Double-target dsrna molecule for preventing and treating tomato brown rugose fruit virus and application thereof
Patent Information
- Application Number
- CN202610921619.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-25
- Publication Date
- 2026-09-22
- Estimated Expiration
- 2046-06-25
AI Technical Summary
CN120230761A报道了靶向RP的dsRNA,但其仅针对单一功能模块,靶标药效不佳,需施用高浓度dsRNA才能达到效果,田间应用潜力受限
(1)双靶点协同增效,持效期更长。本发明将靶向ToBRFV RdRP编码基因第3659–3916nt区段和MP编码基因第5159–5350nt区段的两个有效序列融合为双靶点DT-dsRNA,经本氏烟生测验证,其接种后第3天和第7天的病毒抑制效果均显著高于单一RdRP-dsRNA和MP-dsRNA,且第7天病毒相对含量仍维持在较低水平,表明双靶点策略具有更佳的持续抑制能力。
Smart Images

Figure CN122445648B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biopesticide technology, specifically, it relates to a dual-target dsRNA molecule for controlling tomato brown wrinkle virus and its application. Background Technology
[0002] Tomato brown wrinkle virus ( Tomato brown rugose fruit virus Tobacco mosaic virus (ToBRFV) is a newly emerging and rapidly spreading RNA virus belonging to the genus Tobacco Mosaic Virus (ToBRFV). Tobamovirus Tobacco-Radix Flavescentis (ToBRFV) primarily infects tomatoes and peppers, with tomatoes being its main host. Tomato leaves infected with ToBRFV, especially young leaves, exhibit mild to severe mosaic symptoms, characterized by dark green raised, narrowed, and deformed growths; pedicels and calyxes often die, preventing fruit production; and tomato fruits develop yellow, brown, or black spots and wrinkles, severely impacting yield and quality. (Jewehan et al., see article "Screening of...") Solanum (sections Lycopersicon and Juglandifolia (germplasm for reactions to the tomato brown rugose fruit virus (ToBRFV), Journal of Plant Diseases and Protection, 2022, Vol. 129, pp. 117-123) on 636 Solanum genus ( Solanum Tomato group and Juglandifolia ToBRFV resistance screening was conducted on a group of germplasm resources. Results showed that all 636 germplasm accessions were susceptible to ToBRFV, and no effectively resistant materials were found. Furthermore, ToBRFV can disrupt the genetic resistance to tobacco mosaic virus conferred by the Tm-1, Tm-2, and Tm-2² alleles in tomatoes and the L1 and L2 alleles in peppers. Therefore, breeding resistant tomato varieties is extremely difficult, and there are currently no commercially available ToBRFV-resistant tomato varieties. Traditional integrated pest management measures, such as crop rotation, eradication of diseased plants, seed disinfection, and chemical treatment of contaminated greenhouses, have yielded minimal results. There is an urgent need to develop new and efficient ToBRFV control strategies for tomato production.
[0003] The ToBRFV genome is a single-stranded, positive-sense RNA, highly consistent with the classic "four-ORF pattern" of the Tobacco Mosaic Virus genus, with clearly defined functional modules. Its genome contains four open reading frames (ORFs): ORF1 encodes a 126kDa protein responsible for viral RNA replication initiation and replication complex assembly; ORF2 encodes a 183kDa protein, derived from the read-through translation of ORF1, with the additional C-terminal sequence encoding an RNA-dependent RNA polymerase (RdRP) responsible for amplifying the viral genome and subgenomic RNA; ORF3 encodes a mobile protein (MP), determining viral movement between plant cells and systemic infection efficiency; and ORF4 encodes a capsid protein (CP), responsible for viral particle assembly and environmental stability. These four functional modules are potential targets for RNA interference (RNAi) control strategies.
[0004] RNAi-based interferon is a novel type of green biopesticide that targets key viral genes to precisely inhibit viral replication and transmission, making it an effective approach to control plant viral diseases. Currently, there are reports of dsRNAs designed to target key functional modules of ToBRFV that can control the infection of this virus. For example, CN118480548A reported dsRNAs specifically targeting ToBRFV CP, MP, RP, and RdRP; however, all its embodiments used chitosan quaternary ammonium salt (CQAS) nanomaterials as delivery vectors, without mentioning vectorless application methods. Furthermore, the dsRNA targeting MP only reduced MP protein expression by about 50%, showing limited inhibitory efficiency. CN120230761A reported dsRNA targeting RP, but it only targets a single functional module, resulting in poor target efficacy and requiring high concentrations of dsRNA to achieve the desired effect, thus limiting its potential for field application.
[0005] Therefore, there is an urgent need to develop a dsRNA molecule that can effectively control ToBRFV at low application doses without relying on a delivery vector, in order to improve control efficiency, reduce costs, and meet the needs of practical field applications. Summary of the Invention
[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a dual-target dsRNA molecule that can effectively prevent and control Tomato Brown Ruffle Fruit Virus (ToBRFV) at low application doses without relying on nanodelivery carriers, as well as its preparation method and application.
[0007] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a dual-target dsRNA molecule that simultaneously targets the 3659-3916nt region of the RdRP-encoding gene and the 5159-5350nt region of the MP-encoding gene in the Tomato Brown Ruffle Fruit Virus (ToBRFV) genome.
[0008] According to a preferred embodiment of the present invention, the sense strand sequence of the dsRNA molecule is shown in SEQ ID NO:1, and the antisense strand sequence is shown in SEQ ID NO:2.
[0009] In a second aspect, the present invention provides a DNA molecule that encodes a dual-target dsRNA molecule as described above.
[0010] A third aspect of the present invention provides a recombinant expression vector containing the DNA molecule described above.
[0011] According to a preferred embodiment of the present invention, the DNA molecule and the pET28-ter linear plasmid fragment are linked by homologous recombination, and the DNA fragment has a T7 promoter sequence upstream and downstream.
[0012] A fourth aspect of the present invention provides a recombinant strain containing the recombinant expression vector as described above; The host bacterium of the recombinant strain is Escherichia coli HT115 (DE3).
[0013] A fifth aspect of the present invention provides a method for preparing a dual-target dsRNA molecule as described above, comprising the following steps: S1. Using cDNA derived from ToBRFV-infected plant tissues as templates, DNA fragments from the 3659-3916nt region of the RdRP-encoding gene and the 5159-5350nt region of the MP-encoding gene were amplified by PCR. S2. The DNA fragment obtained in step S1 is ligated with the pET28-ter linear plasmid fragment through homologous recombination to construct a recombinant expression vector; S3. The recombinant expression vector obtained in step S2 is transformed into Escherichia coli HT115 (DE3). After expression is induced by IPTG, total RNA is extracted, digested and purified by nucleases to obtain the dual-target dsRNA molecule. The nucleases are DNase I and RNase T1.
[0014] A sixth aspect of the present invention provides the application of the dual-target dsRNA molecule described above in inhibiting the proliferation of tomato brown wrinkle virus.
[0015] According to a preferred embodiment of the present invention, the application is for the prevention and control of diseases in solanaceous crops caused by tomato brown wrinkle virus; The solanaceous crops mentioned are selected from tomatoes, tobacco, and peppers.
[0016] A seventh aspect of the present invention provides a method for preventing and controlling plant diseases caused by tomato brown wrinkle virus, comprising applying to plants the dual-target dsRNA molecule as described above; The solanaceous crops mentioned are selected from tomatoes, tobacco, and peppers.
[0017] The beneficial effects of this invention are as follows: (1) Dual-target synergistic effect and longer duration of action. This invention fuses two effective sequences targeting the 3659–3916nt region of the ToBRFV RdRP coding gene and the 5159–5350nt region of the MP coding gene into a dual-target DT-dsRNA. Verification by Benjamin Butler assay showed that its virus inhibition effect on days 3 and 7 after inoculation was significantly higher than that of single RdRP-dsRNA and MP-dsRNA, and the relative viral load remained at a low level on day 7, indicating that the dual-target strategy has better sustained inhibitory ability.
[0018] (2) It has a high inhibitory effect even at low doses. The half-leaf method of tobacco three-year test showed that the half-maximal effective concentration (EC50) of DT-dsRNA against ToBRFV was 12.62 mg / L (R²=0.9528). It can effectively inhibit the virus at a low application dose, which is conducive to reducing production costs and meeting the needs of large-scale field application.
[0019] (3) It does not rely on a delivery carrier and can be sprayed directly, with greenhouse efficacy superior to commercially available agents. The dsRNA of this invention can be prepared and purified by the E. coli fermentation system and then sprayed directly onto the plant leaves without the need for nanomaterials such as chitosan quaternary ammonium salt as a delivery carrier. Verified in a tomato greenhouse, the relative virus content 7 and 14 days after spraying with 300 mg / L DT-dsRNA was significantly lower than that of the double-distilled water control group and the commercially available amino oligosaccharide control group, with a stable duration of efficacy, making it suitable for actual production use. Attached Figure Description
[0020] Figure 1 This is a schematic diagram of the vector map of the dual-target expression vector pET28-ter-dsDT.
[0021] Figure 2 Agarose gel electrophoresis images of total RNA expressed by different target dsRNAs in Escherichia coli HT115(DE3). Lane M is DL10000 DNA Marker (purchased from Takara Bio Inc., catalog number 3584A); Lane 1 is total RNA of plasmid-free HT115(DE3) strain (negative control); Lane 2 is total RNA of strain expressing DT-dsRNA; Lane 3 is total RNA of strain expressing RdRP-dsRNA; and Lane 4 is total RNA of strain expressing MP-dsRNA.
[0022] Figure 3 The images show the electrophoresis results of the purified dsRNA samples. Lane M contains a DL10000 DNA Marker (purchased from Takara Bio Inc., catalog number 3584A); lane 1 contains purified DT-dsRNA; lane 2 contains purified RdRP-dsRNA; and lane 3 contains purified MP-dsRNA.
[0023] Figure 4 This is a comparative graph showing the control effects of different target dsRNAs on ToBRFV in Nicotiana benthamiana. The vertical axis represents the relative ToBRFV content, and the horizontal axis represents the levels on days 3 and 7 after ToBRFV inoculation in different treatment groups.
[0024] Figure 5 These are photographs of lesion phenotypes in *Antennae sanguisorba* used for bioassay of DT-dsRNA via the half-leaf method. Figure 5 Photo A shows a comparison of lesions treated with 2 mg / L DT-dsRNA. Figure 5 Photographs comparing lesions in group B treated with 6 mg / L DT-dsRNA. Figure 5 C represents the lesion comparison photos of the 18 mg / L DT-dsRNA treatment group. Figure 5 Comparison photos of lesions in the 54 mg / L DT-dsRNA treatment group. Figure 5 The comparison photos show the lesions of the 168 mg / L DT-dsRNA treatment group; in each sub-image, the left half of the leaf is the DT-dsRNA sprayed side (experimental side), and the right half of the leaf is the double-distilled water sprayed side (control side).
[0025] Figure 6 The EC50 fitting curve for the efficacy of DT-dsRNA against ToBRFV in Tobacco Tributazone is shown.
[0026] Figure 7 Phenotypic images of tomato plants treated with dual-target DT-dsRNA at week 2, in which... Figure 7 Photograph of tomato plants (A represents the negative control group, CK, without virus inoculation or dsRNA spraying) showing their phenotypic characteristics. Figure 7 Photographs of tomato plants (B is the positive control group, treated with virus and double-distilled water) showing their phenotypic characteristics. Figure 7 C represents the phenotypic image of tomato plants in the DT-dsRNA treatment group (inoculation with virus + 200 mg / L DT-dsRNA).
[0027] Figure 8 The results show the relative content of ToBRFV in tomato plants after treatment with dual-target DT-dsRNA.
[0028] Figure 9The results of the detection of relative ToBRFV virus content under different treatments in the tomato greenhouse in Example 8 are shown.
[0029] Figure 10 These are photographs of lesion phenotypes on leaves of the Pingjiao 6 pepper variety after inoculation with double-distilled water and DT-dsRNA. Figure 10 Photo A shows the phenotypic pattern of disease spots on the leaves of the Pingjiao No. 6 pepper after double-distilled water treatment following virus inoculation. Figure 10 Photo B shows the phenotypic pattern of lesions on leaves of the Pingjiao No. 6 pepper after DT-dsRNA treatment following inoculation. Detailed Implementation
[0030] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0031] Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions.
[0032] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0033] The crude virus extract used in the following examples is described in detail below: The ToBRFV samples were obtained from field samples of diseased leaves and identified. The preservation method was long-term live subculture in the laboratory. The preparation method of the crude virus extract was as follows: 0.2g of fresh leaves from live ToBRFV-infected tobacco plants (subcultured in the laboratory) were collected and ground using a sterilized mortar to obtain plant tissue lysate. The lysate was centrifuged at 12000rpm for 5 minutes at 4℃ using a refrigerated centrifuge, and the supernatant was collected and diluted to 500mL with ddH2O to obtain the crude virus extract.
[0034] This invention targets the genomic functional modules of Tomato Brown Ruffle Fruit Virus (ToBRFV), designing 13 target dsRNAs for the coding regions of RdRP, MP, and CP proteins, and validating their functions. Several dsRNA molecules that effectively inhibited viral load in tomato plants were screened, with the dsRNA molecules targeting RdRP and MP showing relatively better RNAi effects. Furthermore, the RdRP and MP target sequences were fused to construct DT-dsRNA.
[0035] The DT-dsRNA simultaneously targets the 3659-3916nt region of the RdRP-encoding gene and the 5159-5350nt region of the MP-encoding gene in the ToBRFV genome. The sense strand RNA sequence (5′→3′) of the DT-dsRNA is shown in SEQ ID NO:1, and the antisense strand RNA sequence (5′→3′) is shown in SEQ ID NO:2.
[0036] SEQ ID NO:1 (DT-dsRNA sense strand, 5′→3′): CCACUGAUUCCGAUGGUACGAACGGCGGCAGAAAUGCCACGCCAGACUGGACUAUUGGAAAAUUUGGUGGCGAUGAUCAAAAGAAA CUUUAAUUCACCGGAGUUAUCAGGAAUAAUCGACAUUGAGAAUACUGCAUCUUUAGUAGUAGAUAAAUUUUUUGAUAGUUACUUGCUUAAAGAAAAAAGAAAACCAAAUAA AAAUGUUUCUUUAUUUUGUAGAGAGUCUCUCAAUAGAUGGUUAGAGAAGCAGGAGCAAGUGAGAGAAUGGAGAGAGCGGACGAGGCAACUCUUGCUUCAUACUAUACCGCAGCGGCUAAGAAAAGGUUUCAGUUCAAAGUCGUUCCAAAUUACAACAUCACUACCAAGGACGCAGAAAAGGCAGUUUGGCAAGUACUAGUUAAUAUUAGAAAUGUUAAAAU.
[0037] SEQ ID NO:2 (DT-dsRNA antisense strand, 5′→3′): AUUUUAACAUUUCUAAUUAACUAGUACUUGCCAAACUGCCUUUUCUGCGUCCUUGGUAGUGAUGUUGUAAUUUGGAACGACUUUG AACUGAAACCUUUUCUUAGCCGCUGCGGUAUAGUAUGAAGCAAGAGUUGCCUCGUCCGCUCUCUCCAUUCUCACUUGCUCCUGCUUCUCUAACCAUCUAUUGAGAGACU CUCUACAAAAUAAAGAAACAUUUUUAUUUGGUUUUCUUUUUCUUUAAGCAAGUAACUAUCAAAAAAUUUUUUACUACUAAAGAUGCAGUAUUCUCAAUGUCGAUUAUU CCUGAUAACUCCGGUGAAUUAAAGUUUCUUUUGAUCAUCGCCACCAAAUUUUCCAAUAAGUCCAGUCUGGCGUGGCAUUUCUGCCGCCGUUCGUACCAUCGGAAUCAGUGG.
[0038] Example 1: Comparison of the efficacy of different target dsRNAs against ToBRFV In this embodiment, the target screening was based on the genome sequence (NC_028478.1) of tomato brown wrinkle virus obtained from the NCBI database. The target was designed using the company's AI intelligent algorithm system (see CN120126561A for details), and 13 target sequences were obtained. The positions of different target fragments are shown in Table 1.
[0039] Table 1. Statistical analysis of ToBRFV target efficacy
[0040] 1.1 Preparation of dsRNAs targeting different targets Weigh 0.1g of fresh tomato leaves infected with ToBRFV, grind them immediately with liquid nitrogen, and extract total RNA using RNAiso Plus reagent (Takara Bio Inc., D9108A). Obtain cDNA using HiScript II 1st Strand cDNASynthesis Kit (Nanjing Novizan Biotechnology Co., Ltd., R211).
[0041] Using cDNA as a template and the sequences shown in Table 2 as primers, PCR amplification was performed using the rapid PCR polymerase PrimeSTAR® Max DNA Polymerase (Takara Biotech, R045Q). The purified PCR product (target sequence DNA with T7 promoter sequences at both ends) was used as a template for in vitro transcription using a T7 RNAi transcription kit (Nanjing Novizan Biotechnology Co., Ltd., TR102) to obtain high-purity dsRNA, which was stored at -20℃ for later use. Specific procedures were performed according to the kit's instruction manual.
[0042] Table 2. Primer sequences for amplification of different targets
[0043] 1.2 Comparison of local viral inhibition rates of different target dsRNAs on tobacco The efficacy of different target dsRNAs against ToBRFV was investigated on Nicotiana trifoliata using a half-leaf method. Specifically, 100 μL of the 200 mg / L target dsRNA prepared above was sprayed onto the left half of the petiole of the inoculated leaf, while the other half was coated with double-distilled water. After culturing for 12 hours, a layer of carborundum was sprinkled onto all leaves. 100 μL of crude virus extract was then dropped onto the leaves and spread evenly by hand, gently rubbing twice. The leaves were immediately rinsed with a wash bottle.
[0044] On day 5 after ToBRFV inoculation, the number of lesions on both sides of the same leaf was counted. The leaf treated with dsRNA and inoculated with the virus was designated as the experimental leaf, with the number of lesions denoted as Nt. The leaf treated with double-distilled water and inoculated with the virus was designated as the control leaf, with the number of lesions denoted as Nck. Three tobacco plants were selected for each target, and three leaves were selected from each tobacco plant for the experiment. The local virus inhibition rate (IR%) was calculated using the following formula. If the calculated result was negative, the correction inhibition rate was 0.
[0045]
[0046] The experimental results are shown in Table 1. It can be seen that the local inhibition rates of the targets ToBRFV-03, 08, 09 and 11 are relatively high. According to the position of the target fragments in the corresponding genomic coding frames, the dsRNA targeting viral RdRP and MP has relatively high efficacy.
[0047] Example 2: Preparation of target gene fragments 0.1g of fresh tomato leaves infected with ToBRFV were weighed and immediately ground with liquid nitrogen. Total RNA was extracted using RNAiso Plus reagent (Takara Bio Inc., catalog number D9108A), and cDNA was obtained using the HiScript II 1st Strand cDNA Synthesis Kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number R211). Using primers RdRP-F / R and MP-F / R (primer sequences shown in Table 3), rapid PCR was performed using PrimeSTAR polymerase. ® Max DNA Polymerase (Takara Biotech, catalog number R045Q) amplifies DNA fragments from the 3659-3916 nt region of the RdRP-encoding gene and the 5159-5350 nt region of the MP-encoding gene. The amplified fragments are purified using a DNA purification kit (Tiangen Biotech (Beijing) Co., Ltd., catalog number DP214) to obtain high-purity RdRP-encoding gene DNA fragments (RdRP-DNA) and MP-encoding gene DNA fragments (MP-DNA).
[0048] Table 3. Primers for target gene fragment amplification
[0049] Note: The underlined sequence is the T7 promoter sequence.
[0050] Example 3: Construction of dsRNA expression vector and strain (1) Construction of single-target expression vector and bacterial cells Using the pET28-ter-TMV-cp vector constructed in CN121065060A as a template, the linear plasmid pET28-ter fragment was recovered after digestion with EcoRI. The pET28-ter fragment was ligated with the RdRP-DNA and MP-DNA fragments obtained in Example 2 using a homologous recombination kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number C116) to obtain the expression vectors pET28-ter-RdRP and pET28-ter-MP for RdRP-dsRNA and MP-dsRNA, respectively. These two expression vectors were transformed into *E. coli* HT115(DE3) competent cells to obtain RdRP-dsRNA expression strains (transformed into expression vector pET28-ter-RdRP) and MP-dsRNA expression strains (transformed into expression vector pET28-ter-MP), respectively.
[0051] (2) Construction of dual-target expression vector and bacterial cells Using the cDNA obtained in Example 2 as a template, the rapid PCR polymerase PrimeSTAR was used. ® Max DNA Polymerase (Takara Biotech, catalog number R045Q) amplified an RdRP-DNA fragment with adapters using RdRP-F and RdRP-CE-R primers; and an MP-DNA fragment with adapters using MP-CE-F and MP-R primers. The adapter-containing RdRP-DNA fragment, MP-DNA fragment, and linear plasmid pET28-ter fragment were then mixed and ligated using a homologous recombination kit to obtain the dual-target expression vector pET28-ter-dsDT, as shown in the vector map below. Figure 1 As shown. The expression vector was transformed into Escherichia coli HT115(DE3) competent cells to obtain a strain expressing dual-target DT-dsRNA.
[0052] Example 4: Expression and Preparation of dsRNA 10 µL of glycerol-preserved bacterial culture from RdRP-dsRNA-expressing strains, MP-dsRNA-expressing strains, and dual-target DT-dsRNA-expressing strains were inoculated into 20 mL of LB medium containing 25 µg / mL tetracycline and 100 µg / mL ampicillin, and cultured overnight at 37 °C and 200 rpm. The next day, 1 mL of the bacterial culture was transferred to 50 mL of LB medium containing 25 µg / mL tetracycline and 100 µg / mL ampicillin, and cultured for 2 h at 37 °C and 200 rpm. IPTG was then added to induce fermentation, and the culture was continued for 18 h before fermentation was stopped. Plasmid-free *E. coli* HT115(DE3) was used as a control group under the same culture conditions.
[0053] Collect 4 mL of fermentation broth by centrifugation at 12000 rpm for 1 min. Extract total RNA from *E. coli* using RNAiso Plus reagent (Takara Bio Inc., catalog number D9108A). Add 1 μL of LDNase I and 1 μL of RNase T1 to 100 µL of the obtained total RNA solution and digest at 37 °C for 1 h. Then purify the RNA using RNA purification magnetic beads (Nanjing Novizan Biotechnology Co., Ltd., catalog number N412) to obtain a high-purity dsRNA solution, which is stored at -20 °C for subsequent bioassay experiments.
[0054] Figure 2 Agarose gel electrophoresis images of total RNA expressed in E. coli HT115(DE3) for different target dsRNAs, as shown below. Figure 2As shown, the total RNA of the RdRP-dsRNA expressing strain and the MP-dsRNA expressing strain showed a significant overexpression band at approximately 200 bp, while the total RNA of the DT-dsRNA expressing strain showed a significant overexpression band at approximately 418 bp, consistent with the theoretical design, indicating that all three expressing strains normally expressed the target dsRNA.
[0055] Figure 3 Here is an agarose gel electrophoresis image of the purified dsRNA sample, as shown. Figure 3 As shown, all three dsRNAs showed a single band, indicating that the purified dsRNAs had high purity and could be used as qualified samples for the next bioassay.
[0056] Example 5: Comparison of the efficacy of single-target dsRNA and dual-target dsRNA In this embodiment, *Nicotiana benthamiana* was used as the test plant, and bioassays were conducted using a pot experiment. Foliar sprays were performed on *Nicotiana benthamiana* plants using 200 mg / L solutions of RdRP-dsRNA, MP-dsRNA, and DT-dsRNA. After drying for 12 hours, ToBRFV was inoculated via friction. Specifically, a layer of carborundum was sprinkled on the first and second leaves (excluding the cotyledons) from the bottom up (the inoculated leaves). 100 μL of crude virus extract was then dropped onto the leaf, and the entire leaf was rubbed evenly by hand, gently rubbed twice, and the leaves were immediately rinsed with a wash bottle. The experimental setup included a positive control group (treated with double-distilled water and then inoculated with ToBRFV) and a negative control group (CK) (no virus inoculation).
[0057] On days 3 and 7 after ToBRFV inoculation, leaves from the upper part of the inoculated leaves were harvested for RT-qPCR detection of the relative viral load. Based on the tobacco genome... Actin The gene was used as an internal control. RT-qPCR was performed using the specific primers qRdRP-F / qRdRP-R and the internal control amplification primers qActin-F / qActin-R listed in Table 4. -ΔΔCt Numerical values represent the relative abundance of the virus.
[0058] Figure 4 A comparative graph showing the control efficacy of different target dsRNAs against ToBRFV in Nicotiana benthamiana, as shown below. Figure 4As shown, compared with the positive control group, RdRP-dsRNA, MP-dsRNA, and DT-dsRNA all effectively reduced the viral load of ToBRFV. Among them, the prevention and control effect of DT-dsRNA on days 3 and 7 was significantly higher than that of single-target RdRP-dsRNA and MP-dsRNA. Moreover, the relative ToBRFV content of DT-dsRNA on day 7 was also relatively low, with no significant difference from the viral load on day 3. It can be seen that the dual-target DT-dsRNA has a longer duration of prevention and control and a better prevention and control effect than single-target RdRP-dsRNA and MP-dsRNA.
[0059] Table 4. Specific primers for relative quantitative detection of ToBRFV
[0060] Comparative Example 1: Efficacy testing of other dual-target dsRNA combinations The sequences of ToBRFV-08 and ToBRFV-11, which showed high local viral inhibition rates in Example 1, were combined to obtain the dual-target ToBRFV-14, with sequence positions 3659-3916 and 4911-5070 of the ToBRFV genome, totaling 418 bp in length. The sequences of ToBRFV-09 and ToBRFV-11 were combined to obtain the dual-target ToBRFV-15, with sequence positions 4058-4307 and 4911-5070, totaling 410 bp in length.
[0061] The dual-target dsRNA in this comparative example was prepared as follows: DNA sequences of the dual-target sequences of ToBRFV-14 and ToBRFV-15 were synthesized (commissioned by Sangon Biotech Co., Ltd.) to obtain plasmid vectors pUC57-kan-ToBRFV14 and pUC57-kan-ToBRFV15 carrying the target sequences. Using these plasmids as templates, PCR amplification was performed using the primers shown in Table 5. The purified PCR products were then transcribed in vitro according to the single-target dsRNA preparation method described in Section 1.1 of Example 1 to obtain high-purity dual-target dsRNA.
[0062] Table 5. Primer sequences used in Comparative Example 1
[0063] Wherein, the synthetic DNA sequence of ToBRFV-14 (SEQ ID NO: 45) (5'→3') is as follows: CCACTGATTCCGATGGTACGAACGGCGGCAGAAATGCCACGCCAGACTGGACTATTGGAAAATTTGGTGGCGATGATCAAAAGAAACTTTAATTCACCGGAGTTATCAGGAATAATCGACATTGAGAATACTGCATCTTTAGTAGTAGATAAATTTTTTGATAGTTACTTGCTTAAAGAAAAAAGAAAACCAAATAAAAATGTTTCTTTATTTTGTAGAGAGTCTCTCAATAGATGGTTAGAGAAGCAGGAGCAAGTGATGGCTCTTGTTAAGGGTAAAGTCAATATTAATGAGTTCATAGACTTGTCAAAATCAGAAAAATTTCTTCCGTCTATGTTCACACCTGTTAAGAGTGTCATGATCTCCAAGGTTGATAAGATATTGGTTCATGAAGATGAATCTTTGTCCGAAGTCAATT。
[0064] Wherein, the synthetic DNA sequence of ToBRFV-15 (SEQ ID NO: 46) (5'→3') is as follows: CATTCGAAAAAGATCAACGCAATCTTCGGTCCTTTGTTCAGTGAGCTCACAAGGCAAATGCTCGAAAGCATAGACTCAAGTAAGTTTTTGTTCTTTACAAGGAAGACGCCAGCTCAAATTGAGGATTTCTTCGGAGATCTCGATAGCCATGTCCCTATGGATATCTTGGAGTTGGATATTTCGAAGTATGACAAATCTCAGAACGAGTTCCACTGTGCAGTAGAGTATGAAATATGGAGAAGACTTGGATATGGCTCTTGTTAAGGGTAAAGTCAATATTAATGAGTTCATAGACTTGTCAAAATCAGAAAAATTTCTTCCGTCTATGTTCACACCTGTTAAGAGTGTCATGATCTCCAAGGTTGATAAGATATTGGTTCATGAAGATGAATCTTTGTCCGAAGTCAATT。
[0065] The local viral inhibition rate of the comparative dual-target dsRNA against ToBRFV on tobacco was tested using the half-leaf method described in Section 1.2 of Example 1. The number of lesions was counted on the 5th day after inoculation, and the inhibition rate was calculated according to IR = (Nck - Nt) / Nck × 100%. The results are shown in Table 6.
[0066] Table 6. Local viral inhibition rate of dual-target dsRNA combination on tobacco in Comparative Example 1
[0067] As shown in Table 6, ToBRFV-14 had a local inhibition rate of 42.32% against ToBRFV, which was lower than that of its corresponding single targets ToBRFV-08 (64.35%) and ToBRFV-11 (53.21%). ToBRFV-15 had a local inhibition rate of 30.88% against ToBRFV, which was also lower than that of its corresponding single targets ToBRFV-09 (45.47%) and ToBRFV-11 (53.21%).
[0068] The above results indicate that simply combining single-target dsRNA sequences with high efficacy may not necessarily result in dual-target dsRNAs with better efficacy than single-target sequences.
[0069] Example 6: Efficacy test of different concentrations of dual-target DT-dsRNA against ToBRFV in tobacco. Three Lives Smoke ( Nicotiana tabacum cv. Samsun NN) is a typical local lesion host, capable of hypersensitive response to ToBRFV and forming visible necrotic lesions. Each lesion usually corresponds to a successful and restricted viral infection event. Therefore, the number of lesions can be used as a quantitative indicator of the initial viral infection efficiency and indirectly reflect the inhibitory effect of dsRNA on the virus.
[0070] This experiment selected the first and second leaves (excluding cotyledons) from the bottom up (inoculated leaves) and used the half-leaf method to test the biocontrol efficacy. The specific method was as follows: 100 μL of dsRNA solution at different concentrations (2 mg / L, 6 mg / L, 18 mg / L, 54 mg / L, 168 mg / L) was sprayed onto the left half of the inoculated leaf petiole, while the other half was sprayed with an equal amount of double-distilled water as a control. After 12 hours of incubation, a layer of carborundum was sprinkled on the entire leaf, and 100 μL of crude virus extract was dropped onto the leaf. The entire leaf was then rubbed gently twice by hand, and the leaf was immediately rinsed with a wash bottle. On the 5th day after ToBRFV inoculation, the number of lesions on both sides of the same leaf was counted. The number of lesions on the side treated with dsRNA (experimental side) was recorded as Nt, and the number of lesions on the side treated with double-distilled water (control side) was recorded as Nck. Three tobacco plants were selected for each concentration test, and three leaves were selected from each plant for the experiment. The local viral inhibition rate (IR) is calculated using the following formula: .
[0071] Figure 5 Photographs of lesion phenotypes in Nicotiana trifoliata using the half-leaf method for bioassay of DT-dsRNA, such as... Figure 5 As shown, with the increase of DT-dsRNA treatment concentration, the number of lesions on the sprayed side (left half of the leaf) gradually decreased, indicating that the inhibitory effect of DT-dsRNA on ToBRFV infection showed a clear dose-response relationship.
[0072] Based on the inhibition rate data at various concentrations, nonlinear fitting was performed using GraphPad software, and the EC50 value of DT-dsRNA against ToBRFV was found to be 12.62 mg / L. Figure 6 The EC50 fitting curve of the control effect of DT-dsRNA on ToBRFV in Nicotiana trifoliata is shown below. Figure 6 As shown, the R² of the fitted curve is 0.9528, indicating a good fit and that DT-dsRNA can achieve effective viral inhibition at a low concentration.
[0073] Example 7: Efficacy test of dual-target DT-dsRNA against ToBRFV in tomato plants. The tomato variety selected in this embodiment was Zhongshu No. 4, purchased from Zhongshu Seed Industry Technology (Beijing) Co., Ltd. Tomato plants at the 4-5 leaf stage were selected for testing, and bioassays were performed using a pot method. A 200 mg / L DT-dsRNA solution was sprayed onto the leaves of the tomato plants, and after drying for 12 hours, ToBRFV was inoculated via friction. The inoculation method was as follows: a layer of carborundum was sprinkled on the first and second leaves (excluding the cotyledons) from the bottom up (the inoculated leaves). 100 μL of crude virus extract was dropped onto the leaf, and the entire leaf was rubbed evenly by hand, gently rubbed twice, and the leaves were immediately rinsed with a wash bottle. Experimental setup: tomatoes not inoculated with ToBRFV served as the negative control group (CK), and the treatment of spraying with double-distilled water followed by ToBRFV inoculation served as the positive control group.
[0074] Plant phenotypic observations were conducted two weeks after ToBRFV inoculation, and plant height and fresh weight were measured. Simultaneously, leaves from the upper part of the inoculated leaves were collected for RT-qPCR detection, using the Actin gene of the tomato genome as an internal control. RT-qPCR was performed using the specific primers qRdRP-F / qRdRP-R and the internal control amplification primers qtActin-F / qtActin-R (see Table 4). -ΔΔCt Numerical values represent the relative abundance of the virus.
[0075] Figure 7 Phenotypic images of tomato plants treated with dual-target DT-dsRNA at week 2, such as... Figure 7 As shown, the tomato plants in the positive control group exhibited obvious symptoms of slow growth, leaf wrinkling, and yellowing, while the growth status of the tomato plants in the DT-dsRNA treatment group was close to that of the negative control group, indicating that DT-dsRNA can effectively alleviate the disease symptoms caused by ToBRFV infection.
[0076] Figure 8 The bar chart shows the relative ToBRFV content of tomato plants after treatment with dual-target DT-dsRNA, as shown in the figure. Figure 8 As shown, the relative content of ToBRFV in the DT-dsRNA treatment group was significantly lower than that in the positive control group, indicating that DT-dsRNA can significantly reduce the virus accumulation level in tomato plants.
[0077] Table 7 shows the plant height and fresh weight data of tomato plants in different treatment groups. As shown in Table 7, the plant height and fresh weight of the positive control group were significantly lower than those of the negative control group, while the plant height and fresh weight of the DT-dsRNA treatment group were not significantly different from those of the negative control group, indicating that DT-dsRNA treatment can effectively protect the normal growth of tomato plants.
[0078] Table 7. Determination of plant height and fresh weight of tomatoes after DT-dsRNA treatment
[0079] Example 8: Bioassay of dual-target DT-dsRNA in a tomato greenhouse Through field investigation, greenhouses with tomato leaves exhibiting typical ToBRFV traits were selected as biotesting sites. Tomato leaf samples were taken and RT-qPCR was performed using the method described in Example 5 and the specific primers qRdRP-F / qRdRP-R listed in Table 4 to confirm ToBRFV infection in the tomatoes.
[0080] The experiment was divided into the following groups: (1) Spray with double-distilled water (control group, CK); (2) Spray with 2% amino oligosaccharide (commercially available control agent group); (3) Spray with 300 mg / L DT-dsRNA; Two treatments were set up in each group. Tomato samples were taken 7 days and 14 days after drug application to detect the relative content of ToBRFV. Three samples were taken for each treatment. The method for detecting the relative content of ToBRFV and the method for calculating the viral content were the same as in Example 5. Figure 9 The results of relative ToBRFV virus content detection under different treatments in a tomato greenhouse are as follows: Figure 9 As shown, after 7 days of application, the virus content in tomato leaves treated with DT-dsRNA was significantly reduced, while the relative virus content in tomato leaves treated with amino oligosaccharides showed no significant change, indicating that the control effect of DT-dsRNA was superior to that of the commercially available control agent. Furthermore, 14 days after DT-dsRNA application, the virus content in tomato leaves remained significantly lower than that in the control group and the commercially available control agent group, indicating that its control effect was stable and had a long-lasting effect.
[0081] Example 9: Efficacy test of dual-target DT-dsRNA against ToBRFV in pepper variety Pingjiao 6 The chili pepper variety selected in this embodiment is Pingjiao 6 (Gansu Academy of Agricultural Sciences). This variety is a local lesion host of ToBRFV and can produce a hypersensitive reaction to ToBRFV, forming visible necrotic lesions. Therefore, the efficacy of dual-target DT-dsRNA against ToBRFV can be indirectly determined by calculating the local virus inhibition rate (IR).
[0082] The experiment selected 6-7 leaf-grown Pingjiao No. 6 pepper seedlings as biotesting plants. Three potted pepper plants were selected, and 5 leaves were selected from each plant. The ToBRFV virus crude extract was inoculated using the friction inoculation method described in Example 6. After inoculation, 100 μL of 152 mg / L DT-dsRNA solution was sprayed onto the leaf surface. Leaves sprayed with an equal amount of double-distilled water served as controls. After drying for 12 hours, the leaves were placed in a greenhouse for normal cultivation for 7 days, and the number of lesions was counted. Pepper leaves sprayed with double-distilled water after virus inoculation served as controls. Leaves sprayed with DT-dsRNA were used as experimental leaves, and the number of lesions was Nt. Leaves sprayed with double-distilled water were used as control leaves, and the number of lesions was Nck. The local inhibition rate (%) was calculated. The local virus inhibition rate (IR%) was calculated using the following formula: If the calculated data result is negative, the correction inhibition rate is 0.
[0083] Figure 10 These are photographs of lesion phenotypes on leaves of the Pingjiao 6 pepper variety after inoculation with double-distilled water and DT-dsRNA. Figure 10 As shown, pepper leaves sprayed with double-distilled water exhibit numerous lesions and show yellowing and wrinkling phenotypes, while leaves sprayed with DT-dsRNA show fewer lesions and normal leaf phenotype. Furthermore, the growth of new leaves in pepper plants sprayed with double-distilled water is significantly weaker than that in those sprayed with DT-dsRNA. The lesion count results show that DT-dsRNA can achieve a local inhibition rate of 70.40±8.34% against ToBRFV in this pepper variety, indicating that DT-dsRNA can effectively control ToBRFV in this pepper variety.
[0084] The above description is only a partial embodiment of the present invention and is not intended to limit the scope of the present invention. Various changes can be made to the above embodiments of the present invention. All simple and equivalent changes and modifications made based on the content of the present invention's specification fall within the protection scope of the present invention. All aspects not described in detail in this invention are conventional technical content.
Claims
1. A dual-target dsRNA molecule, characterized in that, The dsRNA molecule simultaneously targets the 3659-3916nt segment of the RdRP encoding gene and the 5191-5350nt segment of the MP encoding gene in the NC_028478.1 genome of Tomato Brown Ruffle Fruit Virus (ToBRFV).
2. The dual-target dsRNA molecule according to claim 1, characterized in that, The sense strand sequence of the dsRNA molecule is shown in SEQ ID NO:1, and the antisense strand sequence is shown in SEQ ID NO:
2.
3. A DNA molecule, characterized in that, The DNA molecule encodes the dual-target dsRNA molecule as described in claim 1 or 2.
4. A recombinant expression vector, characterized in that, The recombinant expression vector contains the DNA molecule as described in claim 3.
5. The recombinant expression vector according to claim 4, characterized in that, The DNA molecule is linked to the pET28-ter linear plasmid fragment via homologous recombination, and the DNA fragment has T7 promoter sequences upstream and downstream of it. The pET28-ter linear plasmid fragment was obtained by digestion with EcoRI using the pET28-ter-TMV-cp vector constructed in CN121065060A as a template.
6. A recombinant bacterial strain, characterized in that, The recombinant strain contains the recombinant expression vector according to claim 4 or 5; The host bacterium of the recombinant strain is Escherichia coli HT115 (DE3).
7. A method for preparing the dual-target dsRNA molecule of claim 1 or 2, characterized in that, Includes the following steps: S1. Using cDNA derived from ToBRFV-infected plant tissues as templates, DNA fragments from the 3659-3916nt region of the RdRP-encoding gene and the 5159-5350nt region of the MP-encoding gene were amplified by PCR. S2. The DNA fragment obtained in step S1 is ligated with the pET28-ter linear plasmid fragment through homologous recombination to construct a recombinant expression vector; S3. The recombinant expression vector obtained in step S2 is transformed into Escherichia coli HT115 (DE3). After expression is induced by IPTG, total RNA is extracted, digested and purified by nucleases to obtain the dual-target dsRNA molecule. The nucleases are DNase I and RNase T1; The pET28-ter linear plasmid fragment was obtained by digestion with EcoRI using the pET28-ter-TMV-cp vector constructed in CN121065060A as a template.
8. The use of the dual-target dsRNA molecule of claim 1 or 2 in inhibiting the proliferation of tomato brown wrinkle virus.
9. The application according to claim 8, characterized in that, The application is for the prevention and control of diseases in solanaceous crops caused by tomato brown wrinkle virus; The solanaceous crops mentioned are selected from tomatoes, tobacco, and peppers.
10. A method for preventing and controlling diseases of solanaceous crops caused by tomato brown wrinkle virus, characterized in that, This includes applying the dual-target dsRNA molecule of claim 1 or 2 to Solanaceae crops; The solanaceous crops mentioned are selected from tomatoes, tobacco, and peppers.
Citation Information
Patent Citations
Design method and application of dsRNA / siRNA target based on thermodynamic parameters and computer program product
CN120126561A
Target segment and double-stranded RNA for preventing and treating tomato brown crinkled fruit virus in tobacco and application of target segment and double-stranded RNA
CN120230761A
Escherichia coli recombinant bacterium capable of efficiently expressing dsRNA based on double-plasmid system and application of escherichia coli recombinant bacterium
CN121065060A
Nano-RNAi medicine for preventing and treating tomato brown fruit wrinkling virus as well as preparation method and application of nano-RNAi medicine
CN118480548A
Method for preventing and treating tomato brown wrinkled fruit virus
CN122146700A