Ultrasound-activated targeted drug-loaded nanodroplets, methods of making and uses thereof

Abstract

The application discloses an ultrasonic-activated targeted drug-loaded nanodroplet as well as a preparation method and application thereof, relates to the technical field of nanomedicine, and discloses the ultrasonic-activated targeted drug-loaded nanodroplet, which comprises a phase change material, an miRNA drug and a hyaluronic acid modified nanocarrier, the phase change material and the miRNA drug are jointly loaded in the hyaluronic acid modified nanocarrier, and the hyaluronic acid modified on the surface of the nanocarrier can be combined with a CD44 receptor in a targeted manner; the phase change material is perfluoropentane, and the miRNA drug is hsa-miR-136-5p mimic; under the action of ultrasonic waves, the perfluoropentane is subjected to liquid-gas phase change, triggers the structural change of the nanodroplet, and realizes in-situ and controllable release of the hsa-miR-136-5p mimic in a tumor; and the released miRNA drug overexpresses miR-136 in triple-negative breast cancer, and plays a therapeutic role through a miR-136 / Smad3 axis.

Description

Technical Field

[0001] This invention relates to the field of nanomedicine technology, and in particular to an ultrasound-activated targeted drug-loaded nanodroplet, its preparation method, and its application. Background Technology

[0002] Triple-negative breast cancer (TNBC) lacks a clear therapeutic target, preventing patients from benefiting from classic endocrine therapy and HER2-targeted therapy. Clinically, it primarily relies on chemotherapy and immunotherapy. However, paclitaxel- and anthracycline-based chemotherapy suffers from significant side effects and limited efficacy. Immune checkpoint inhibitors are only effective in a subset of PD-L1-positive patients, with limited overall objective response rates, and are associated with immune-related adverse reactions and high costs. Therefore, developing innovative technologies that combine high efficiency, precision, and safety, especially intelligent delivery systems with tumor targeting, anti-tumor immunomodulatory capabilities, and low systemic toxicity, is a crucial research direction in the field of precision medicine for triple-negative breast cancer.

[0003] Studies have shown that microRNAs (miRNAs) play a crucial role in the development and progression of triple-negative breast cancer, maintenance of tumor stemness, epithelial-mesenchymal transition, and regulation of the immune microenvironment. hsa-miR-136-5p possesses tumor-suppressive functions, inhibiting tumor cell proliferation, migration, and invasion by targeting and regulating signaling pathways such as Smad3. However, naked miRNA / mRNA drugs are easily degraded by nucleases in vivo, exhibiting poor cyclic stability, low tumor accumulation efficiency, and insufficient cellular uptake, thus limiting their clinical translation.

[0004] To improve the in vivo delivery efficiency of nucleic acid drugs, nanodelivery systems have become an important technological direction. Hyaluronic acid (HA) possesses excellent biocompatibility, degradability, and tumor-targeting capabilities. It can achieve active targeted delivery by recognizing the CD44 receptor highly expressed on the surface of triple-negative breast cancer cells, thereby improving tumor enrichment efficiency and reducing toxicity to normal tissues. Nanodroplet systems can effectively encapsulate nucleic acid drugs, improving their blood circulation stability and intracellular delivery efficiency. However, existing nanodelivery systems still have drawbacks such as uncontrollable drug release, limited deep tumor penetration, and insufficient real-time imaging monitoring.

[0005] Ultrasonic-responsive phase-change nanosystems based on perfluoropentane (PFP) exhibit excellent acoustic response characteristics. Under low-intensity focused ultrasound, PFP undergoes a liquid-gas phase transition, forming microbubble structures that enhance ultrasound imaging signals, enabling real-time imaging diagnosis of tumor sites. Simultaneously, it induces the rupture of nanocarrier structures, achieving controlled drug release at the tumor site, improving accuracy and reducing systemic toxicity. Ultrasonic-triggered phase-change nanoplatforms hold broad application prospects in tumor drug delivery and gene therapy. However, systematic research on ultrasound-responsive targeted delivery systems for miRNA drugs targeting triple-negative breast cancer is lacking, particularly regarding ultrasound-responsive CD44-targeting nanodroplet platforms based on miR-136 / Smad3 signal axis regulation. Therefore, constructing an ultrasound-activated targeted drug-loaded nanodroplet integrating "active CD44 targeting, ultrasound-responsive controlled drug release, ultrasound imaging diagnosis, and miR-136 / Smad3 gene regulation," along with its preparation method and applications, is of significant value for improving the precision treatment of triple-negative breast cancer and promoting the clinical translation of nucleic acid drugs. Summary of the Invention

[0006] In view of this, the present invention addresses the deficiencies of the existing technology, and its main objective is to provide an ultrasound-activated targeted drug-loaded nanodroplet, its preparation method, and its application. The nanodroplet surface is modified with hyaluronic acid (HA), which specifically binds to the CD44 receptor highly expressed on the surface of triple-negative breast cancer tumor stem cells, achieving active targeting and improving tumor tissue enrichment and cellular uptake efficiency. The DSPE-PEG-HA, lipid materials, and perfluoropentane used in this invention all possess good biocompatibility and degradability, effectively reducing systemic toxicity and non-specific immune reactions, and exhibiting superior safety compared to traditional chemotherapy drugs and some cationic polymer carriers.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] An ultrasound-activated targeted drug-loaded nanodroplet comprises a phase change material, a miRNA drug, and a nanocarrier. The miRNA drug is hsa-miR-136-5p mimic; the guide strand sequence of hsa-miR-136-5p mimic is shown in SEQ ID NO.1: ACUCCAUUUGUUUUGAUGAUGGA, and the guest strand sequence of hsa-miR-136-5p mimic is shown in SEQ ID NO.2: CAUCAUCAAAACAAAUGGAGUUU; (1:1). The surface of the nanocarrier is modified with hyaluronic acid (HA). The phase change material and the miRNA drug are co-encapsulated within the nanocarrier. The hyaluronic acid can target and bind to the CD44 receptor on the surface of triple-negative breast cancer cells.

[0009] As a preferred option, the phase change material is perfluoropentane.

[0010] As a preferred embodiment, the hyaluronic acid-modified nanocarrier is a lipid nanocarrier, and the lipid components of the lipid nanocarrier include DOTAP, cholesterol, and DSPE-PEG-HA or DSPE-PEG-NH2.

[0011] As a preferred embodiment, the mass ratio of DOTAP, DSPE-PEG-HA, or DSPE-PEG-NH2 to cholesterol is 3:1:1.

[0012] A method for preparing the ultrasound-activated targeted drug-loaded nanodroplets includes the following steps:

[0013] S1. The lipid component is dissolved in an organic solvent, the organic solvent is removed by rotary evaporation under reduced pressure to form a uniform lipid film, and then dried under vacuum.

[0014] S2. Add an aqueous solution containing the phase change material perfluoropentane (PFP), and ultrasonically hydrate under ice bath protection to obtain nanodroplet primary emulsion;

[0015] S3. Intermittent ultrasonic emulsification was performed using an ultrasonic cell disruptor under ice bath protection, followed by filtration and granulation through a filter membrane to obtain targeted blank nanodroplets or blank nanodroplets.

[0016] S4. Incubate the obtained targeted blank nanodroplets or blank nanodroplets with hsa-miR-136-5p mimic to obtain targeted drug-loaded nanodroplets or drug-loaded nanodroplets.

[0017] As a preferred embodiment: the lipid components in step S1 include DOTAP, cholesterol, and DSPE-PEG-HA or DSPE-PEG-NH2. The lipid components are dissolved in an organic solvent specifically as follows: DOTAP:DSPE-PEG-HA or DSPE-PEG-NH2:cholesterol = 3:1:1 in analytical grade chloroform.

[0018] As a preferred embodiment: the volume ratio of perfluoropentane in the aqueous solution in step S2 is 5%; the ultrasonic hydration under ice bath protection specifically involves ultrasonic hydration for 2-15 minutes using an ultrasonic cleaner under ice bath protection.

[0019] As a preferred embodiment: the intermittent ultrasonic emulsification time in step S3 is 5 minutes; the pore size of the filter membrane is 0.22 μm; and the incubation time in step S4 is 20 minutes.

[0020] The application of the ultrasound-activated targeted drug-loaded nanodroplets in the preparation of a medicament for treating triple-negative breast cancer, wherein the medicament uses hsa-miR-136-5p mimic as the active ingredient and also includes pharmaceutically acceptable excipients.

[0021] As a preferred embodiment, the perfluoropentane contained in the drug can undergo a liquid-gas phase transition under ultrasound triggering, thereby promoting the release of hsa-miR-136-5p mimic at the tumor site.

[0022] Compared with the prior art, the present invention has obvious advantages and beneficial effects. Specifically, as can be seen from the above technical solution:

[0023] First, this invention constructs a CD44-targeted phase-change nanodroplet carrying nucleic acid drugs with ultrasonic response, namely a targeted drug-loaded nanodroplet. This nanodroplet has both stable nucleic acid delivery and efficient loading capabilities. It mainly encapsulates hsa-miR-136-5p mimic through lipid nanodroplets, which can significantly improve its stability, bioavailability and in vivo circulation time, thereby enhancing the delivery efficiency of nucleic acid drugs.

[0024] Secondly, this invention uses hyaluronic acid (HA) to modify the surface of nanodroplets, and utilizes its specific binding with the CD44 receptor highly expressed on the surface of triple-negative breast cancer tumor stem cells to achieve active targeting and improve tumor tissue enrichment and cell uptake efficiency.

[0025] Third, this invention induces a liquid-gas phase transition by encapsulating perfluoropentane (PFP) under the action of external ultrasound. The microbubbles generated after the phase transition of perfluoropentane (PFP) can significantly enhance the ultrasound imaging signal. At the same time, the phase transition can enable the nanodroplets to rupture precisely at the tumor site and release hsa-miR-136-5p mimic, realizing non-invasive, visualized and spatiotemporally controllable drug release.

[0026] Fourth, the DSPE-PEG-HA, lipid materials, cholesterol, and perfluoropentane (PFP) used in this invention all have good biocompatibility and degradability, which can effectively reduce side effects such as systemic toxicity and non-specific immune reactions, and their safety is superior to traditional chemotherapy drugs and some cationic polymer carriers.

[0027] Fifth, this invention is the first to organically integrate CD44 active targeting, hsa-miR-136-5p mimic gene delivery, perfluoropentane ultrasound-responsive phase transition imaging, and targeted release into the same nanoplatform, forming a complete technical system of "precise delivery - real-time imaging - controlled drug release - gene therapy", which has outstanding innovation and broad clinical translation prospects.

[0028] To more clearly illustrate the structural features and effects of the present invention, a detailed description is provided below in conjunction with the accompanying drawings and specific embodiments. Attached Figure Description

[0029] Figure 1 This is a schematic diagram of the synthesis and structure of the drug-loaded nanodroplets of the present invention based on thin-film hydration and ultrasonic emulsification.

[0030] Figure 2 The results of morphological investigation and ultrasonic phase transition experiments of the drug-loaded nanodroplets and targeted drug-loaded nanodroplets of this invention are presented; among them, Figure 2 a, Figure 2 b and Figure 2 In the middle c, the morphological characterization images of nanodroplets detected by dynamic light scattering instrument and transmission electron microscopy are shown respectively. The histogram is the particle size distribution map, and the embedded image is the transmission electron microscopy image. Figure 2 In the middle, d represents the polydispersity index (PDI) statistics of different groups of nanodroplets; Figure 2 In the diagram, e represents the Zeta potential of different groups of nanodroplets; Figure 2 Image f in the middle is an ultrasonically triggered phase transition image of the targeted drug-loaded nanodroplets;

[0031] Figure 3 These are the results of an in vitro tumor-targeting study of the targeted drug-loaded nanodroplets of this invention; wherein, Figure 3 In the middle section (a), the flow cytometry plot shows the uptake level of CD44+MDA-MB-231 cells after 2 hours of pretreatment with various nanodroplets by flow cytometry. Figure 3 In the middle b, the histogram of semi-quantitative flow cytometry analysis of CD44+MDA-MB-231 cells pretreated with each nanodroplet for 2 hours is shown.

[0032] Figure 4 These are the in vivo tumor targeting experimental results of the targeted drug-loaded nanodroplets of the present invention; wherein, Figure 4 Image a shows real-time biodistribution fluorescence images of drug-loaded nanodroplets and targeted drug-loaded nanodroplets in triple-negative breast cancer-bearing mice at different time points, obtained using the IVIS small animal in vivo fluorescence imaging system. Figure 4 Image b shows fluorescence images of vital organs (heart, liver, spleen, lung, and kidney) and tumors in mice collected 24 hours after drug administration, representing the in vivo distribution of drug-loaded nanodroplets and targeted drug-loaded nanodroplets 24 hours after drug administration.

[0033] Figure 5 Representative contrast-enhanced ultrasound (CEUS) and B-mode ultrasound images of the targeted drug-loaded nanodroplets after ultrasound-triggered phase transition 12 hours after drug administration according to the present invention.

[0034] Figure 6 The results of the in vitro antitumor activity evaluation of the targeted drug-loaded nanodroplets of the present invention;

[0035] Figure 7 This is the in vivo antitumor activity evaluation result of the targeted drug-loaded nanodroplets of the present invention; wherein, Figure 7 In the middle, 'a' represents the tumor volume change curve of in vivo antitumor therapy with targeted drug-loaded nanodroplets (n=6). Figure 7 In the middle b, there is a representative image of the tumor at the endpoint of the treatment experiment (n=6); Figure 7 The middle 'c' is a statistical graph of tumor weight in each group after treatment, representing the endpoint of the treatment experiment. Figure 7 In the figure, d represents the statistical results of tumor inhibition rate of in vivo treatment with targeted drug-loaded nanodroplets; Figure 7 In the middle, e represents the results of H&E staining, Ki-67 immunohistochemical staining, and TUNEL fluorescence staining, used to evaluate changes in tumor tissue morphology, cell proliferation, and apoptosis after intravenous administration; *p<0.05, **p<0.01, ***p<0.001, n=3;

[0036] Figure 8 The results of the in vivo safety study of the targeted drug-loaded nanodroplets of this invention are as follows; wherein, Figure 8 In the middle section, a represents representative H&E stained histological images of the major organs (heart, liver, spleen, lung, and kidney) used to evaluate the in vivo biosafety of the targeted drug-loaded nanodroplets. Figure 8 b and Figure 8 In the middle, c represents the results of serum biochemical index analysis, which is used to evaluate the in vivo nephrotoxicity of targeted drug-loaded nanodroplets; Figure 8 d and Figure 8 In the figure, e represents the results of serum biochemical index analysis, which are used to evaluate the in vivo hepatotoxicity of targeted drug-loaded nanodroplets; Figure 8 f and Figure 8 The result of serum biochemical analysis is used to evaluate the in vivo cardiotoxicity of targeted drug-loaded nanodroplets. Detailed Implementation

[0037] The present invention is as follows Figures 1 to 8As shown, an ultrasound-activated targeted drug-loaded nanodroplet comprises a phase change material, a miRNA drug, and a nanocarrier. The miRNA drug is hsa-miR-136-5p mimic. The guide strand sequence of hsa-miR-136-5p mimic is shown in SEQ ID NO.1: ACUCCAUUUGUUUUGAUGAUGGA, and the guest strand sequence of hsa-miR-136-5p mimic is shown in SEQ ID NO.2: CAUCAUCAAAACAAAUGGAGUUU; (1:1). This hsa-miR-136-5p mimic is a human mature microRNA mimic, and its sequence has been included in the miRBase public database, database accession number: MI0000475. It can be obtained directly from commercial biotechnology companies through routine procurement and is a known commercial reagent in this field. Currently, we obtained it from MedChemExpres (MCE), a commercial biotechnology company, with product number HY-R00263. The surface of the nanocarrier is modified with hyaluronic acid (HA), and the phase change material and miRNA drug are co-encapsulated within the nanocarrier. The hyaluronic acid (HA) can target and bind to the CD44 receptor on the surface of triple-negative breast cancer cells.

[0038] The phase change material is perfluoropentane (PFP).

[0039] The hyaluronic acid (HA) modified nanocarrier is a lipid nanocarrier, and the lipid components of the lipid nanocarrier include DOTAP, cholesterol, and DSPE-PEG-HA or DSPE-PEG-NH2.

[0040] The mass ratio of DOTAP, DSPE-PEG-HA, or DSPE-PEG-NH2 to cholesterol is 3:1:1.

[0041] A method for preparing ultrasound-activated targeted drug-loaded nanodroplets includes the following steps:

[0042] S1. The lipid component is dissolved in an organic solvent, the organic solvent is removed by rotary evaporation under reduced pressure to form a uniform lipid film, and then dried under vacuum.

[0043] S2. Add an aqueous solution containing the phase change material perfluoropentane (PFP), and ultrasonically hydrate under ice bath protection to obtain nanodroplet primary emulsion;

[0044] S3. Intermittent ultrasonic emulsification was performed using an ultrasonic cell disruptor under ice bath protection, followed by filtration and granulation through a filter membrane to obtain targeted blank nanodroplets or blank nanodroplets.

[0045] S4. Incubate the obtained targeted blank nanodroplets or blank nanodroplets with hsa-miR-136-5p mimic to obtain targeted drug-loaded nanodroplets or drug-loaded nanodroplets.

[0046] In step S1, the lipid components include DOTAP, cholesterol, and DSPE-PEG-HA or DSPE-PEG-NH2. The lipid components are dissolved in an organic solvent specifically as follows: DOTAP:DSPE-PEG-HA or DSPE-PEG-NH2:cholesterol = 3:1:1 in analytical grade chloroform.

[0047] In step S2, the volume ratio of perfluoropentane in the aqueous solution is 5%; the ultrasonic hydration under ice bath protection is specifically as follows: ultrasonic hydration is performed for 2-15 minutes using an ultrasonic cleaner under ice bath protection.

[0048] In step S3, the intermittent ultrasonic emulsification time is 5 minutes, and the pore size of the filter membrane is 0.22 μm; in step S4, the incubation time is 20 minutes.

[0049] The application of an ultrasound-activated targeted drug-loaded nanodroplet in the preparation of a drug for treating triple-negative breast cancer, the drug using hsa-miR-136-5p mimic as the active ingredient and also including pharmaceutically acceptable excipients.

[0050] The drug contains perfluoropentane (PFP), which can undergo a liquid-gas phase transition under ultrasound triggering, thereby prompting hsa-miR-136-5p mimic to be released at the tumor site.

[0051] The CD44-targeted ultrasound-responsive phase-change nanodroplets of this invention are characterized by: ① using hsa-miR-136-5p mimic as a therapeutic nucleic acid drug, and encapsulating it together with liquid perfluoropentane (PFP) in a nanocarrier to achieve an integrated design of gene therapy and ultrasound response functions; ② the surface of the nanodroplets is modified with hyaluronic acid (HA), which can specifically recognize and bind to the CD44 receptor highly expressed on the surface of triple-negative breast cancer cells, thereby promoting the active accumulation and endocytosis of nanodroplets at the tumor site and improving the delivery efficiency of nucleic acid drugs; ③ the encapsulated perfluoropentane (PFP) undergoes a liquid-gas phase transition under low-intensity ultrasound, forming microbubbles and inducing the rupture of the nanostructure, achieving precise and spatiotemporally controllable release of hsa-miR-136-5p mimic in the tumor site; ④ the microbubbles generated after the phase transition of perfluoropentane (PFP) can significantly enhance the ultrasound scattering signal, enabling the system to also have diagnostic functions and can be used for real-time visual monitoring of the tumor area and tracking of the treatment process. Therefore, CD44-targeted ultrasonic-responsive phase-change nanodroplets have significant application prospects in nanomedicine, disease diagnosis, and tumor therapy. The preparation method involves synthesizing CD44-targeted ultrasonic-responsive nanodroplets using a thin-film dispersion method. First, multi-chamber nanodroplets are prepared using a thin-film hydration method. Then, their particle size distribution is optimized through a film extrusion granulation process, ultimately obtaining nanodroplets with uniform particle size, good stability, and CD44-targeted and ultrasonic-responsive phase-change properties. The specific steps are as follows:

[0052] 1) Preparation of phase change nanodroplets: ① Weigh an appropriate amount of DOTAP into analytical grade chloroform, gently shake until completely dissolved, concentration range: 5-10 mg / mL; ② Weigh an appropriate amount of cholesterol into analytical grade chloroform, gently shake until completely dissolved, concentration range: 2-5 mg / mL; ③ Weigh an appropriate amount of DSPE-PEG-HA / DSPE-PEG-NH2 into analytical grade chloroform, gently shake until completely dissolved, concentration range: 2-5 mg / mL; ④ Add the cholesterol solution and DSPE-PEG-HA solution to the DOTAP solution, with a concentration ratio of DOTAP:DSPE-PEG-HA / DSPE-PEG-NH2:cholesterol = 3:1:1; ⑤ Remove the organic solvent by rotary evaporation under reduced pressure to obtain a uniform lipid film, and vacuum dry for 24 h; ⑥ Add perfluoropentane aqueous solution and sonicate under ice bath protection; ⑦ Emulsify by intermittent sonication for 5 minutes using an ultrasonic cell disruptor under ice bath protection, and filter and granulate to obtain targeted blank / blank nanodroplets; ⑧ Incubate the nanodroplets with hsa-miR-136-5p mimic to finally obtain targeted drug-loaded / drug-loaded nanodroplets; ⑨ After detecting the shape and size of the nanodroplets by transmission electron microscopy and particle size analyzer, store them in the dark for later use.

[0053] 2) Detection of phase transition imaging of targeted drug-loaded nanodroplets in aqueous solution under ultrasonic excitation: A certain concentration of targeted drug-loaded nanodroplets is placed in a pre-made agarose gel mold and ultrasonicated for 20 seconds and 120 seconds. The intensity of ultrasonic imaging is qualitatively detected under B-ultrasound.

[0054] 3) Evaluation of the tumor targeting ability of targeted drug-loaded nanodroplets: MDA-MB-231 cells in the logarithmic growth phase were targeted with 5×10⁻⁶ nanodroplets. 4 Cells were seeded per well in 6-well plates, with 1 mL of cell suspension added to each well. After incubation overnight at 37°C (containing 5% CO2), DIR-modified targeted drug-loaded nanodroplets were diluted to a certain concentration with culture medium and added to the cells. Control groups were set up (PBS group, non-targeted group with DIR-modified nanodroplets, drug-loaded nanodroplets, and targeted blank nanodroplets). After incubation for another 2 hours, cells were collected and fluorescence intensity was detected by flow cytometry to evaluate the in vitro tumor targeting of the nanodroplets.

[0055] 4) Evaluation of the in vitro antitumor activity of nanodroplets against triple-negative breast cancer cells: MDA-MB-231 cells in logarithmic growth phase were subjected to in vitro antitumor activity of nanodroplets at a concentration of 5 × 10⁻⁶ cells / mL. 4 Cells were seeded per well in 6-well plates, with 1 mL of cell suspension added to each well. After incubation overnight at 37°C (containing 5% CO2), targeted drug-loaded nanodroplets were diluted to the set concentration with complete culture medium and added to the cells. Four groups were set up: PBS group, blank nanodroplet group, targeted blank nanodroplet group, and drug-loaded nanodroplet group. After 2 hours of incubation, the medium was replaced with fresh complete culture medium, and the sonication group was sonicated according to preset parameters. After 24 hours of further culture, CCK8 working solution was added to each well, and the cells were incubated at 37°C in the dark for 1 hour. The absorbance at 450 nm was measured using a multi-mode microplate reader, and the cell viability of each treatment group was calculated based on the absorbance values ​​to evaluate the in vitro antitumor biological activity of the nanodroplets.

[0056] Currently, miRNA / mRNA-based nucleic acid drugs are widely used in tumor gene therapy research. However, naked miRNAs are highly susceptible to degradation by nucleases such as RNases in vivo, and also suffer from short circulating half-lives, easy clearance by the liver and reticuloendothelial system, and weak cell membrane penetration, resulting in insufficient effective concentrations in tumor tissues. Furthermore, after entering cells, nucleic acid drugs are easily degraded by endosomes / lysosomes, further reducing gene regulation efficiency. Therefore, existing miRNA therapy systems generally suffer from insufficient biological stability and low effective delivery efficiency, making it difficult to achieve sustained and efficient anti-tumor effects. Currently used nanodelivery systems are often used as carriers for nucleic acid drugs, such as lipid nanoparticles, polymer nanoparticles, and exosomes. Although these delivery systems can improve the stability of nucleic acid drugs to some extent, most nanocarriers mainly rely on the tumor EPR effect for passive enrichment, lacking active targeting capabilities, thus making it difficult to achieve optimal enrichment at the lesion site. In addition, most existing delivery systems lack exogenous stimulus response characteristics, making the drug release process uncontrollable and prone to premature leakage or insufficient drug concentration at the tumor site. Especially for triple-negative breast cancer, which is highly heterogeneous and has a dense matrix, the tumor penetration and local drug release efficiency of traditional nanosystems are still relatively limited.

[0057] This invention aims to provide an ultrasound-responsive CD44-targeted nucleic acid drug-loaded phase-change nanodroplet and its application in the treatment of triple-negative breast cancer. The system constructs miRNA-loaded nanodroplets by co-loading hsa-miR-136-5p mimic with the phase-change material perfluoropentane (PFP) in a hyaluronic acid-modified nanocarrier. Nano-encapsulation enhances the in vivo stability and circulation time of the miRNA drug, and the specific binding of hyaluronic acid (HA) to the highly expressed CD44 receptor on the surface of triple-negative breast cancer cells enables active targeted enrichment of the nucleic acid drug at the tumor site. Furthermore, this invention utilizes the liquid-gas phase transition property of perfluoropentane (PFP) under ultrasound to achieve drug release locally in the tumor. On one hand, the microbubbles formed by the phase transition enhance the ultrasound imaging signal, enabling real-time imaging monitoring of the tumor area; on the other hand, the phase transition induces the rupture of the nanodroplet structure, thereby promoting the precise and controllable release of hsa-miR-136-5p mimic in situ within the tumor, improving local drug concentration and cellular uptake efficiency. Furthermore, the ultrasound-triggered, spatiotemporally controlled release of hsa-miR-136-5pmimic can significantly increase the expression level of miR-136 in triple-negative breast cancer cells and inhibit tumor cell proliferation, invasion and migration, and maintenance of tumor stemness by targeting and regulating the miR-136 / Smad3 signaling axis, thereby achieving precision gene therapy for triple-negative breast cancer.

[0058] This invention designs and prepares an ultrasound-responsive CD44-targeted nucleic acid drug-loaded phase-change nanodroplet. The system modifies the surface of the nanodroplet with hyaluronic acid (HA) and encapsulates hsa-miR-136-5p mimic and perfluoropentane (PFP) within a lipid core-shell structure. Hyaluronic acid specifically recognizes the highly expressed CD44 receptor on the surface of triple-negative breast cancer cells, enabling active targeted enrichment of nucleic acid drugs at the tumor site. Nanocapsule encapsulation effectively improves the stability and circulation time of miRNAs in vivo. Under exogenous ultrasound, perfluoropentane (PFP) undergoes a liquid-gas phase transition, generating microbubbles to enhance ultrasound imaging signals for real-time tumor imaging. It also causes the nanodroplet to rupture, triggering the precise and controllable release of hsa-miR-136-5p mimic at the tumor site. After release, hsa-miR-136-5p mimic restores miR-136 expression in tumor cells, inhibiting cell proliferation, migration, and tumor stemness by regulating the miR-136 / Smad3 signaling axis.

[0059] This invention constructs an ultrasound-responsive CD44-targeted nucleic acid-loaded phase-change nanodroplet delivery system to achieve precise delivery and controllable release of hsa-miR-136-5p mimic in triple-negative breast cancer, and exerts anti-tumor effects by regulating the miR-136 / Smad3 signaling axis. Specifically, hsa-miR-136-5p mimic is co-encapsulated with perfluoropentane (PFP) in a lipid nanoshell, enabling the same carrier to simultaneously possess gene therapy and ultrasound-responsive functions. Hyaluronic acid (HA) is used to modify the surface of the nanodroplets, utilizing the high affinity of HA for the CD44 receptor to achieve active recognition and efficient internalization of CD44-highly expressed triple-negative breast cancer cells and tumor stem cells. Under ultrasound, perfluoropentane (PFP) undergoes a liquid-gas phase transition, inducing nanodroplet rupture and releasing hsa-miR-136-5p mimic, achieving precise, non-invasive, and spatiotemporally controlled drug delivery to the tumor site. Simultaneously, the microbubbles formed by phase transition can enhance ultrasound contrast signals, enabling real-time visual monitoring of drug delivery and treatment sites, and constructing an integrated diagnostic and therapeutic platform. After release, hsa-miR-136-5pmimic is re-expressed within tumor cells, inhibiting tumor cell proliferation, migration, invasion, and tumor stemness by targeting and inhibiting Smad3 and its downstream pathways. This system not only inhibits primary tumor growth but also significantly reduces lung metastases and lowers the risk of recurrence.

[0060] Example 1 – Synthesis of Nanodroplets

[0061] 1. Dissolve DOTAP:DSPE-PEG-HA:cholesterol in analytical grade chloroform (DSPE-PEG-NH2 is used instead of DOTAP for the non-targeted group) at a mass ratio of 3:1:1, and gently shake until completely dissolved; 2. Remove the organic solvent by rotary evaporation under reduced pressure to obtain a homogeneous lipid membrane, and vacuum dry for 24 h; 3. Add perfluoropentane (PFP) aqueous solution and sonicate under ice bath protection using an ultrasonic cleaner for 2-15 minutes to obtain nanodroplet proemulsion; the perfluoropentane (PFP) aqueous solution contains 950 μL PBS and 50 μL perfluoropentane, 5% (v / v); 4. Perform intermittent sonication for 5 minutes using an ultrasonic cell disruptor under ice bath protection; 5. Filter and granulate using a 0.22 μm filter membrane to obtain targeted blank nanodroplets or blank nanodroplets; 6. Incubate the targeted blank nanodroplets or blank nanodroplets with hsa-miR-136-5p mimic for 20 minutes to promote mRNA... The interaction between mimics and nanodroplets ultimately yields targeted drug-loaded nanodroplets or drug-loaded nanodroplets. The preparation process is as follows: Figure 1 As shown; morphological characterization was performed using a dynamic light scattering instrument and a transmission electron microscope, and the experimental results are as follows. Figure 2 a and Figure 2 As shown in Figure b; the dispersion coefficient and surface charge of the nanodroplets were investigated using a dynamic light scattering instrument, and the experimental results are shown in Figure b. Figure 2 d and Figure 2 As shown in Figure e, the targeted drug-loaded nanodroplets and the drug-loaded nanodroplets are regularly dispersed and uniformly spherical structures.

[0062] Example 2 – Ultrasonic Response Characteristics of Targeted Drug-Loaded Nanodroplets

[0063] Targeted drug-loaded nanodroplets of a certain concentration were prepared and ultrasonically excited. The morphological changes of the nanodroplets after excitation were then observed. The experimental results are as follows: Figure 2 As shown in Figure c; simultaneously, targeted drug-loaded nanodroplets of a certain concentration were placed in a pre-made agarose gel mold and subjected to ultrasonic excitation (recorded at two time points, 20 seconds and 120 seconds respectively). The phase transition and imaging in the solution were recorded using a B-mode ultrasound instrument to verify the effect of the ultrasonic response. The experimental results are shown in Figure c. Figure 2 As shown in Figure f, targeted drug-loaded nanodroplets showed excellent imaging effects after 120 seconds of ultrasound.

[0064] Example 3 – In vitro tumor targeting performance of targeted drug-loaded nanodroplets

[0065] DIR-modified blank nanodroplets, targeted blank nanodroplets, drug-loaded nanodroplets, and targeted drug-loaded nanodroplets were diluted to specific concentrations in culture medium (with a concentration of 20 nM containing hsa-miR-136-5p mimic) and added to triple-negative breast cancer cells. After incubation for 2 hours, the culture medium was replaced with fresh medium, and the results were analyzed by flow cytometry. The experimental results are shown below. Figure 3 As shown, both the targeted blank nanodroplets and the targeted drug-loaded nanodroplets exhibit certain in vitro tumor targeting properties, with the targeted drug-loaded nanodroplets showing better tumor targeting.

[0066] Example 4 – In vivo tumor targeting of targeted drug-loaded nanodroplets

[0067] Drug-loaded nanodroplets modified with DIR and targeted drug-loaded nanodroplets were injected via the tail vein into mice that had been established as a subcutaneous triple-negative breast cancer model. Fluorescence distribution and intensity were then detected at 0, 1, 3, 6, 9, 12, and 24 hours using a small animal in vivo imaging system. After 24 hours, the mice were euthanized, and their hearts, livers, spleens, lungs, kidneys, and tumor tissues were harvested for fluorescence imaging to examine the in vivo distribution of the drug-loaded and targeted drug-loaded nanodroplets and to evaluate their in vivo tumor targeting ability. The experimental results are as follows: Figure 4 As shown, both drug-loaded nanodroplets and targeted drug-loaded nanodroplets have certain tumor targeting properties, with targeted drug-loaded nanodroplets exhibiting better tumor targeting.

[0068] Example 5 – In vivo ultrasound imaging effect of targeted drug-loaded nanodroplets

[0069] Drug-loaded nanodroplets and targeted drug-loaded nanodroplets were injected into triple-negative breast cancer model mice via tail vein injection, respectively. Referring to small animal imaging results, the highest accumulation at the tumor site was observed 12 hours after in vivo administration. At 12 hours post-administration, ultrasound was used to excite the nanodroplets within the tumor, causing a phase transition, and images were acquired using ultrasound. Experimental results are as follows: Figure 5 As shown, targeted drug-loaded nanodroplets produced the most significant ultrasound contrast enhancement signal after 120 s of ultrasound treatment at the tumor site in tumor-bearing mice, demonstrating the best ultrasound imaging performance.

[0070] Example 6 – Evaluation of the in vitro antitumor activity of targeted drug-loaded nanodroplets

[0071] Drug-loaded nanodroplets and targeted drug-loaded nanodroplets were diluted separately with DMEM medium and added to MDA-MB-231 cells in logarithmic growth phase. After incubation at 37°C (containing 5% CO2) for 2 hours, the old medium was replaced with fresh medium, and the cells were sonicated. The cells were then incubated again at 37°C (containing 5% CO2) for 24 hours. CCK8 was then added, and after 1 hour, the absorbance at 450 nm was measured using a multi-mode microplate reader. The in vitro antitumor activity of the nanodroplets was calculated, and the effect of ultrasound response on antitumor activity was evaluated. Experimental results are as follows: Figure 6 As shown, both the ultrasound and non-ultrasound groups of drug-loaded nanodroplets and targeted drug-loaded nanodroplets exhibited certain toxicity to MDA-MB-231 cells. The targeted drug-loaded nanodroplet group showed the best effect, especially after ultrasound, which further promoted tumor cell death.

[0072] Example 7 – Evaluation of the in vivo antitumor activity of targeted drug-loaded nanodroplets

[0073] Triple-negative breast cancer model mice were randomly divided into five groups (n=5 per group): (I) control group, (II) ultrasound only group, (III) targeted blank nanodroplet + ultrasound group, (IV) targeted drug-loaded nanodroplet + ultrasound group, and (V) drug-loaded nanodroplet + ultrasound group. PBS and nanodroplets of each group were injected into the triple-negative breast cancer model mice via the tail vein. Based on small animal imaging results, the highest accumulation at the tumor site was determined 12 hours after drug administration. 12 hours after drug administration, ultrasound was used to excite the nanodroplets within the tumor, causing a phase transition and releasing the miRNA drug. Tumor size was measured every two days after ultrasound treatment, and volume was calculated using the formula: Volume = Length × Width² / 2. The tumor inhibition rate was calculated as: [1 - (average tumor volume of the treatment group / average tumor volume of the control group)] × 100%. Mice were sacrificed on day 18, the tumors were removed, photographed, and weighed. Experimental results are as follows: Figure 7 As shown, both drug-loaded nanodroplets and targeted drug-loaded nanodroplets ultrasound groups exhibited certain inhibitory effects on tumors, with the targeted drug-loaded nanodroplets group showing the best effect, indicating that ultrasound can further inhibit the development of triple-negative breast cancer.

[0074] Example 8 – In vivo safety study of targeted drug-loaded nanodroplets

[0075] After the in vivo treatment experiment, blood was collected in 1.5 mL centrifuge tubes and placed overnight at 4°C. The next day, the supernatant was collected by centrifugation (3000 rpm, 10 min). The levels of AST / ALP, CRE / BUN, or CK / CK-MB in the serum of treated mice were measured using AST / ALP, CRE / BUN, or CK / CK-MB activity assay kits to assess liver, kidney, and cardiac function in the treated mice. Major organs from the treated model mice were paraffin-embedded and sectioned into 8 µm sections. H&E staining was performed to assess the toxicity of the drug and treatment to mouse organs according to the following steps. Experimental results are as follows: Figure 8 As shown, there were no significant differences in the serum AST / ALP, CRE / BUN, or CK / CK-MB levels between the treatment group and the PBS group, and there were no significant differences in H&E staining between the groups. Therefore, the application of targeted drug-loaded nanodroplets in the treatment of triple-negative breast cancer has good safety.

[0076] The key design focus of this invention is:

[0077] First, this invention constructs a CD44-targeted phase-change nanodroplet carrying nucleic acid drugs with ultrasonic response, namely a targeted drug-loaded nanodroplet. This nanodroplet has both stable nucleic acid delivery and efficient loading capabilities. It mainly encapsulates hsa-miR-136-5p mimic through lipid nanodroplets, which can significantly improve its stability, bioavailability and in vivo circulation time, thereby enhancing the delivery efficiency of nucleic acid drugs.

[0078] Secondly, this invention uses hyaluronic acid (HA) to modify the surface of nanodroplets, and utilizes its specific binding with the CD44 receptor highly expressed on the surface of triple-negative breast cancer cells and tumor stem cells to achieve active targeting and improve the enrichment of tumor tissue and cell uptake efficiency.

[0079] Third, this invention induces a liquid-gas phase transition by encapsulating perfluoropentane (PFP) under the action of external ultrasound. The microbubbles generated after the phase transition of PFP can significantly enhance the ultrasound imaging signal. At the same time, the phase transition can enable the nanodroplets to rupture precisely at the tumor site and release hsa-miR-136-5p mimic, achieving non-invasive, visualized and spatiotemporally controllable drug release.

[0080] Fourth, the DSPE-PEG-HA, lipid materials, and perfluoropentane (PFP) used in this invention all have good biocompatibility and degradability, which can effectively reduce systemic toxicity and immune side effects, and their safety is superior to traditional chemotherapy drugs and some cationic polymer carriers.

[0081] Fifth, this invention is the first to organically integrate hsa-miR-136-5p mimic gene delivery, CD44 active targeting, perfluoropentane (PFP) ultrasound-responsive phase transition imaging, and targeted release into the same nanoplatform, forming a complete technical system of "precise delivery - real-time imaging - controlled drug release - gene therapy", which has outstanding innovation and broad clinical translation prospects.

[0082] The above description is merely a preferred embodiment of the present invention and does not constitute any limitation on the technical scope of the present invention. Therefore, any minor modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention shall still fall within the scope of the technical solution of the present invention.

Claims

1. An ultrasound-activated targeted drug-loaded nanodroplet, characterized in that: The invention comprises a phase change material, a miRNA drug, and a nanocarrier. The miRNA drug is hsa-miR-136-5p mimic, with its guide strand sequence shown in SEQ ID NO.1 and its transit strand sequence shown in SEQ ID NO.

2. The nanocarrier is surface-modified with hyaluronic acid, and the phase change material and miRNA drug are co-encapsulated within the nanocarrier. The hyaluronic acid can target and bind to the CD44 receptor expressed on the surface of triple-negative breast cancer cells. The phase change material is perfluoropentane. The hyaluronic acid-modified nanocarrier is a lipid nanocarrier, and the lipid components of the lipid nanocarrier include DOTAP, cholesterol, and DSPE-PEG-HA. The mass ratio of DOTAP, DSPE-PEG-HA to cholesterol is 3:1:1; The method for preparing the ultrasound-activated targeted drug-loaded nanodroplets includes the following steps: S1. The lipid component is dissolved in an organic solvent, the organic solvent is removed by rotary evaporation under reduced pressure to form a uniform lipid film, and then dried under vacuum. S2. Add an aqueous solution containing the phase change material perfluoropentane, and ultrasonically hydrate under ice bath protection to obtain nanodroplet primary emulsion; S3. Intermittent ultrasonic emulsification was performed using an ultrasonic cell disruptor under ice bath protection, followed by filtration and granulation through a filter membrane to obtain targeted blank nanodroplets or blank nanodroplets. In step S3, the intermittent ultrasonic emulsification time is 5 minutes, and the pore size of the filter membrane is 0.22 μm. S4. Incubate the obtained targeted blank nanodroplets or blank nanodroplets with hsa-miR-136-5p mimic to obtain targeted drug-loaded nanodroplets or drug-loaded nanodroplets.

2. The ultrasound-activated targeted drug-loaded nanodroplets according to claim 1, characterized in that: In step S1 of the preparation method, the lipid components include DOTAP, cholesterol, and DSPE-PEG-HA. The lipid components are dissolved in an organic solvent specifically as follows: DOTAP:DSPE-PEG-HA:cholesterol = 3:1:1 in analytical grade chloroform.

3. The ultrasound-activated targeted drug-loaded nanodroplets according to claim 1, characterized in that: In step S2 of the preparation method, the volume ratio of perfluoropentane in the aqueous solution is 5%; the ultrasonic hydration under ice bath protection is specifically performed by ultrasonic hydration for 2-15 minutes under ice bath protection in an ultrasonic cleaner.

4. The ultrasound-activated targeted drug-loaded nanodroplets according to claim 1, characterized in that: The incubation time in step S4 of the preparation method is 20 minutes.

5. The application of the ultrasound-activated targeted drug-loaded nanodroplets as described in claim 1 in the preparation of a medicament for treating triple-negative breast cancer, characterized in that: The drug uses hsa-miR-136-5p mimic as its active ingredient and also includes pharmaceutically acceptable excipients.

6. The application according to claim 5, characterized in that: The drug contains perfluoropentane, which can undergo a liquid-gas phase transition under ultrasound triggering, thereby promoting the release of hsa-miR-136-5p mimic at the tumor site.

Images