge tube 6-8 times until a white flocculent precipitate appears. Let it stand in an ice bath for 5 minutes.

[0060] ④ Centrifuge at 12000 rpm at room temperature for 10 minutes, and carefully transfer the supernatant to the adsorption column provided with the kit, avoiding aspiration of precipitate.

[0061] ⑤ Add reagent wash buffer 1 to the adsorption column, centrifuge at 12000 rpm for 1 minute, and discard the waste liquid.

[0062] ⑥ Add the reagent wash buffer 2 to the adsorption column, centrifuge at 12,000 rpm for 1 minute, discard the waste liquid; repeat the washing once.

[0063] ⑦ Centrifuge the empty adsorption column at 12000 rpm for 2 minutes to completely remove residual ethanol from the adsorption column and prevent ethanol from affecting subsequent experiments.

[0064] ⑧ Transfer the adsorption column to a new sterile centrifuge tube, add nuclease-free water to the center of the adsorption column membrane, and let it stand at room temperature for 2-3 minutes.

[0065] ⑨ Centrifuge at 12000 rpm at room temperature for 2 minutes to elute the plasmid DNA on the adsorption column. Collect the eluent in the centrifuge tube; this is the recombinant plasmid. Determine the concentration and purity of the recombinant plasmid (an A260 / A280 ratio of 1.8-2.0 is considered acceptable).

[0066] II. Lentiviral Packaging and Cell Infection 1. Lentiviral packaging (1) The plasmids used in this embodiment include PLKO.1-SHC and PLKO.1-hZNF753sh. On the first day, 293T cells in good condition, with fewer passages and good adhesion were selected and passaged at a ratio of 1:3.

[0067] (2) Day 2: When the cell density reaches 70-90%, transfect the plasmid. The proportions of each packaging system are as follows: 6-well plate: pLKO.1-SHC: 2μg, p8.9: 2μg, VSVG: 1μg; 10 cm dish: pLKO.1-SHC: 5 μg, p8.9: 5 μg, VSVG: 2 μg; 15 cm dish: pLKO.1-SHC: 15 μg, p8.9: 15 μg, VSVG: 7.5 μg; Linear PEI: plasmid ratio is 3:1.

[0068] 6-well plate: PLKO.1-hZNF753sh: 2μg, p8.9: 2μg, VSVG: 1μg; 10 cm dish: PLKO.1-hZNF753sh: 5 μg, p8.9: 5 μg, VSVG: 2 μg; 15 cm dish: PLKO.1-hZNF753sh: 15 μg, p8.9: 15 μg, VSVG7.5: μg; Linear PEI: plasmid ratio is 3:1.

[0069] (3) Prepare two EP tubes, labeled A and B respectively. Add Opti-MEM (200 μL for a 6-well plate, 400 μL for a 10cm plate, and 800 μL for a 15cm plate) to tube A, add linear PEI according to the plasmid amount, and gently mix with a pipette to prevent air bubbles from forming. After mixing, let it stand at room temperature for 5 min. Add Opti-MEM (200 μL for a 6-well plate, 400 μL for a 10cm plate, and 800 μL for a 15cm plate) to tube B, then add plasmid according to the proportion, and gently mix with a pipette. Add the mixture from tube B to tube A, mix with a pipette, and let it stand at room temperature for 15 min. After standing, gently and evenly drop the mixture into the culture dish.

[0070] (4) Replace with fresh complete culture medium 16-18 hours after transfection; (5) Collect the supernatant virus 24 hours after replacing the complete culture medium and add fresh complete culture medium; collect the supernatant virus again 24 hours later. Mix the two viruses thoroughly, filter using a 0.45μm filter and aliquot the virus. Quick-freeze the aliquoted virus in liquid nitrogen and store at -80℃ for long-term storage.

[0071] 2. Lentiviral infection of cells (1) Select H1299 and A549 cells in good condition and with a density of more than 80% and passage them at a ratio of 1:3.

[0072] (2) When the cells adhere to the wall and the density reaches 30-40%, discard part of the culture medium in proportion and add virus to infect the cells; at the same time, add polybrene in proportion.

[0073] (3) 8-12 hours after infection with the virus, discard the upper layer of virus solution and replace it with a complete culture medium containing puromycin at a final concentration of 2 μg / mL to screen cells.

[0074] (4) After 48 hours of puromycin screening, cells were collected for subsequent experiments.

[0075] III. RT-qPCR Experiment 1. Total RNA extraction from cells RNA extraction was performed using an RNA extraction kit, and the specific steps are as follows: (1) Prepare the sample. After the cells grow to 3x106, digest the cells and collect the cell suspension into a 1.5mL centrifuge tube. Centrifuge at 15000xg for 5s. After centrifugation, discard the supernatant culture medium, wash the cell pellet once with PBS, centrifuge again and discard the supernatant, leaving the cell pellet for subsequent experiments.

[0076] (2) Add 500 μL of LysisBuffer to the collected sample tube, immediately pipette and mix until there are no cell clumps, and let stand for 1 min.

[0077] (3) Add the liquid from the previous step to the adsorption column RA (place the adsorption column in the collection tube), let it stand for 2 minutes, then centrifuge at 12000 rpm for 30 seconds and discard the filtrate.

[0078] (4) Add 500 μL Washing Buffer D2 to the adsorption column (make sure anhydrous ethanol has been added), let stand for 2-5 minutes, then centrifuge at 12000 rpm for 30 seconds and discard the filtrate if possible.

[0079] (5) Repeat step (4).

[0080] (6) Place the adsorption column RA back into the empty collection tube, centrifuge at 12000 rpm for 2 min, and remove as much of the washing liquid as possible to avoid the residual ethanol in the washing liquid inhibiting the downstream reaction.

[0081] (7) Take out the adsorption column RA and put it into a clean 1.5mL RNaseFree centrifuge tube. Add 25μL of RNaseFreeH2O preheated at 65℃ to the middle of the adsorption membrane. Be careful not to puncture the bottom adsorption membrane when adding the liquid. Let it stand at room temperature for 1min, centrifuge at 10000rpm (9,600xg) for 1min. Repeat the elution once to increase the yield and measure the cell RNA concentration.

[0082] 2. RNA is reverse transcribed into cDNA Take a 200 μL PCR tube and add the sample and reagents according to the following system: Add 500 ng of template RNA to the PCR tube, add 2 μL of All-in-One First-Strand Synthesis Master Mix reagent, add 0.5 μL of dsDNase reagent, and bring the total volume to 10 μL with Nuclease-free Water. Perform reverse transcription according to the reverse transcription program in the table below. After the reaction is complete, add 90 μL of dd H2O to dilute it 10-fold. The extracted total RNA must be within the usable range (OD260 / 280: 1.8-2.1, OD260 / 230: 1.8-2.1) before reverse transcription can be performed.

[0083] The role of temperature and time in reverse transcription programs: Remove genomic DNA contamination at 37℃ for 5 minutes; 55℃, 15min; The reaction was terminated at 85℃ for 5 minutes. Store at 4℃ for extended periods, then allow to cool to -20℃.

[0084] The RT-qPCR reaction system is shown in the table below: Table 5 RT-qPCR reaction system IV. Western blot experiment The ZNF753 antibody used in this embodiment was prepared by Hangzhou Huaan Biotechnology Co., Ltd. as a polyclonal antibody. Project number: TP40578; amino acid sequence (SEQ ID No. 9): DRKPPERPTVPRKPC; animal number: RB4825 / RB4826.

[0085] 1. Extract total protein This experiment was conducted entirely on ice to avoid protein inactivation. Cells were collected at 90% confluence in 6-well plates, washed with pre-chilled PBS at 4°C, and centrifuged at 15000xg for 5 seconds. A lysis mixture was prepared by mixing RIPA lysis buffer and protease inhibitor at a ratio of 100:1, adding 50-100 μL of the mixture, vortexing, and allowing to stand for 10 minutes. This process was repeated three times. After lysis, the cells were sonicated. After lysis, the cells were centrifuged at 15000xg for 25 minutes at 4°C, and the supernatant was collected. The protein concentration of the cell samples was quantified using a BCA protein quantification kit. After quantification, dd H2O and 5 x SDS loading buffer were added in proportion, the sample was mixed, and then boiled in a metal bath at 95°C for 7 minutes. The samples were then stored at -20°C for subsequent experiments.

[0086] 2. Western Blot Experiment (1) Preparation of SDS-PAGE gel; (A) Take two clean glass plates, clean them with ultrapure water, let them dry, and fix them on the plastic frame.

[0087] (B) Prepare an appropriate concentration of SDS-PAGE gel according to the size of the protein band to be measured. After adding the lower separating gel, press the gel with isopropanol and let it stand at room temperature for 20-30 minutes. After the lower separating gel solidifies, use a three-folded paper to absorb the upper isopropanol.

[0088] (C) After the isopropanol is removed, add the upper layer of stacking gel, use the matching comb to remove air bubbles and then quickly insert the comb. Let it stand at room temperature for 20-30 minutes for subsequent experiments.

[0089] (2) Sample loading and electrophoresis (A) Dilute the 10x electrophoresis buffer to 1x electrophoresis buffer, take out the prepared protein sample and the protein marker required for the experiment from the -20 ℃ box, let it stand in the 95℃ metal bath for 7 min and then centrifuge. Pour the 1x electrophoresis buffer between the gel plates and add the samples in the order of the experimental design. Mix the samples before each addition.

[0090] (B) After the sample is loaded, add enough electrophoresis solution to the electrophoresis tank, connect the power supply according to the positive and negative terminals, first keep the voltage at 80V, wait for the protein sample to run to the separating gel, then adjust the voltage to 120V, wait for the protein sample to run to the bottom of the gel, and stop electrophoresis.

[0091] (3) Transfer membrane (A) Prepare 1x transfer buffer according to the formula of 100 mL of 10x transfer buffer, 200 mL of methanol solution and 700 mL of ultrapure water.

[0092] (B) Activate the PVDF membrane with methanol for 5 min, rinse off the hydrophobic membrane on the surface, and set aside.

[0093] (C) Immerse the transfer clamp in the transfer buffer solution with the anode on top and the cathode on the bottom. From top to bottom, the order is: non-woven fiber pad, filter paper, gel, PVDF membrane, filter paper, non-woven fiber pad. Be careful to avoid air bubbles and fix the transfer clamp in place.

[0094] (D) Place the transfer clamp into the transfer tank according to the corresponding electrode, add the transfer solution, turn on the power, and place on ice for 250mA constant current transfer for 2h.

[0095] (4) Closed After the transfer is complete, remove the PVDF membrane, with the side in contact with the gel as the front. Cut off a corner of the mark and place it in 10% skim milk. Seal at room temperature for at least 4 hours.

[0096] (5) Antibody incubation and color development (A) Preparation of primary and secondary antibodies: Prepare the antibody to the appropriate concentration according to the antibody instructions.

[0097] (B) Remove the PVDF membrane from the skim milk, wash twice with TBST to remove residual milk, cut the membrane at the appropriate position according to the required protein and protein marker, place it in the corresponding primary antibody, and incubate overnight at 4°C on a shaker for at least 8 hours.

[0098] (C) After incubation, the primary antibody is recovered and washed with an appropriate amount of TBST solution on a shaker for 10 min, and washed 3 times.

[0099] (D) After cleaning, add a secondary antibody that is homologous to the primary antibody and incubate at room temperature on a shaker for 2 hours.

[0100] (E) After recovering the secondary antibody, wash it with an appropriate amount of TBST solution on a shaker for 10 minutes, repeating the washing 3 times.

[0101] (F) Exposure and color development after washing film V. CCK8 Experiment (1) Add the virus-infected cells required for the experiment. After the drug screening is completed, the density grows to 70-90%. Digest the cells and make a cell suspension.

[0102] (2) Take the cell suspension for counting. After counting, use 100 μL of liquid per well to contain 2000 cells, 3 replicates, and measure for a total of 5 days (i.e., the cell count of 15 wells). Calculate the required cell suspension and culture medium, mix well, and seed 100 μL of cell suspension per well into a 96-well plate.

[0103] (3) Prepare the mixture by mixing CCK-8 reagent and culture medium at a ratio of 1:10. After mixing, remove the culture medium from the wells to be tested that day, then add 100 μL of the mixture per well and incubate in a cell culture incubator for 1.5 h.

[0104] (4) Use an ELISA reader and select a wavelength of 450 nm to measure each well; (5) Measure at the same time every day. On the third day after measurement, add 50 μL of complete culture medium to the unmeasured wells to prevent cell death or deformation, which could affect the experimental results. (6) Record the data every day, and analyze the cell proliferation based on the measurement data of 5 days after the measurement is completed.

[0105] VI. Transwell Experiment (1) Add the virus required for the experiment to infect the cells, and wait until the density reaches 70-90% after the drug screening is completed. (2) Add 100 μL of diluted matrix gel to the Transwell chamber and place it in an incubator.

[0106] (3) Digest the cells and add serum-free culture medium to prepare a cell suspension. Take the cell suspension for counting, and take 4 x 10 cells per well. 4 One cell was used to prepare a 200 μL cell suspension.

[0107] (4) Add 200 μL of cell suspension to the upper side of the Transwell chamber and 500 μL of serum-containing complete culture medium to the lower side. Remove the air bubbles at the bottom of the chamber and incubate in a cell culture incubator for 14 h.

[0108] (5) Remove the Transwell chamber, discard the culture medium in the well, add pre-cooled methanol at -20℃ to the bottom of the chamber and fix at 4℃ for 30 min.

[0109] (6) Discard the methanol at the bottom, add 1 mL of crystal violet staining solution and stain for 25 min; after staining, wash twice with 1 mL of PBS, and gently wipe away the unmigrated cells on the inside with a cotton swab moistened with PBS. (7) Take pictures and count five random fields of view under a microscope.

[0110] like Figure 2 As shown in A and B, after transfection of a ZNF753-targeting shRNA lentivirus into NSCLC cell lines (H1299 and A549), qPCR and Western blot confirmed that ZNF753 expression was successfully knocked down. Figure 2 As shown in Figure C, the CCK-8 cell proliferation curves indicate that, compared to the control group (NonT sh), the ZNF753 knockdown group (ZNF753 sh) showed significantly inhibited cell proliferation rates from days 1 to 5. Figure 2 As shown in D, the Transwell migration and invasion assay results showed a significant reduction in the number of cells that crossed the matrix gel and entered the lower chamber.

[0111] In summary, targeting and inhibiting ZNF753 expression can significantly weaken the malignant biological behaviors of non-small cell lung cancer cells, such as proliferation, migration, and invasion, in vitro.

[0112] Example 3: Validation of ZNF753 promoting non-small cell lung cancer tumors in mice The mouse shRNA sequence information used in this embodiment is as follows: mZNF753-sh1 (SEQ ID No.1)>F:CCGGGCCTTCGATGCCTCGTTTAAACTCGAGTTTAAACGAGGCATCGAAGGCTTTTTG; (SEQ ID No. 2)>R: AATTCAAAAAGCCTTCGATGCCTCGTTTAAAACTCGAGTTTAAACGAGGCATCGAAGGC.

[0113] mZNF753-sh2 (SEQ ID No.3)>F: CCGGCTTGGTTCTAACCTTCTAAACTCGAGTTTAGAAGGTTAGAACCACAGTTTTTG; (SEQ ID No. 4)>R: AATTCAAAAACTGTGGTTTCTAACCTTCTAAACTCGAGTTTAGAAGGTTAGAACCACAG.

[0114] I. Lentiviral Packaging and Cell Infection 1. Lentiviral packaging (1) The plasmids used in this embodiment include PLKO.1-SHC and PLKO.1-hZNF753sh, PLKO.1-mZNF753-sh1, and PLKO.1-mZNF753-sh2. On the first day, 293T cells in good condition, with fewer passages and good adhesion were selected and passaged at a ratio of 1:3.

[0115] (2) Day 2: When the cell density reaches 70-90%, transfect the plasmid. The proportions of each packaging system are as follows (taking PLKO.1-SHC as an example): 6-well plate: pLKO.1-SHC: 2μg, p8.9: 2μg, VSVG: 1μg; 10 cm dish: pLKO.1-SHC: 5 μg, p8.9: 5 μg, VSVG: 2 μg; 15 cm dish: pLKO.1-SHC: 15 μg, p8.9: 15 μg, VSVG: 7.5 μg; Linear PEI: plasmid ratio is 3:1.

[0116] (3) Prepare two EP tubes, labeled A and B respectively. Add Opti-MEM (200 μL for a 6-well plate, 400 μL for a 10cm plate, and 800 μL for a 15cm plate) to tube A, add linear PEI according to the plasmid amount, and gently mix with a pipette to prevent air bubbles from forming. After mixing, let it stand at room temperature for 5 min. Add Opti-MEM (200 μL for a 6-well plate, 400 μL for a 10cm plate, and 800 μL for a 15cm plate) to tube B, then add plasmid according to the proportion, and gently mix with a pipette. Add the mixture from tube B to tube A, mix with a pipette, and let it stand at room temperature for 15 min. After standing, gently and evenly drop the mixture into the culture dish.

[0117] (4) Replace with fresh complete culture medium 16-18 hours after transfection; (5) Collect the supernatant virus 24 hours after replacing the complete culture medium and add fresh complete culture medium; collect the supernatant virus again 24 hours later. Mix the two viruses thoroughly, filter using a 0.45μm filter and aliquot the virus. Quick-freeze the aliquoted virus in liquid nitrogen and store at -80℃ for long-term storage.

[0118] 2. Lentiviral infection of cells (1) Select LLC-1 and A549 cells in good condition and with a density of more than 80% and passage them at a ratio of 1:3.

[0119] (2) When the cells adhere to the wall and the density reaches 30-40%, discard part of the culture medium in proportion and add virus to infect the cells; at the same time, add polybrene in proportion.

[0120] (3) 8-12 hours after infection with the virus, discard the upper layer of virus solution and replace it with a complete culture medium containing puromycin at a final concentration of 2 μg / mL to screen cells.

[0121] (4) After 48 hours of puromycin screening, cells were collected for subsequent experiments.

[0122] II. Establishment of a mouse tumor-bearing model Four-week-old female Balb / c nude mice were purchased and acclimatized in an SPF mouse room for 5-7 days before model construction. A549 cells were digested and counted, and the solution was adjusted to a volume of 1 x 10⁻⁶ cells per 100 μL. 6 Each mouse was injected with 200 μL of cell suspension. The animals were sterilized with ultraviolet light in a clean bench beforehand, and the inoculation was performed subcutaneously. Tumor size was then measured using calipers, and the volume was recorded and calculated every 3 days. After approximately one month, the mice were dissected, and the tumor weight was measured using an analytical balance.

[0123] III. Establishing a mouse migration model After purchasing 5-week-old female C57BL / 6 mice, they were acclimatized in the mouse house for 5-7 days before model construction.

[0124] LLC cells were digested and counted, and the volume was adjusted to 2.5 x 10^6 cells per 100 μL solution. 6 Each mouse was injected with 150 μL of cell suspension. The injection was performed via tail vein in a clean bench. After injection, the mice were observed for 10 minutes. If no abnormal reaction was observed, the mice were returned to their cages. Twenty days later, the mice were dissected to observe lung metastasis. The number and size of nodules were recorded after taking photographs.

[0125] like Figure 3 As shown, this embodiment uses the two different animal models described above for cross-validation: In a subcutaneous tumor-bearing model: Human non-small cell lung cancer cells with stable ZNF753 knockdown (A549-shZNF753) and control cells were subcutaneously seeded in Balb / c nude mice. Tumor growth curves and final tumor weighing results showed that, compared with the control group, the tumor volume growth in the ZNF753 knockdown group was extremely slow, and the average tumor weight was significantly reduced.

[0126] In a tail vein injection lung metastasis model: Lewis lung cancer cells with knocked-down ZNF753 expression (LLC-shZNF753) and control cells were injected into C57BL / 6 mice via the tail vein. After a period of feeding, the lung tissue of the mice was dissected and stained with hematoxylin and eosin (HE). Statistical results showed that the number of metastatic nodules formed in the lungs of the ZNF753 knockdown group was sharply reduced compared with the control group.

[0127] Please see Figure 3 The images of mice with subcutaneous tumors and macroscopic images of ex vivo tumors in the A group show that, compared with the NonT sh control group, the subcutaneous tumor volume of mice in the ZNF753 sh group was significantly reduced. The visible difference in ex vivo tumors directly confirms the inhibitory effect of ZNF753 knockdown on solid tumor growth.

[0128] In addition, the tumor volume growth curve ( Figure 3 (B) shows that the difference in tumor volume between the two groups continued to widen over time, and by day 31, the tumor volume in the ZNF753 sh group was significantly lower than that in the NonT sh control group ( (p<0.0001), indicating that knockdown of ZNF753 can sustainably and significantly inhibit tumor proliferation and growth in vivo. The experimental endpoint was the weighing of ex vivo tumor cells. Figure 3 The results (C) showed that the average tumor weight in the ZNF753 sh group was significantly lower than that in the NonT sh group. (p<0.001), further quantitatively confirming the inhibitory effect of ZNF753 knockdown on tumor growth from a weight dimension.

[0129] Gross anatomical photographs of the lungs in a tail vein injection lung transfer model. Figure 3 The results (D) showed that a large number of obvious white metastatic nodules were visible on the lung surface of the NonT sh control group, while the number of nodules on the lung tissue surface of the two knockdown groups ZNF753 sh1 and ZNF753 sh2 was significantly reduced, and the lung morphology was close to normal.

[0130] Please refer to Figure 3 The E-cell lung metastasis statistics table showed that all 5 mice in the NonT sh group developed lung metastases (5 / 5), and each mouse had a relatively large number of metastatic nodules in the lungs (1, 3, 1, 1, 4). In the ZNF753 sh1 and sh2 groups, 5 / 5 mice also developed metastases, but the number of nodules in each mouse was extremely small or even reduced to 0 (sh1: 1, 0, 0, 0, 1; sh2: 0, 0, 0, 0, 0). This indicates that although knocking down ZNF753 did not completely block the occurrence of metastasis, it could reduce the number of metastatic nodules in the lungs to a level close to zero, and the inhibitory effect on the ability to metastasize to distant sites was extremely significant.

[0131] The above experimental results demonstrate that, at the in vivo animal level, targeting and inhibiting ZNF753 can effectively suppress the growth of solid tumors and distant (lung) metastasis in non-small cell lung cancer, making ZNF753 a highly promising drug intervention target.

[0132] Example 4: Validation of ZNF753 activation of the MAPK signaling pathway in non-small cell lung cancer I. Transcriptome Sequencing 1. Cell collection and RNA extraction H1299 shZNF753 cells were harvested, and after removing the culture medium, washed twice with pre-cooled PBS buffer. Total RNA was extracted using an RNA extraction kit (Novizan RC112-01). The concentration and purity of the extracted RNA were assessed using Nanodrop 2000, RNA integrity was detected by agarose gel electrophoresis, and RIN values ​​were determined using an Agilent 5300. For a single library preparation, the required total RNA amount was 1 μg, concentration ≥30 ng / μL, RQN >6.5, and OD260 / 280 between 1.8 and 2.2.

[0133] 2. Enrichment and purification of mRNA Eukaryotic mRNAs have a polyA tail at their 3' end. Using magnetic beads with Oligo(dT) nucleotides to pair with the polyA tail, mRNA can be isolated from total RNA for transcriptome analysis. The Illumina platform is designed for sequencing short fragments, and the enriched mRNA is a complete RNA sequence with an average length of several kb. Therefore, it needs to be randomly fragmented. A fragmentation buffer is added to randomly break the mRNA into small fragments of approximately 300 bp.

[0134] 3. Library Construction Using fragmented mRNA as a template, first-strand cDNA was synthesized via reverse transcription using random primers; subsequently, DNA Polymerase I and RNase H were added to synthesize second-strand cDNA. The double-stranded cDNA had sticky ends, which were padded to blunt ends with EndRepairMix, followed by the addition of an A base at the 3' end for Y-shaped adapter ligation. The ligation product was purified and fragment sorted, and the sorted product was used for PCR amplification, followed by purification to obtain the final library.

[0135] 4. Library quality control and sequencing The library concentration was quantified using Qubit (≥2 ng / μL) and then sequenced.

[0136] 5. Sequencing data processing The sequencing results were analyzed, and volcano diagrams and KEGG signaling pathway diagrams were drawn based on the number of upregulated and downregulated genes.

[0137] II. Construction of Overexpression Plasmids 1. Enzyme digestion and recovery of vector (1) Using pLVX as the original vector (this plasmid is resistant to puromycin and can be used for subsequent screening of stable cell lines), BamH1 and EcoRI restriction endonucleases were selected for digestion to form linearized plasmids.

[0138] (2) Double enzyme digestion and gel recovery of plasmid vectors.

[0139] 1) Prepare the double enzyme digestion reaction system according to the table below into a 50 μL PCR tube, gently pipette to mix, and then centrifuge briefly.

[0140] Table 6. Double enzyme digestion reaction system 2) Place the PCR tube in the PCR instrument and react at 37°C for 1 hour, followed by reaction at 85°C for 20 minutes to inactivate the restriction endonuclease.

[0141] 3) Separate the enzyme digestion products by 1% agarose gel electrophoresis, and observe the target bands under a UV gel imaging system using DNA marker as the molecular weight standard.

[0142] 4) After confirming the band size is correct, cut the target band and recover the linearized pLVX vector using a gel extraction kit. The specific steps are as follows: ① Weigh the agarose gel block containing the target band that was cut off, add the sol solution according to the ratio, and incubate in a water bath at about 50-60℃ for 5-10 minutes, gently mixing during the process until the gel is completely dissolved.

[0143] ② Transfer all the dissolved gel solution to the adsorption column, centrifuge at 12,000 rpm at room temperature for 1 minute to allow the DNA to bind to the column membrane, and then discard the waste liquid.

[0144] ③ Add washing solution to clean the adsorption column, centrifuge at 12000 rpm for 1 minute, and discard the waste liquid; repeat this washing step once to thoroughly wash away impurities.

[0145] ④ Centrifuge the empty adsorption column at 12,000 rpm for 2 minutes to remove any residual ethanol and avoid ethanol affecting subsequent enzymatic experiments.

[0146] ⑤ Transfer the adsorption column to a new sterile centrifuge tube, add elution buffer to the middle of the column membrane, and let it stand at room temperature for 2 minutes to allow the DNA to dissolve completely.

[0147] ⑥ Centrifuge at 12000 rpm at room temperature for 2 minutes, collect the liquid at the bottom of the tube (the purified linearized pLVX vector), and use Nanodrop to measure the concentration and mass of the linearized vector.

[0148] 2. Design the CDS sequence for ZNF753. 1) Search for the CDS information of the ZNF753 gene on the NCBI GEO website, as follows: number NM_001271156.3. Insert the CDS sequence into the pLVX vector using SnapGene software and generate primers (with BamH1 and EcoRI as restriction sites). Order the primers from Qingke Biotechnology Co., Ltd. according to the primer sequence.

[0149] 2) PCR amplification was performed using the Phanta Max Super-Fidelity DNA Polymerase kit (catalog number: P505) to obtain the CDS sequence of gene ZNF753.

[0150] 3. Homologous recombination 1) The enzyme digestion vector and CDS fragment were re-ligated using the Novizan ClonExpress II One Step Cloning Kit (catalog number: C112). 10 μL of the product was added to 50 μL of competent cells, incubated on ice for 30 minutes, then heat-shocked in a 42°C water bath for 90 seconds, and then quickly transferred to ice to cool for 2 minutes.

[0151] 4) Add 1 mL of antibiotic-free LB medium and shake at 37°C and 200 rpm for 1 hour to revive the bacteria.

[0152] 5) Spread 100 μL of bacterial culture onto an LB agar plate containing ampicillin (100 μg / mL) and incubate upside down at 37°C for 16 hours.

[0153] 6) Single colonies were selected and sent to a sequencing company for Sanger sequencing using cmv (SEQ ID No. 11: 5'-CACGCTGTTTTGACCTCCATAGA-3') as primers. The sequencing results matched the CDS sequence of ZNF753, indicating successful plasmid construction.

[0154] 4. Plasmid extraction and sequencing verification 1) Take the above sequencing sample bacterial culture and inoculate it into 20 ml of LB liquid medium containing ampicillin (100 μg / mL), and incubate at 37℃ and 200 rpm for 12-16 hours.

[0155] 2) Centrifuge at 4000 for 10 minutes to collect the bacterial precipitate and discard the supernatant.

[0156] 3) Extract recombinant plasmids using a plasmid extraction kit. The specific steps are as follows: ① Add the bacterial resuspension solution from the kit to the bacterial pellet, and pipette until the bacterial cells are completely resuspended and there are no obvious bacterial clumps.

[0157] ② Add the lysis buffer from the kit, and gently invert the centrifuge tube 4-6 times until the solution becomes clear (the lysis time should be controlled within 5 minutes to avoid genomic DNA contamination).

[0158] ③ Add the neutralizing solution from the kit, and immediately gently invert the centrifuge tube 6-8 times until a white flocculent precipitate appears. Let it stand in an ice bath for 5 minutes.

[0159] ④ Centrifuge at 12000 rpm at room temperature for 10 minutes, and carefully transfer the supernatant to the adsorption column provided with the kit, avoiding aspiration of precipitate.

[0160] ⑤ Add reagent wash buffer 1 to the adsorption column, centrifuge at 12000 rpm for 1 minute, and discard the waste liquid.

[0161] ⑥ Add the reagent wash buffer 2 to the adsorption column, centrifuge at 12,000 rpm for 1 minute, discard the waste liquid; repeat the washing once.

[0162] ⑦ Centrifuge the empty adsorption column at 12000 rpm for 2 minutes to completely remove residual ethanol from the adsorption column and prevent ethanol from affecting subsequent experiments.

[0163] ⑧ Transfer the adsorption column to a new sterile centrifuge tube, add nuclease-free water to the center of the adsorption column membrane, and let it stand at room temperature for 2-3 minutes.

[0164] ⑨ Centrifuge at 12000 rpm at room temperature for 2 minutes to elute the plasmid DNA on the adsorption column. Collect the eluent in the centrifuge tube; this is the recombinant plasmid. Determine the concentration and purity of the recombinant plasmid (an A260 / A280 ratio of 1.8-2.0 is considered acceptable).

[0165] III. Lentiviral Packaging and Cell Infection 1. Lentiviral packaging (1) The plasmids used in this embodiment include PLKO.1-SHC, PLKO.1-hZNF753sh (hZNF753sh is the same as hZNF753 used in Example 2), PLVX, and PLVX-ZNF753. On the first day, 293T cells in good condition, with fewer passages and good adhesion were selected and passaged at a ratio of 1:3.

[0166] (2) Day 2: When the cell density reaches 70-90%, transfect the plasmid. The proportions of each packaging system are as follows (taking PLKO.1-SHC as an example): 6-well plate: pLKO.1-SHC: 2μg, p8.9: 2μg, VSVG: 1μg; 10 cm dish: pLKO.1-SHC: 5 μg, p8.9: 5 μg, VSVG: 2 μg; 15 cm dish: pLKO.1-SHC: 15 μg, p8.9: 15 μg, VSVG: 7.5 μg; Linear PEI: plasmid ratio is 3:1.

[0167] (3) Prepare two EP tubes, labeled A and B respectively. Add Opti-MEM (200 μL for a 6-well plate, 400 μL for a 10cm plate, and 800 μL for a 15cm plate) to tube A, add linear PEI according to the plasmid amount, and gently mix with a pipette to prevent air bubbles. After mixing, let it stand at room temperature for 5 min. Add Opti-MEM (200 μL for a 6-well plate, 400 μL for a 10cm plate, and 800 μL for a 15cm plate) to tube B, then add plasmid according to the proportion, and gently mix with a pipette. Add the mixture from tube B to tube A, mix with a pipette, and let it stand at room temperature for 15 min. After standing, gently and evenly drop the mixture into the culture dish.

[0168] (4) Replace with fresh complete culture medium 16-18 hours after transfection; (5) Collect the supernatant virus 24 hours after replacing the complete culture medium and add fresh complete culture medium; collect the supernatant virus again 24 hours later. Mix the two viruses thoroughly, filter using a 0.45μm filter and aliquot the virus. Quick-freeze the aliquoted virus in liquid nitrogen and store at -80℃ for long-term storage.

[0169] 2. Lentiviral infection of cells (1) Select H1299 and PC9 cells in good condition and with a density of more than 80% and passage them at a ratio of 1:3.

[0170] (2) When the cells adhere to the wall and the density reaches 30-40%, discard part of the culture medium in proportion and add virus to infect the cells; at the same time, add polybrene in proportion.

[0171] (3) 8-12 hours after infection with the virus, discard the upper layer of virus solution and replace it with a complete culture medium containing puromycin at a final concentration of 2 μg / mL to screen cells.

[0172] (4) After 48 hours of puromycin screening, cells were collected for subsequent experiments.

[0173] IV. Western blot experiment 1. Extract total protein This experiment was conducted entirely on ice to avoid protein inactivation. Cells were collected at 90% confluence in 6-well plates, washed with pre-chilled PBS at 4°C, and centrifuged at 15000xg for 5 seconds. A lysis mixture was prepared by mixing RIPA lysis buffer and protease inhibitor at a ratio of 100:1, adding 50-100 μL of the mixture, vortexing, and allowing to stand for 10 minutes. This process was repeated three times. After lysis, the cells were sonicated. After lysis, the cells were centrifuged at 15000xg for 25 minutes at 4°C, and the supernatant was collected. The protein concentration of the cell samples was quantified using a BCA protein quantification kit. After quantification, dd H2O and 5 x SDS loading buffer were added in proportion, the sample was mixed, and then boiled in a metal bath at 95°C for 7 minutes. The samples were then stored at -20°C for subsequent experiments.

[0174] 2. Western Blot Experiment (1) Preparation of SDS-PAGE gel; (A) Take two clean glass plates, clean them with ultrapure water, let them dry, and fix them on the plastic frame.

[0175] (B) Prepare an appropriate concentration of SDS-PAGE gel according to the size of the protein band to be measured. After adding the lower separating gel, press the gel with isopropanol and let it stand at room temperature for 20-30 minutes. After the lower separating gel solidifies, use a three-folded paper to absorb the upper isopropanol.

[0176] (C) After the isopropanol is removed, add the upper layer of stacking gel, use the matching comb to remove air bubbles and then quickly insert the comb. Let it stand at room temperature for 20-30 minutes for subsequent experiments.

[0177] (2) Sample loading and electrophoresis (A) Dilute the 10x electrophoresis buffer to 1x electrophoresis buffer, take out the prepared protein sample and the protein marker required for the experiment from the -20 ℃ box, let it stand in the 95℃ metal bath for 7 min and then centrifuge. Pour the 1x electrophoresis buffer between the gel plates and add the samples in the order of the experimental design. Mix the samples before each addition.

[0178] (B) After the sample is loaded, add enough electrophoresis solution to the electrophoresis tank, connect the power supply according to the positive and negative terminals, first keep the voltage at 80V, wait for the protein sample to run to the separating gel, then adjust the voltage to 120V, wait for the protein sample to run to the bottom of the gel, and stop electrophoresis.

[0179] (3) Transfer membrane (A) Prepare 1x transfer buffer according to the formula of 100 mL of 10x transfer buffer, 200 mL of methanol solution and 700 mL of ultrapure water.

[0180] (B) Activate the PVDF membrane with methanol for 5 min, rinse off the hydrophobic membrane on the surface, and set aside.

[0181] (C) Immerse the transfer clamp in the transfer buffer solution with the anode on top and the cathode on the bottom. From top to bottom, the order is: non-woven fiber pad, filter paper, gel, PVDF membrane, filter paper, non-woven fiber pad. Be careful to avoid air bubbles and fix the transfer clamp in place.

[0182] (D) Place the transfer clamp into the transfer tank according to the corresponding electrode, add the transfer solution, turn on the power, and place on ice for 250mA constant current transfer for 2h.

[0183] (4) Closed After the transfer is complete, remove the PVDF membrane, with the side in contact with the gel as the front. Cut off a corner of the mark and place it in 10% skim milk. Seal at room temperature for at least 4 hours.

[0184] (5) Antibody incubation and color development (A) Preparation of primary and secondary antibodies: Prepare the antibody to the appropriate concentration according to the antibody instructions.

[0185] (B) Remove the PVDF membrane from the skim milk, wash twice with TBST to remove residual milk, cut the membrane at the appropriate position according to the required protein and protein marker, place it in the corresponding primary antibody, and incubate overnight at 4°C on a shaker for at least 8 hours.

[0186] (C) After incubation, the primary antibody is recovered and washed with an appropriate amount of TBST solution on a shaker for 10 min, and washed 3 times.

[0187] (D) After cleaning, add a secondary antibody that is homologous to the primary antibody and incubate at room temperature on a shaker for 2 hours.

[0188] (E) After recovering the secondary antibody, wash it with an appropriate amount of TBST solution on a shaker for 10 minutes, repeating the washing process 3 times.

[0189] (F) Expose and develop color after washing.

[0190] Please refer to the experimental results. Figure 4 .

[0191] in, Figure 4 In A, after transcriptome sequencing of H1299 ZNF753 sh cells and the NonT sh control group, the results showed that |log2FC|>1 and -log 10 Using a p-value significance threshold as the screening criterion, a total of 154 significantly upregulated genes and 113 significantly downregulated genes were identified. The number and distribution of differentially expressed genes indicate that ZNF753 has a broad regulatory effect on gene transcription in NSCLC cells, and its knockdown can induce large-scale changes in the expression of downstream genes.

[0192] Figure 4Figure B provides the KEGG signaling pathway enrichment analysis results, presented as a bubble chart. Bubble size represents the number of enriched genes, and color intensity represents the FDR value (darker colors indicate higher enrichment significance). Among all enriched signaling pathways, the MAPK signaling pathway showed a high degree of enrichment (rich value approximately 0.08, with a high number of enriched genes and a relatively low FDR value), ranking high in significance among all enriched pathways. These results suggest at the transcriptome level that the main downstream regulatory targets of ZNF753 are concentrated in genes related to the MAPK signaling pathway, and that ZNF753 knockdown can lead to an overall downregulation of the MAPK pathway gene population.

[0193] Figure 4 The C in the figure provides knockdown verification Western blot results. Compared with the NonT sh control group, after ZNF753 knockdown, the protein phosphorylation levels of p-ERK1 / 2, p-p38 and p-JNK in H1299 and PC9 cells were significantly reduced, while the GAPDH internal control showed no significant change. This indicates that ZNF753 has a positive regulatory effect on the activation of the three branches of the MAPK pathway, namely ERK, p38 and JNK, and is not limited to a single branch.

[0194] Figure 4 The D in the paper provides overexpression validation Western blot results. After overexpression of ZNF753, the phosphorylation levels of p-ERK1 / 2, p-p38 and p-JNK in both cell lines were significantly increased compared with the control group, while the expression of GAPDH internal reference was stable. From the perspective of functional gain, it is proved that the increase in ZNF753 expression level can directly drive the full activation of the three branches of the MAPK signaling pathway.

[0195] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0196] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.

Claims

1. Application of substances that inhibit the expression or activity of transcription factor ZNF753 in the preparation of drugs for the treatment of non-small cell lung cancer; The substance that inhibits the expression or activity of transcription factor ZNF753 is an shRNA that can target ZNF753. The shRNA is formed by annealing the forward strand SEQ ID No. 7 and the reverse strand SEQ ID No.

8.

2. The use of the substance that inhibits the expression or activity of transcription factor ZNF753 according to claim 1 in the preparation of a medicament for treating non-small cell lung cancer, characterized in that, The drug also includes a vector for delivering the shRNA.

3. The use of the substance that inhibits the expression or activity of transcription factor ZNF753 according to claim 2 in the preparation of a medicament for treating non-small cell lung cancer, characterized in that, The vector is a lentivirus.

4. A drug, characterized in that, Includes shRNA for inhibiting the expression or activity of transcription factor ZNF753, said shRNA being formed by annealing the forward strand SEQ ID No. 7 and the reverse strand SEQ ID No.

8.

5. The drug according to claim 4, characterized in that, The drug also includes a lentiviral vector for delivering the shRNA.

Images