Recombinant engineering bacteria with thlA gene knockout and industrial gas domestication and application thereof

Abstract

The application discloses a recombinant engineering bacterium with ThlA gene knockout and industrial gas source domestication and application thereof. The recombinant engineering bacterium is Clostridium autoethanogenum engineering bacterium with the preservation number of GDMCC No: 67962. The application optimizes carbon flow distribution of the C. autoethanogenum from the metabolic pathway level by using the CRISPR / Cas9 gene editing technology to knock out the acetyl coenzyme A acetyltransferase coding gene ThlA (gene number: CLAU_0409), and reduces by-product generation. On this basis, the gene edited strain is further subjected to laboratory directional domestication to strengthen the tolerance and adaptability of the strain to the complex environment of steel industry tail gas, and finally the growth rate, ethanol selectivity and ethanol yield of the strain are simultaneously improved, thereby providing core strain support for industrialization landing of resource utilization of the steel industry tail gas.

Description

Technical Field

[0001] This invention relates to the field of microbial genetic engineering technology, specifically to a recombinant engineered bacterium that has undergone Th1A gene knockout and industrial gas source domestication, and its application. Background Technology

[0002] As global warming becomes increasingly prominent, frequent extreme weather events pose severe challenges to the ecological environment and human societal development. Controlling greenhouse gas emissions and promoting energy structure transformation have become a global consensus. Against this backdrop, my country has proposed a dual-carbon strategy of peaking carbon emissions and achieving carbon neutrality. This strategy aims to reduce the dependence of socio-economic development on fossil fuels through a series of policies and technological means, thereby achieving effective greenhouse gas emission reduction and contributing to global climate governance.

[0003] Carbon capture, utilization and storage (CCUS) technology, as one of the key negative carbon technologies for addressing climate change, can capture, convert and utilize greenhouse gases during the use of fossil energy. It is widely regarded as one of the core technology paths for deep decarbonization in the industrial sector and occupies an important position in the implementation of the dual-carbon strategy.

[0004] my country is the world's largest steel producer. As a pillar industry of the national economy, the steel industry generates substantial amounts of industrial waste gas during its production processes (including sintering, ironmaking, and steelmaking). This waste gas contains not only greenhouse gases such as carbon dioxide (CO2) but also combustible components like carbon monoxide (CO) and hydrogen (H2), possessing significant potential for resource utilization. However, the current treatment and utilization of industrial waste gas in my country's steel industry still faces significant shortcomings: on the one hand, the emissions are large and concentrated, and direct emissions would not only exacerbate the greenhouse effect but also lead to energy waste; on the other hand, traditional treatment methods mainly rely on simple emissions or inefficient combustion, lacking large-scale, high-value-added resource utilization technologies, making it difficult to meet the urgent needs of the industry's green transformation.

[0005] As a key industry characterized by high energy consumption and high emissions, the green and low-carbon transformation of the steel industry is a crucial link in my country's dual-carbon strategy. Therefore, research and development of efficient capture, separation, and resource utilization technologies for industrial waste gas from the steel industry, turning waste into treasure, can not only reduce greenhouse gas emission intensity and alleviate environmental pressure, but also improve energy efficiency and create economic value. This has significant practical and strategic value for promoting the sustainable development of the steel industry and facilitating the implementation of the dual-carbon strategy.

[0006] Currently, industrial waste gas bio-fermentation technology is mainly divided into two categories: chemical methods and bio-fermentation methods. Chemical methods require multi-step catalytic reactions under high temperature and pressure conditions to achieve conversion, which not only suffers from high catalyst costs, low product selectivity, and difficulties in separation and purification, but also presents challenges. In the exploration of technologies for the resource utilization of waste gas in the steel industry, bio-fermentation methods have become a highly promising technological direction due to their advantages such as mild reaction conditions, fewer byproducts, and strong environmental compatibility. Its core is to utilize specific microorganisms to convert components such as CO, CO2, and H2 in the waste gas into high-value-added chemicals such as ethanol and methanol, achieving closed-loop utilization and value enhancement of carbon elements. Bio-fermentation can directly complete the conversion through microbial metabolism. In particular, anaerobic microorganisms relying on the Wood-Ljungdahl metabolic pathway (such as Clostridium autoethanogenum and Clostridium ljungdahlii) have been proven to produce ethanol from syngas or industrial waste gas, becoming a research hotspot. Shougang Langze has already commercialized C. autoethanogenum, converting industrial waste gas into ethanol and microbial protein.

[0007] However, current industrial waste gas bio-fermentation technology still faces many bottlenecks, severely restricting its industrial application: First, existing strains mostly rely on natural isolation or traditional mutagenesis screening, which are poorly adapted to the complex operating conditions of steel industry waste gas. Trace amounts of sulfur compounds, dust, and fluctuating CO / H2 ratios in the waste gas can easily lead to growth inhibition, decreased metabolic activity, and even interruption of fermentation. Second, fermentation efficiency is low. Existing research is mostly at the laboratory stage. Even with optimization of fermentation conditions such as pH and metal ion concentration, ethanol yield and productivity still cannot meet industrial requirements and cannot match the high-efficiency demands of industrial production. Third, there are very few industrial application cases. Currently, only Shougang Langze has formed a mature industrial application technology system. In addition, traditional strain improvement methods (such as natural screening and chemical mutagenesis) have drawbacks such as long cycles, random mutation sites, and low positive mutation rates, making it difficult to accurately optimize the key performance of strains and fundamentally solve the above-mentioned technical problems.

[0008] There is an inherent contradiction between the precision of gene editing at specific points and the integrity of the cellular metabolic network. Edited cells often require readaptation due to metabolic imbalances. Therefore, when designing gene editing protocols, we should not only focus on the target site itself, but also consider the resilience and robustness of the metabolic network at the system level. Summary of the Invention

[0009] Therefore, embodiments of the present invention provide a recombinant engineered bacterium that has undergone Th1A gene knockout and industrial gas source domestication, and its application.

[0010] To achieve the above objectives, the embodiments of the present invention provide the following technical solutions:

[0011] According to a first aspect of the present invention, the present invention provides a recombinant engineered bacterium, which is Clostridium ethanolae, deposited on March 16, 2026 at the Guangdong Provincial Microbial Culture Collection Center with accession number GDMCCNo: 67962 and classified as Clostridium autoethanogenum.

[0012] According to a second aspect of the present invention, the present invention provides a method for constructing recombinant engineered bacteria as described above, the method comprising:

[0013] Knocking out the ThlA gene in wild-type Clostridium ethanolae yielded recombinant strain △thla;

[0014] The recombinant strain Δthla was domesticated using a combination of carbon source switching and continuous subculturing.

[0015] Furthermore, the wild-type Clostridium ethanolae is a self-produced Clostridium ethanolae DSM10061;

[0016] The nucleotide sequence of the ThlA gene is shown in SEQ ID No. 1.

[0017] Furthermore, the domestication method includes:

[0018] The recombinant strain Δthla was cultured in YTF medium containing fructose until the logarithmic growth phase, then transferred to an anaerobic bottle containing fresh medium. The bottle was sealed and anaerobic acclimatization culture was initiated by introducing a simulated industrial gas source containing CO. The culture was continued until the strain reached the OD (Organic Growth Rate). 600 When the value is ≥1.0, the culture medium is transferred again to fresh medium and the above anaerobic acclimatization culture process is repeated. The culture is continued until the growth lag phase of the strain no longer shortens, and the acclimatized strain is obtained.

[0019] Furthermore, the volume composition of the CO-containing simulated industrial gas source is: 45%~55% CO, 15%~25% N2, and 25%~35% CO2;

[0020] The concentration of fructose is 5-10 g / L;

[0021] The anaerobic acclimatization culture conditions are as follows: inoculum size 5-20% (v / v), internal pressure 0.1-0.2 MPa, culture temperature 37℃, rotation speed 120-150 rpm, gas replacement every 16-36 hours, to maintain stable internal pressure and sufficient carbon source.

[0022] Further, the composition of the YTF culture medium is as follows: NH4Cl 0.25g / L, KCl 0.1g / L, MgSO4·7H2O 0.2g / L, CaCl2·2H2O 0.02g / L, FeSO4·7H2O 0.05g / L, yeast extract 10g / L, tryptone 16g / L, fructose 10g / L, NaCl 0.2g / L, trace element solution 10mL / L, Wolf vitamin solution 10mL / L, and resazurite 0.5mL / L;

[0023] The gaseous fermentation medium consists of the following components: NH4Cl 0.25 g / L, KCl 0.1 g / L, MgSO4·7H2O 0.2 g / L, CaCl2·2H2O 0.02 g / L, FeSO4·7H2O 0.05 g / L, trace element solution 10 mL / L, and Wolf vitamin solution 10 mL / L.

[0024] According to a third aspect of the present invention, the present invention provides the application of the recombinant engineered bacteria described above in the preparation of ethanol using CO-containing industrial waste gas as a carbon source.

[0025] This invention utilizes CRISPR / Cas9 gene editing technology to selectively knock out the ThlA gene (gene number: CLAU_0409) encoding acetyl-CoA acetyltransferase, optimizing carbon flux allocation in C. autoethanogenum at the metabolic pathway level and reducing byproduct generation. Furthermore, the gene-edited strain undergoes targeted laboratory domestication to enhance its tolerance and adaptability to the complex environment of steel industry exhaust gases. Ultimately, this results in a simultaneous increase in the strain's growth rate, ethanol selectivity, and ethanol yield, providing core strain support for the industrial-scale utilization of steel industry exhaust gases.

[0026] This invention utilizes CRISPR / Cas9 targeted knockout of the ThlA gene combined with directed domestication of industrial gas sources as its core technical solution. Addressing the technical bottlenecks of existing industrial waste gas fermentation strains (such as wild-type and single-gene modified strains of C. autoethanogenum), including low CO utilization efficiency, poor growth adaptability, low ethanol selectivity, and insufficient industrialization performance, this invention achieves a technological breakthrough through the synergistic effect of metabolic pathway reconstruction and enhanced industrial environment adaptability. Its specific beneficial effects are as follows:

[0027] 1. Break through the bottleneck of CO carbon source utilization and significantly improve the carbon resource conversion efficiency of industrial exhaust gas.

[0028] In existing technologies, wild-type strains have limited ability to utilize CO, a carbon source in industrial exhaust gases, resulting in generally low carbon source conversion rates and significant CO loss due to ineffective utilization. This invention reduces carbon flow losses in branched metabolisms such as acetic acid synthesis by knocking out the ThlA gene (CLAU_0409). Simultaneously, through targeted domestication with industrial gas sources, the resulting domesticated strain SGLT_Ca138 directs more carbon sources to the target product by reducing branched metabolic losses. It also achieves faster growth and production rates because domestication enhances the strain's physiological adaptability to industrial gas sources. Furthermore, it enables CO to become the dominant carbon source, meaning the modified strain can utilize CO more efficiently, reducing dependence on other organic carbon sources and thus improving the economic viability of industrial exhaust gas resource recovery. This improvement not only reduces carbon waste in the industrial exhaust gas resource recovery process but also aligns with the core requirements of industrial carbon sequestration and emission reduction under the dual-carbon strategy, providing an efficient technological path for the low-carbon treatment of industrial exhaust gases.

[0029] 2. Eliminate carbon source switching inhibition to achieve synergistic optimization of strain growth and product synthesis.

[0030] Existing strains, after switching from fructose to CO carbon source, generally exhibit a growth lag period of over 15 days and insufficient biomass accumulation (the original strain's biomass after 30 days was only 3.99 g / L), making it difficult to meet the demands of continuous industrial production. This invention employs a synergistic strategy of optimizing metabolic supply through gene editing and targeted domestication to adapt to the carbon source environment. This shortens the growth lag period of the domesticated strain to within 3 days, achieving a final biomass of 5.92 g / L after 30 days (a 48.4% increase compared to the original strain and a 31.3% increase compared to the recombinant strain); simultaneously, the ethanol concentration reaches 27.02 g / L (a 118.3% increase compared to the original strain and an 89.2% increase compared to the recombinant strain). This achieves synergistic high yield in cell growth and target product synthesis, solving the problem of growth-yield antagonism in traditional technologies and laying the foundation for high-intensity industrial production.

[0031] 3. Enhance ethanol selectivity and increase the economic value of industrial waste gas resource utilization.

[0032] In existing technologies, wild-type strains exhibit metabolic selectivity biased towards byproducts such as acetic acid (the original strain's ethanol / acetic acid yield ratio is only 1.46), resulting in low ethanol yield and insufficient returns. Genetically modified strains show limited selectivity improvement (the recombinant strain's ethanol / acetic acid yield ratio is 2.87). This invention, by knocking out the Th1A gene to inhibit the acetic acid synthesis pathway and combining this with domestication to solidify the metabolic flow, increases the ethanol / acetic acid yield ratio of the domesticated strain to 4.96, while controlling the acetic acid concentration at a low level of 5.45 g / L (a 35.5% reduction compared to the original strain). As a high-value-added chemical, the increased yield of ethanol significantly improves the economic benefits of industrial waste gas resource utilization, breaking through the industrialization bottleneck of high costs and low returns inherent in existing technologies.

[0033] 4. Improve adaptability to industrial environments and ensure the stability of large-scale production.

[0034] Existing laboratory-modified strains often exhibit performance degradation (such as growth stagnation and decreased yield) after being scaled up to industrial systems due to insufficient environmental adaptability, making stable production difficult. The domesticated strain of this invention, after 35 generations of continuous subculturing with industrial gas sources, has fully adapted to the complex operating conditions of steel industry exhaust gas (45%~55% CO, 25%~35% CO2, 15%~25% N2), and its growth and product synthesis are stable during a 30-day long-term fermentation in a 3L fermenter.

[0035] 5. The technical solution has strong applicability and broad application value.

[0036] The "targeted gene editing + industrial environment-oriented domestication" combined strategy adopted in this invention is not only applicable to the improvement of C. autoethanogenum, but can also be extended to the performance optimization of other gas fermentation strains (such as C. ljungdahlii, C. carboxidivorans, etc.). At the same time, its adapted industrial exhaust gas resource utilization process can be extended to the treatment of CO-containing waste gas in many fields such as steel and coal chemical industry, which has broad prospects for technology promotion and application, and is of great significance to promoting the technological upgrading of the industrial exhaust gas resource utilization industry. Attached Figure Description

[0037] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other embodiments based on the provided drawings without creative effort.

[0038] Figure 1 The metabolic pathway reconstruction design targeting the Th1A gene provided by this invention;

[0039] Figure 2 Growth and metabolic curves of the wild-type strain DSM1006 provided by this invention in a 3L fermenter;

[0040] Figure 3 Growth and metabolic curves of the recombinant strain SGLT_Ca063 provided by this invention in a 3L fermenter;

[0041] Figure 4 Growth and metabolic curves of the domesticated strain SGLT_Ca001 provided for this invention in a 3L fermenter

[0042] Figure 5 The growth and metabolic curves of the domesticated strain SGLT_Ca138 provided by this invention in a 3L fermenter. Detailed Implementation

[0043] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0044] Example 1: Design of Metabolic Pathway Reconstruction Targeting the ThlA Gene

[0045] like Figure 1 As shown, acetyl-CoA acetyltransferase Th1A (labeled as CLAU_0409 in some Clostridium species) is a key enzyme in Clostridium involved in fatty acid metabolism and solvation. Th1A catalyzes the condensation of two molecules of acetyl-CoA to acetoacetyl-CoA, releasing CoA. The reaction is: 2 acetyl-CoA = CoA + acetoacetyl-CoA.

[0046] The nucleotide sequence encoding Th1A is as follows:

[0047]

[0048] Example 2: Construction of gene knockout tool plasmids for the CRISPR / Cas9 editing system

[0049] This study achieved gene knockout of acetyl-CoA acetyltransferase ThlA (CLAU_0409) using CRISPR / Cas9 technology.

[0050] The plasmids required for this experiment were constructed based on the pRECas1 plasmid. To achieve THLA gene knockout using CRISPR / Cas9 technology, the sgRNA module and homologous arm module need to be inserted into the SalI / AatII and AatII / AscI sites of the pRECas1 plasmid, respectively.

[0051] 2.1 Design of guide RNA targeting the THLA gene

[0052] Design of guide RNA targeting the THLA gene using the website http: / / grna.ctegd.uga.edu / :

[0053] THLA_gRNA1:aaattagctgagggacaaca (SEQ ID No. 2);

[0054] THLA_gRNA2:gaaatgatgagggttgtcag (SEQ ID No. 3).

[0055] 2.2 Construction of sgRNA plasmid

[0056] THLA_gRNA1 primer synthesis:

[0057] LN-0048.THLA_gRNA1-F: CGACTT aaattagctgagggacaaca (SEQ ID No. 4);

[0058] LN-0049.THLA_gRNA1-R:AAAC tgttgtccctcagctaattt AA (SEQ ID No. 5).

[0059] THLA_gRNA2 primer synthesis:

[0060] LN-0050.THLA_gRNA2-F: CGACTT gaaatgatgagggttgtcag (SEQ ID No. 6);

[0061] LN-0051.THLA_gRNA2-R:AAACctgacaaccctcatcatttcAA (SEQ ID No. 7).

[0062] gRNA primer annealing:

[0063] A. Dilute primers LN-0048 ~ LN-0051 to 100 μM with ddH2O;

[0064] B. Mix 5 μl of LN-0048 and LN-0049, mix LN-0050 and LN-0051, and PCR anneal to form double-stranded guide RNA with sticky ends;

[0065] The C.SGLT_P00010001 vector plasmid was digested with BsaI and the linear vector backbone of 2759 bp was recovered.

[0066] D. T4 connection

[0067] Ligate at 22℃ for 1 h, then take 10 μL of the ligation product to transform E. coli.

[0068] E. Colonic transformation

[0069] Take 10 μL of the ligation product into 50 μL of Top10 competent cells, heat shock at 42℃ for 1 min, incubate in LB medium for 1 h, and then spread on LB+Kan solid plates.

[0070] F. Transformer Validation

[0071] The plates that produced transformants after transformation were photographed and analyzed using a Tianneng chemiluminescence / fluorescence image analysis system in green fluorescence mode. Transformants without fluorescence were considered correct clones. Correct clones were selected and streaked onto LB+Kan solid plates for enrichment. Subsequently, 5 mL of LB+Kan liquid medium containing the enriched products of correct clones was inoculated and cultured overnight. The culture was then preserved as glycerol culture before plasmid extraction and sequencing.

[0072] 2.3 Construction of homologous arm plasmids

[0073] To ensure the correctness of the homologous arm sequences, the homologous arm sequences were first stored in the pEASY Blunt Zero vector for sequencing verification before being cloned into the pRECas1 plasmid. In this experiment, homologous arms of 500 bp in length were selected for knockout experiments.

[0074] The primers for PCR amplification of the 500 bp THLA homologous arm are:

[0075] LN-0058.THLA_HL_500bp-F (AatII):

[0076] GACGTCatatagttgcatctagaatatattcagaattattaggatattacag (SEQ ID No. 8);

[0077] LN-0059.THLA_HL_500bp-R:

[0078] ccatagctacttcgcgcatcttttatatccc (SEQ ID No. 9);

[0079] LN-0060.THLA_HR_500bp-F:

[0080] gatgcgcgaagtagctatggatgaaaaaatgtacgcttacaaatg (SEQ ID No. 10);

[0081] LN-0061.THLA_HR_500bp-R (AscI):

[0082] GGCGCGCCctttcaaatttttaggctttatatactgaaaatcttgc (SEQ ID No. 11).

[0083] After obtaining the aforementioned left and right homologous arms through PCR cloning, the left and right homologous arms were ligated using OE-PCR as templates. The corresponding products were cloned into the pEASY Blunt Zero vector, transformed into E. coli Top10, and screened on LB+Kan plates. Transformants were verified by colony PCR.

[0084] For colony PCR verification of the correct strain, inoculate with LB+Kan, culture overnight, preserve the glycerol culture, extract plasmids and send for testing.

[0085] 2.4 Construction of pRECas1 series THLA gene knockout plasmids

[0086] The pRECas1 plasmid was digested with SalI / AscI and then collected in a gel. The digestion product fragment size was 8823 bp.

[0087] The sgRNA plasmid was digested with SalI / AatII and collected by gel electrophoresis. The 155 bp sgRNA expression module fragment was recovered, and its nucleotide sequence is as follows:

[0088] TCGACTTAAATTAGCTGAGGGACAACAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTATAAAAATAAGAAGCCTGCATTTGCAGGCTTCTTATTTTTATGACGT (SEQ ID No. 12).

[0089] The homologous arm plasmid was digested with AatII / AscI and then gel-collected to obtain a 3956 bp pEASY Blunt Zero vector backbone fragment and a 1000 bp homologous arm fusion fragment. The nucleotide sequences are as follows:

[0090] CGTCCAGCTAATTTATCAGCTTTATGTCTTTCCCATAATGCCCTAGTTAATACATACGTTGGTACGCCGCCTAATTCGTGCCATGTTTCTGGTCTTGATTCTAATTCATATTCAATCATCCATCTTTAAATCCATTTGGACTTTCTGCCACTATCCAAACTTCTTTCTTGCTTTAAGATATCAAGATGGTATTCCATTTTAGCTG CAAATAACTGTGCTCCTATTCTAAGTCCTTGTCTTAATGTCATAGTATGATAAGACATTCCAACCTTATCATTAACAGTACGACCATTAACAATTCCTACTATAACTCCATCTATAGTTCCAATTAAGCAATATTCATCCTTAACTCTATATCTGTAATATCCTAATAATTCTGAATATATTCTAGATGCAACTATATGACG (SEQ ID No.13).

[0091] The pRECas1 plasmid, which was double-digested with SalI / AscI, was ligated with the digested sgRNA expression module and homologous arm module using T4 enzyme and then transformed into E. coli Top10. The plating was then plated on LB agar plates (with 25 ug / mL chloramphenicol added) for screening.

[0092] Transformants that were correctly verified by colony PCR were inoculated with bacteria, cultured overnight, and then temporarily stored as glycerol bacteria. Plasmids were extracted and sent for sequencing to verify the correctness of the restriction enzyme sites at the interface. The sequencing primers were LN-0021 and LN-0022. Strains that were correctly verified by sequencing were inoculated with bacteria, cultured overnight, and then stored as glycerol bacteria according to their bacterial storage numbers SGLT_Ec00010032 and SGLT_Ec00010034, respectively. Simultaneously, plasmids were extracted according to their plasmid numbers SGLT_P00010025 and SGLT_P00010027.

[0093] It should be noted that the 2759 bp, 3956 bp, and 8823 bp fragments mentioned above are all existing commercial / conventional CRISPR vector backbone sequences. This invention does not involve the modification or protection of their backbone sequences, therefore the full-length nucleotide sequences are not disclosed.

[0094] Example 3: Construction of donor strain

[0095] 3.1 Preparation of sExpress colonic chemorecompetent cells

[0096] (1) Pick a single colony of Escherichia coli sExpress cultured on LB solid plate and inoculate it into 5 ml of LB liquid medium (containing 50 mg / L kanamycin) and culture at 37°C with shaking for 14 h;

[0097] (2) Add 2 mL of bacterial culture to 100 mL of LB (containing 50 mg / L kanamycin) liquid medium and culture for about 2-3 hours; measure OD. 600 Value, when OD 600 Stop culturing when the viscosity reaches approximately 0.4-0.5.

[0098] (3) Place the bacterial culture in an ice bath for 10 min, and transfer it to a pre-cooled 50 ml sterile centrifuge tube under aseptic conditions. Centrifuge at 4℃ and 3500 rpm for 5 min.

[0099] (4) Discard the supernatant, add 8 ml of pre-cooled sterile CaCl2 (0.1 mol / L) solution to an ice bath, gently shake to suspend the cells, and incubate on ice for 5 min;

[0100] (5) Centrifuge at 3500 rpm for 5 min at 4℃;

[0101] (6) Discard the supernatant, resuspend the cells in 1.4 ml of pre-cooled sterile CaCl2 (0.1 mol / L) solution, add 600 μL of 50% glycerol, mix well, and dispense 100 μL / part into pre-cooled sterile Ep tubes. Store at -80℃ for later use.

[0102] 3.2 sExpress colonic conversion

[0103] The correct pRECas1 series plasmids SGLT_P00010025 and SGLT_P00010027 were constructed and chemically transformed into sExpress competent cells, and screened on LB solid plates containing kanamycin and chloramphenicol.

[0104] Transformants that were verified to be correct by colony PCR were inoculated into LB broth (containing kanamycin and chloramphenicol) and cultured overnight to preserve the glycerol bacteria.

[0105] Example 4: Conjugation Transfer and CRISPR / Cas9 Gene Knockout

[0106] 4.1 Bonding Transfer

[0107] (1) Self-produced Clostridium ethanolii DSM10061 was purchased from the German Microbiology and Cell Preservation Center (Leibniz Institute DSMZ) and inoculated into YTF medium for 72 h to the late exponential growth phase. Then it was transferred to 5 mL of fresh YTF medium and incubated for 16-20 h until OD. 600 Reaching 0.1~0.2;

[0108] (2) The donor strain sExpress carrying the shuttle plasmid was inoculated into LB medium and incubated for 14-16 h; 4 hours before conjugation, the sExpress strain was transferred to fresh LB medium.

[0109] (3) Collect 1 mL of sExpress strain culture into a 1.5 mL centrifuge tube, centrifuge at 3000 g for 3 min, and discard the supernatant; then add 500 μl of PBS buffer, mix gently, centrifuge for 3 min, and discard the supernatant; transfer the bacterial cells to an anaerobic operating chamber;

[0110] (4) Add 200 μL of Clostridium ethanole recipient strain culture to the Escherichia coli cells collected by centrifugation, mix the cells gently, spread the mixture of the two cells on non-resistant YTF anaerobic solid plates, and anaerobic culture at 37°C for 20 h.

[0111] (5) Take 500 μL of PBS buffer and spread it evenly on the surface of the plate from which the conjugation transformant has grown. Use a spreader to mix the colonies and liquid on the plate. Use a pipette to transfer the mixture to a YTF solid medium plate containing thiamphenicol and D-cycloserine for screening Clostridium ethanolae containing the target plasmid. At the same time, back-screen out donor Escherichia coli strains containing the plasmid.

[0112] (6) Transformation zygotes can be seen growing on the plate after coating and anaerobic culture at 37℃ for 72 hours.

[0113] 4.2 Inducing CRISPR / Cas9 expression to screen THLA knockout strains

[0114] (1) Take 500 μL of anaerobic PBS buffer and spread it on the plate surface where the conjugation transformants grew in step (6) above. Use a spreader to mix the colonies and liquid on the plate. Use a pipette to transfer the mixture to a YTF solid medium plate containing thiamphenicol, D-cycloserine and theophylline to induce CRISPR / Cas9 expression.

[0115] (2) After the plate was coated, it was anaerobically incubated at 37°C for 72 hours and single colonies were observed to grow. The single colonies were streaked on YTF solid medium plates for purification. After purification, colony PCR was performed to verify whether the gene was knocked out.

[0116] (3) Verify that the correct strain continues to be passaged in antibiotic-free YTF medium until the plasmid is completely lost. One pure single colony is streaked on a YTF solid medium plate and the other on a YTF + thiamphenicol + D-cycloserine solid medium plate. The strain that grows on the antibiotic-free medium plate but does not grow on the antibiotic-containing medium plate is the correct strain.

[0117] The correct strain was inoculated into 5 mL of YTF medium and cultured anaerobically at 37°C until the logarithmic phase. The glycerol strain was then preserved to obtain the recombinant strain, which was denoted as SGLT_Ca063.

[0118] Example 5: Directed Adaptive Evolution of Original Strains Using Simulated Industrial Gas Sources

[0119] 5.1 Experimental Materials and Reagents

[0120] Strains to be domesticated: Wild-type self-producing ethanol Clostridium DSM10061 (cultured in YTF medium (containing 10 g / L fructose) to the logarithmic growth phase, OD 600 =1.0)

[0121] Simulated industrial gas source: Volume ratio composition of 50% CO, 20% N2, and 30% CO2 (simulating steel converter gas)

[0122] Culture media: YTF medium, gas fermentation medium;

[0123] Culture apparatus: 250 mL anaerobic bottle.

[0124] The composition of YTF medium and gas fermentation medium is shown in Table 1-2 below.

[0125] Table 1. Components of YTF Culture Medium

[0126]

[0127] Table 2. Composition of Gas Fermentation Medium

[0128]

[0129] The specific components of the trace element solution are shown in Table 3, and the specific components of the Wolf vitamin solution are shown in Table 4.

[0130] Table 3. Composition of Trace Element Solution

[0131]

[0132] Table 4. Composition of Wolf Vitamin Solution

[0133]

[0134] 5.2 Domestication Methods

[0135] A targeted domestication strategy combining carbon source switching and continuous subculturing was adopted, and the process is as follows:

[0136] Initial inoculation and carbon source switching: Wild-type strain DSM10061 cultured in YTF medium was transferred at an inoculation rate of 10% (v / v) to an anaerobic bottle containing 50 mL of gas fermentation medium. After sealing, simulated industrial gas was introduced until the pressure inside the bottle reached 0.1~0.2 MPa. Anaerobic culture was carried out at 37℃ and 150 rpm. Gas replacement was performed every 24 h to maintain stable pressure inside the bottle and sufficient carbon source.

[0137] Continuous subculturing: When the strain grows to OD 600 When the inoculum size is ≥1.0, transfer the culture to fresh gaseous fermentation medium at an inoculum size of 10% (v / v), repeat the above culture conditions, record the growth lag period of each generation, and continue subculturing until the lag period no longer shortens.

[0138] Strain preservation: Select the passaged strain after the lag phase stabilizes (35 generations), prepare glycerol strain (final glycerol concentration 20%), and preserve it at -80℃ to obtain the domesticated strain, denoted as SGLT_Ca001.

[0139] 5.3 Monitoring of growth performance during domestication

[0140] The growth lag phase and maximum OD of the strain during subculturing 600 Dynamic monitoring was conducted, and the results are shown in Table 5 below.

[0141] Table 5

[0142]

[0143] 5.4 Results and Analysis

[0144] Lag period changes: The lag period of the first generation after the initial carbon source switch was 20 days, which gradually shortened with the number of generations, and stabilized at 3 days in the 30th generation, indicating that the strain had initially adapted to the CO carbon source environment.

[0145] Enhanced growth capacity: Maximum OD of the 30th generation 600 Compared to the first generation, it increased by 255.8% and the final ethanol concentration increased by 125.6%, indicating that targeted domestication can enhance the wild type's ability to metabolize and utilize CO.

[0146] Strain stability: There was no significant fluctuation in growth performance from the 30th to the 35th generation, indicating that the growth performance of the strain tends to be stable under industrial gas source environment.

[0147] 5.5 Conclusion

[0148] Through continuous subculturing and domestication under industrial gas source, a stable strain SGLT_Ca001 adapted to CO as a carbon source was successfully obtained. Its growth lag period was shortened from 20 days to 3 days, and its CO metabolism utilization and ethanol synthesis capabilities were significantly improved.

[0149] Example 6: Directed Adaptive Evolution of Recombinant Strains Using Simulated Industrial Gas Sources

[0150] 6.1 Experimental Materials and Reagents

[0151] Strains to be domesticated: The recombinant strain SGLT_Ca063 obtained in Example 4 (cultured in YTF medium (containing 10 g / L fructose) to the logarithmic growth phase, OD 600 =1.0);

[0152] Simulated industrial gas source: Volume ratio composition is 50% CO, 20% N2, 30% CO2 (simulating the core components of converter gas in the steel industry);

[0153] Culture medium: Gas fermentation medium;

[0154] Culture apparatus: 250 mL anaerobic bottle.

[0155] 6.2 Domestication Methods

[0156] A targeted domestication strategy combining carbon source switching and continuous subculturing was adopted, and the process is as follows:

[0157] 1. Initial inoculation and carbon source switching: SGLT_Ca063 cultured in YTF medium was transferred at an inoculation rate of 10% (v / v) to an anaerobic bottle containing 50 mL of gas fermentation medium. After sealing, gas (50% CO, 20% N2, 30% CO2) was introduced until the pressure inside the bottle reached 0.2 MPa. Anaerobic culture was carried out at 37℃ and 150 rpm. Gas replacement was performed every 24 hours to maintain stable pressure inside the bottle and sufficient carbon source.

[0158] 2. Continuous subculturing: When the strain grows to OD... 600 When the growth rate is ≥1.0, transfer the culture to fresh gas fermentation medium at an inoculum of 10% (v / v), repeat the above culture conditions, and record the growth lag period of each generation (from inoculation to OD). 600 (the time when the rise begins), continuing to pass on until the lag period no longer shortens;

[0159] 3. Strain Preservation: A passaged strain (35 generations) after lag phase stabilization was selected, and glycerol culture (final glycerol concentration 20%) was prepared and stored at -80℃ to obtain the recombinant engineered strain, designated SGLT_Ca138. This strain was deposited at the Guangdong Provincial Microbial Culture Collection Center on March 16, 2026, with accession number GDMCC NO: 67962, and classified as Clostridium autoethanogenum.

[0160] 6.3 Monitoring of growth performance during acclimatization

[0161] The growth lag phase and maximum OD of the strain during subculturing 600 Dynamic monitoring of CO utilization rate was conducted, and the results are shown in Table 6 below.

[0162] Table 6

[0163]

[0164] 6.4 Results and Analysis

[0165] 1. Lag period changes: After the initial carbon source switch (fructose → CO), the first generation strain had a lag period of up to 20 days. As the number of generations increased, the lag period gradually shortened. By the 30th generation, the lag period stabilized at 2 days, and there was no significant change in subsequent generations, indicating that the strain had adapted to the industrial gas source environment with CO as the only carbon source.

[0166] 2. Enhanced growth capacity: The maximum OD of the 30th generation strain 600 Compared with the first generation, the efficiency was increased by 115.2%, and the final ethanol concentration was increased by 204.7%, indicating that targeted domestication significantly enhanced the strain's ability to metabolize and utilize CO from industrial gas sources.

[0167] 3. Strain stability: growth lag phase and maximum OD of strains from the 30th to the 35th generation. 600 The lack of significant fluctuations in CO utilization rate demonstrates that the growth performance of this strain under industrial gas source conditions has become stable.

[0168] 6.5 Conclusion

[0169] Through continuous subculturing and domestication under industrial gas source, a stable strain SGLT_Ca138 adapted to CO as a carbon source was successfully obtained. Its growth lag period was shortened from 20 days to 2 days, and its CO metabolism utilization and ethanol synthesis capabilities were significantly improved.

[0170] According to the domestication results in Tables 1 and 2, the growth and fermentation performance of both DSM10061 and SGLT_Ca063 significantly improved during continuous subculturing, but the improvement was more pronounced in SGLT_Ca063. After 35 generations of domestication, the growth lag period of DSM10061 shortened from 20.0 days in the first generation to 3.0 days, and the maximum OD... 600 The concentration of ethanol increased from 0.86 g / L to 1.94 g / L, while the growth lag phase of SGLT_Ca063 shortened to 2.0 days, and the maximum OD... 600 The concentration of ethanol reached 2.02 g / L, and the concentration of ethanol increased to 2.62 g / L. Compared with SGLT_Ca001, SGLT_Ca138 showed better performance in lag phase, biomass accumulation, and ethanol synthesis capacity, indicating that knocking out the thla gene is beneficial to further enhance the adaptability of the strain and the efficiency of product synthesis under industrial gas source conditions.

[0171] Example 7: Fermentation scale-up verification of original strains, recombinant strains, domesticated strains and recombinant engineered bacteria

[0172] 7.1 Experimental Materials and Equipment

[0173] Experimental strains: wild-type self-producing ethanol Clostridium DSM10061, SGLT_Ca063, SGLT_Ca001, SGLT_Ca138;

[0174] Fermentation gas source: tail gas from the steel industry, Shougang Jingtang converter gas (volume ratio: 45-52% CO, 30% CO2, 18-25% N2), equipped with a gas flow meter for precise speed control;

[0175] Fermentation medium: Gas fermentation medium (same as in Example 5, pH 5.8), prepared according to the working volume of a 3L fermenter (2L);

[0176] Core equipment: 3L anaerobic fermenter (equipped with online pH / DO monitoring probe, gas inlet / outlet gas recovery system, mechanical stirring device), HPLC, enzyme-linked immunosorbent assay (ELISA) reader, gas chromatograph (GC990).

[0177] 7.2 Scale-up Fermentation Method in a 3L Fermenter

[0178] 1. Seed culture expansion:

[0179] Primary seed: Four strains were inoculated into YTF medium (10 g / L fructose) and cultured at 37°C until the logarithmic growth phase (OD). 600 =1.0±0.1).

[0180] Secondary seed: Transfer to a 500 mL anaerobic flask (containing 300 mL YTF medium) at a 10% (v / v) inoculation rate and incubate at 37℃ and 200 rpm until OD. 600 =1.0±0.1, used as the seed liquid for fermentation tank inoculation.

[0181] 2. Fermentation tank inoculation and start-up:

[0182] Add 2L of gaseous fermentation medium to a 3L fermenter, sterilize at 121℃ for 20 min, and after cooling, introduce nitrogen and fermentation gas source to replace the air in the tank (to maintain an anaerobic environment).

[0183] Inoculate the secondary seed culture at a 10% (v / v) inoculation rate (200 mL) and seal the fermentation tank.

[0184] 3. Control of fermentation process parameters:

[0185] Temperature: 37±0.5℃;

[0186] Initial stirring speed: 200 rpm;

[0187] Initial ventilation rate: 0.1 L / min, stabilized by a flow meter;

[0188] pH control: The pH is maintained at 5.8±0.1 by automatically adding ammonia water through online monitoring.

[0189] 4. Sample and data monitoring:

[0190] Monitoring indicators: Growth index OD 600 Biomass refers to the amount of biomass; product indicators include ethanol concentration and acetic acid concentration.

[0191] 7.3 Results of strain growth performance and metabolic scale-up verification

[0192] The metabolic comparison results of each strain after 30 days of fermentation are shown in Table 7.

[0193] Table 7

[0194]

[0195] Depend on Figure 2It can be seen that after the original strain DSM10061 was inoculated into a 3L fermenter system with CO as the carbon source, there was a long growth lag period in the early stage of fermentation (0-13 days). The acetic acid concentration did not change significantly during this stage, and ethanol synthesis was delayed until the 20th day before it started to grow rapidly. The biomass did not enter the typical logarithmic growth stage throughout the process, and the growth was slow.

[0196] The above results indicate that the original strain has a weak ability to utilize CO from industrial gas sources and cannot efficiently convert CO into carbon sources and energy required for cell growth and metabolism, resulting in low growth rate and metabolic conversion efficiency. At the end of 30 days of fermentation, its highest biomass was only 3.99 g / L, the ethanol concentration was 12.38 g / L, and the acetic acid concentration was still as high as 8.45 g / L. The ethanol selectivity was low, indicating that the original strain has limitations in the application of industrial tail gas fermentation system with CO as carbon source, including slow growth, inefficient carbon source utilization, and poor product selectivity.

[0197] Depend on Figure 3 It can be seen that the recombinant strain SGLT_Ca063 constructed by knocking out the ThlA gene (CLAU_0409) still has a certain growth lag period in the 3L fermenter system with CO as the carbon source, but its metabolic performance has been significantly optimized compared with DSM10061: the start time of ethanol synthesis during fermentation is significantly earlier and the accumulation rate is significantly faster; at the same time, the amount of acetic acid synthesized is greatly reduced, and more carbon source flows to the target product.

[0198] At the 30-day fermentation endpoint, the biomass of the recombinant strain SGLT_Ca063 reached 4.51 g / L, a 13.0% increase compared to the original strain DSM10061 (3.99 g / L); the ethanol concentration was 14.28 g / L, a 15.4% increase compared to the original strain DSM10061 (12.38 g / L); while the acetic acid concentration was only 4.97 g / L, a 41.2% decrease compared to the original strain DSM10061 (8.45 g / L). Data comparison indicates that although the targeted knockout of the ThlA gene did not completely eliminate the growth lag phase, it successfully reduced carbon flux loss in acetic acid synthesis, directing more carbon sources to the ethanol synthesis pathway, ultimately significantly improving ethanol selectivity. This verifies the effectiveness of this gene editing strategy in regulating metabolic flux.

[0199] Depend on Figure 4 It can be seen that the strain SGLT_Ca001, obtained after domestication of the original strain DSM10061, has significantly optimized metabolic performance in a 3L fermenter system with CO as the carbon source compared to the original strain DSM10061: the lag phase is shortened, the start time of ethanol and acetic acid synthesis during fermentation is significantly advanced, and the accumulation rate is significantly accelerated; however, while synthesizing the target product ethanol, a considerable amount of carbon source flows to acetic acid synthesis.

[0200] At the 30-day end of fermentation, the biomass of the domesticated strain SGLT_Ca001 reached 5.83 g / L, an increase of 46.1% compared to the original strain DSM10061 (3.99 g / L); the ethanol concentration reached 16.38 g / L, an increase of 32.3% compared to the original strain DSM10061 (12.38 g / L); and the acetic acid concentration was 12.53 g / L, significantly higher than the 4.97 g / L of the recombinant strain SGLT_Ca063 and the 8.45 g / L of the original strain DSM10061. This indicates that the original strain's ability to utilize CO increased after domestication, converting more CO into metabolites. The ethanol / acetic acid ratio was 1.31, lower than that of the recombinant strain with Th1A knockout (2.87), indicating lower selectivity for the target product ethanol.

[0201] Depend on Figure 5 It can be seen that the recombinant engineered strain SGLT_Ca138, obtained through targeted domestication with industrial gas source, showed a significant leap in growth and metabolic performance compared to the undomesticated recombinant strain SGLT_Ca063 in a 3L fermenter system with CO as the carbon source, demonstrating stronger adaptability to industrial gas source and CO utilization ability: after inoculation, acetic acid began to accumulate gradually, while the target products ethanol and biomass entered a significant logarithmic growth phase from the 3rd day of fermentation, with a significantly accelerated growth rate, completely eliminating the growth lag limitation of the recombinant strain SGLT_Ca063; especially after the 7th day of fermentation, the ethanol synthesis rate continued to be higher than the acetic acid accumulation rate, and the carbon metabolism selectivity further tilted towards ethanol.

[0202] At the end of fermentation (30 days), the biomass of the recombinant engineered strain SGLT_Ca138 reached 5.92 g / L, an increase of 31.3% compared to the recombinant strain SGLT_Ca063 (4.51 g / L), and close to that of the domesticated strain SGLT_Ca001 (5.83 g / L); the ethanol concentration reached 27.02 g / L, an increase of 89.2% compared to the recombinant strain SGLT_Ca063 (14.28 g / L) and 65.0% compared to the domesticated strain SGLT_Ca001 (16.38 g / L); the acetic acid concentration was 5.45 g / L, slightly higher than the 4.97 g / L of the recombinant strain SGLT_Ca063, but combined with the significant increase in ethanol production, it can be seen that the absolute proportion of carbon metabolic flux has significantly shifted towards ethanol, and the ethanol / acetic acid yield ratio increased from 2.87 in the recombinant strain SGLT_Ca063 to 4.96. Compared with the domesticated strain SGLT_Ca001 (acetic acid 12.53 g / L), acetic acid synthesis was reduced, and more carbon source flowed to the target product ethanol. The ethanol / acetic acid ratio increased from 1.31 to 4.96, and the ethanol selectivity was greatly improved.

[0203] This experiment used the self-produced ethanol-producing Clostridium DSM10061 as the starting strain and systematically investigated and compared the CO fermentation performance of the original strain, the ThlA gene knockout recombinant strain, the original gas source-acclimated strain, and the gene-edited combined gas source-acclimated strain. The results showed that industrial gas source-directed acclimation can significantly enhance the strain's ability to utilize CO metabolism, effectively shorten the growth lag phase, improve the cell growth rate and biomass accumulation level, and help the strain quickly adapt to the industrial exhaust gas environment with CO as the sole carbon source. However, it cannot achieve the directional allocation of carbon metabolic flux, and the ethanol selectivity is still at a low level. ThlA gene knockout can directionally inhibit the synthesis of acetic acid byproducts and optimize carbon flux allocation at the metabolic pathway level, significantly improving the ethanol synthesis selectivity, but it is difficult to completely eliminate the growth lag phase of the strain in the CO environment. Combining ThlA gene knockout with targeted domestication of industrial gas sources can exert a synergistic effect, enhancing the strain's CO utilization capacity and ensuring rapid growth while maintaining high ethanol selectivity and reducing by-product accumulation. This allows the strain to achieve optimal growth performance, ethanol yield, and product selectivity, providing a high-performance core strain and technical support for the industrial application of CO-containing industrial tail gas bio-fermentation to produce ethanol.

[0204] 7.4 Conclusion

[0205] In summary, the results show that the original strain DSM10061 has significant limitations in industrial exhaust gas systems using CO as a carbon source, including a long growth lag period, low CO utilization efficiency, and poor product selectivity. The recombinant strain SGLT_Ca063, which knocked out the Th1A gene, achieved a preliminary improvement in ethanol selectivity, but still did not completely overcome the growth adaptation bottleneck. Individual acclimatization of the strain can shorten the lag period in the CO environment, but it failed to improve ethanol selectivity. In contrast, the strain SGLT_Ca138, obtained through synergistic optimization combining gene editing and targeted acclimatization to industrial gas sources, completely eliminated the growth inhibition caused by carbon source switching, enabling rapid use of the strain under CO gas sources, while simultaneously improving biomass accumulation and ethanol synthesis efficiency. At the 30-day endpoint, the ethanol concentration reached 27.02 g / L (an increase of 118.3% compared to the original strain DSM10061, 65.0% compared to the domesticated strain SGLT_Ca001, and 89.2% compared to the recombinant strain SGLT_Ca063), the biomass reached 5.92 g / L (an increase of 48.4% compared to the original strain DSM10061 and 31.3% compared to the recombinant strain SGLT_Ca063), and the ethanol / acetic acid yield ratio increased to 4.96, fully demonstrating the comprehensive advantages of rapid growth, high carbon source utilization, excellent product selectivity, and strong stability.

[0206] This result not only verifies the scientific validity and effectiveness of the technical solution of combining targeted gene editing to reconstruct metabolic pathways with industrial environment-oriented domestication to enhance adaptability, but also proves that the solution can effectively solve the core technical bottleneck of existing industrial exhaust gas fermentation strains, providing core strains and technical support with industrial application potential for the high-value, low-carbon resource utilization of CO-containing industrial waste gases such as steel industry exhaust gas.

[0207] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A recombinant engineered bacterium, characterized in that, The recombinant engineered bacteria is Clostridium ethanolae, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 16, 2026, with accession number GDMCC No: 67962 and classified as Clostridium autoethanogenum.

2. The application of the recombinant engineered bacteria according to claim 1 in the preparation of ethanol using CO-containing industrial waste gas as a carbon source.

Images