Osabcg17 gene and its coded protein in improving rice salt tolerance

Abstract

This invention discloses OsABCG17 The application of genes and their encoded proteins in improving the salt tolerance of rice falls under the field of plant genetic engineering. This invention utilizes cloning rice... OsABCG17 Genes were constructed, overexpression vectors and CRISPR / Cas9 gene editing vectors were created, and transgenic materials were obtained by transformation into rice. Salt tolerance phenotypic analysis revealed that under salt stress, OsABCG17 The fresh weight, dry weight, and survival rate of the overexpression lines were significantly lower than those of the wild type, while OsABCG17 The fresh weight, dry weight, and survival rate of the loss-of-function mutant lines were significantly higher than those of the wild type. Experiments showed... OsABCG17 This gene is a key gene that negatively regulates salt tolerance in rice. Knocking out this gene using gene editing technology can effectively improve the salt tolerance of rice. This invention provides a new gene target and valuable germplasm resources for molecular breeding of salt-tolerant rice.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to rice gene function research and molecular breeding. More specifically, this invention relates to rice. OsABCG17 The function and application of genes in regulating salt tolerance, particularly involving the use of gene editing technology to knock out the gene to obtain rice mutants with improved salt tolerance and their applications. Background Technology

[0002] Rice ( Oryza sativa As a major global food crop, the plant plays a vital role in agricultural production. It is a moderately salt-sensitive crop; when the soluble salt content in the soil or irrigation water reaches 0.3%, it can cause osmotic stress and ion toxicity, leading to inhibited photosynthesis, excessive accumulation of reactive oxygen species, and nutrient imbalance, exhibiting obvious salt damage symptoms such as hindered seedling root development, stunted growth, significantly inhibited development and differentiation, slowed growth rate, and in severe cases, plant death. Simultaneously, plants have evolved a series of molecular and physiological biochemical mechanisms to cope with the harmful effects of salt stress, such as maintaining ion balance, accumulating osmotic regulators, enhancing reactive oxygen species scavenging capacity, and balancing stress responses with growth and development.

[0003] The salt tolerance mechanism of rice involves a complex network of multiple gene regulations and is strongly influenced by the external environment. The physiological processes by which plants adapt to salt stress mainly include ion balance, osmotic balance, reactive oxygen species, and hormone regulation. The molecular mechanisms of plant adaptation to salt stress mainly include signal transduction pathways and transcription factor regulation. A deeper understanding of these mechanisms can advance related sciences, promote the development of basic research, and is crucial for breeding salt-tolerant rice varieties.

[0004] ABC transporters, as a highly conserved transmembrane transport system, possess extremely ancient origins in the history of biological evolution. Most transport various metabolites and signaling molecules in an ATP-dependent manner, and they are widely present in various organisms, playing important roles. The ABCG subfamily, the largest group of ABC transporters, has 52, 45, and 51 coding genes identified in rice, Arabidopsis thaliana, and maize, respectively. Studies have shown that proteins in this subfamily participate in regulating the transmembrane transport of important stress-responsive hormones such as abscisic acid (ABA), jasmonic acid (JA), and salicylic acid (SA). Notably, these transporters play a crucial regulatory role in the tissue-specific accumulation of secondary metabolites and the realization of their physiological functions. Rice ABCG proteins can be divided into two subfamilies: the pleiotropic drug resistance (PDR) subfamily, with a full-size protein (NBD-TMD)2 structure, and the white-brown complex (WBC) subfamily, with a half-size protein NBD-TMD structure. Half-size ABC transporters must form homodimers or heterodimers to effectively perform their transport function. ABCG subfamily proteins play a crucial role in plant physiology and development, and their functions under heavy metal, hormone, and drought stress have been well described.

[0005] Studies have shown that different members of the ABCG family exhibit high functional diversity in regulating rice salt tolerance. For example, OsABCG7 plays a crucial positive regulatory role, and its loss of function leads to a salt-sensitive phenotype in rice (the opposite of OsABCG17 in the application). Members such as OsABCG4, OsABCG30, and OsABCG40 are induced under salt stress and can enhance salt tolerance in yeast experiments (Zhang et al., 2024, Int. J. Mol. Sci.#ABCG Transporters in the Adaptation of Rice to Salt Stresses#20241005). In 2019, researchers identified [a specific type of ABCG transporter] in rice. OsABCG45 / PDR1, OsABCG36 / PDR9 (Abiotic stress) and OsABCG48 / PDR3, OsABCG53 / PDR13 (Biological stress) gene. OsABCG33 and OsABCG37 As Cs + Efflux carriers provide data support for understanding plant resistance to toxic metals. Studies have reported... OsPDR20 Induced by cadmium stress, cytokinins actively participate in the accumulation and balance of cadmium in rice crops, particularly in the roots, stems, and many other organs and tissues. Research at Zhejiang University has introduced the concept of the cytokinin (CK) transport cycle and systematically elucidated its mechanism. OsABCG14 It exists as a homodimer and is responsible for three processes: root assembly, aboveground tissue distribution, and root unloading of CK. Another study showed that... OsABCG5It can form intercellular air channels in plant seedlings, restricting light transmission in cotyledons, thereby helping plants to respond precisely to phototropism. OsABCG36 It is a multifunctional transporter protein that not only participates in the export of the plant growth regulator indole-3-butyric acid (IBA), but is also responsible for the secretion of phytoalexins. This discovery indicates that... OsABCG36 The crucial role of rice in the balance between plant growth and defense. OsABCG18 ( RST31 Salt tolerance in rice can be regulated through the cytokinin pathway. TaABCG2-5B Promoted SA and Cd 2+ This absorption enhances wheat's resistance to Fusarium head blight (FHB).

[0006] In summary, the ABCG family has many members with highly diverse functions, and different members exhibit significant differences in their regulatory directions and mechanisms of action in salt stress response. OsABCG17 It is a member of the rice ABCG family, but its biological function has not yet been elucidated. Currently, there are no publicly available research reports. OsABCG17 The direct relationship between genes and salt tolerance in rice. Therefore, identification OsABCG17 Investigating the function of genes and exploring their role in rice salt stress response is of great significance for enriching the theory of plant salt tolerance and developing new molecular breeding targets. Summary of the Invention

[0007] This invention aims to overcome the shortcomings of existing technologies and provide a novel gene that negatively regulates rice salt tolerance and its application. This invention has experimentally identified and confirmed... OsABCG17 Deletion or inactivation of genes can significantly enhance the salt tolerance of rice.

[0008] To achieve the above-mentioned objectives, the present invention adopts the following technical solution: A method for improving the salt tolerance of rice, the method comprising: using gene editing technology to target specific components in rice... OsABCG17 Genes are knocked out or mutated to reduce the aforementioned OsABCG17 Gene expression levels; wherein, the OsABCG17 The CDS sequence of the gene is shown in SEQ ID NO.1.

[0009] Furthermore, the aforementioned OsABCG17 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.

[0010] Furthermore, the gene editing technology is the CRISPR / Cas9 system.

[0011] Furthermore, the nucleotide sequence of the target site used by the CRISPR / Cas9 system is shown in SEQ ID NO.3.

[0012] The present invention also provides OsABCG17 Application of genes in improving salt tolerance in rice, the application including reducing the salt content of the rice shown in SEQ ID NO.1 OsABCG17 This increases the expression level of genes, thereby improving the salt tolerance of rice.

[0013] Compared with the prior art, the present invention has the following beneficial effects: This invention discloses and verifies OsABCG17 This gene is a key gene negatively regulating salt tolerance in rice. Loss-of-function mutations can significantly enhance salt tolerance in rice seedlings, providing a novel gene target for genetic improvement of rice salt tolerance. Knocking out this gene using gene editing technology can effectively improve the salt tolerance of rice. The obtained... OsABCG17 Loss-of-function mutants are unaffected by growth under normal conditions, but exhibit significantly stronger tolerance (such as higher survival rate and biomass) under salt stress. They are considered "green" salt-tolerant traits and can be directly used as excellent germplasm resources for molecular design breeding of salt-tolerant rice varieties, thus having high application value. Attached Figure Description

[0014] Figure 1 yes OsABCG17 Figure showing the results of relative expression analysis of genes at different time points under salt stress treatment.

[0015] Figure 2 yes OsABCG17 Figure showing the results of relative expression level analysis of gene overexpression lines.

[0016] Figure 3 yes OsABCG17 Gene structure diagram and OsABCG17 Sequencing peak alignment results of gene knockout lines.

[0017] Figure 4 This is a phenotypic comparison of wild-type, overexpression lines, and gene knockout lines under normal conditions and salt stress.

[0018] Figure 5 The chart shows the fresh weight and dry weight of wild-type, overexpression lines and gene knockout lines under normal conditions and salt stress.

[0019] Figure 6 A statistical chart showing the survival rates of wild-type, overexpression lines, and gene knockout lines under normal conditions and salt stress. Detailed Implementation

[0020] To enable those skilled in the art to better understand the technical solutions of this invention, the present application will be further described in detail below with reference to embodiments.

[0021] Example 1: OsABCG17 Analysis of gene expression patterns under salt stress This embodiment is intended to verify OsABCG17 To determine whether genes respond to salt stress and to analyze their expression dynamics.

[0022] 1. Experimental Materials and Processing The experiment used rice ( Oryza sativa Seedlings of the L. variety Huazhan (HZ). After seed disinfection, seeds were germinated at 25℃ and then transferred to 1 / 2 Hogland nutrient solution for hydroponics. Two-week-old seedlings with uniform growth were selected and subjected to salt stress treatment with 1 / 2 Hogland nutrient solution containing 8‰ NaCl (referred to as the salt treatment group). Seedlings cultured in normal 1 / 2 Hogland nutrient solution served as the control (referred to as the 0-hour group). Samples (whole seedlings) were taken at 6, 12, 24, and 48 hours after salt stress treatment, with three biological replicates at each time point. Samples were flash-frozen in liquid nitrogen and stored at -80℃ for later use.

[0023] 2. Total RNA extraction and cDNA synthesis Total RNA was extracted from rice seedling samples at different treatment time points using TRIzol reagent (purchased from Beijing TransGen Biotech Co., Ltd.). RNA concentration and purity were determined using Nanodrop, and RNA integrity was detected by 1% agarose gel electrophoresis.

[0024] Using the TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix kit (purchased from Beijing TransGen Biotech Co., Ltd.), genomic DNA was removed and first-strand cDNA was synthesized following the manufacturer's instructions, using 1 μg of total RNA as a template. The synthesized cDNA was stored at -20°C for later use.

[0025] 3. Real-time quantitative PCR (qRT-PCR) analysis qRT-PCR analysis was performed using TB Green Premix Ex Taq (purchased from Baori Biotechnology (Beijing) Co., Ltd.). Primer sequences are shown in Table 1, qRT-PCR reaction system is shown in Table 2, qRT-PCR reaction procedure is shown in Table 3, and melting curve analysis was performed at the end.

[0026] Table 1 Primer sequence information for qRT-PCR analysis

[0027] Table 2 qRT-PCR reaction system

[0028] Table 3 qRT-PCR reaction procedure

[0029] 4. Data Processing Use 2 -∆∆Ct Method Calculation OsABCG17 Relative gene expression levels. Standardization and statistical analysis were performed using the expression level of the 0-hour control group as a baseline (set as 1).

[0030] qRT-PCR analysis results ( Figure 1 )show, OsABCG17 Gene expression was significantly induced by salt stress. Compared with the 0-hour control, its expression level increased slightly at 6 and 12 hours of stress, reaching a peak at 24 hours of stress, with a significantly upregulated level, approximately 4.5 times that of the control (P<0.01), indicating that the expression level of this gene was induced and upregulated in the early stage of salt stress. The above results demonstrate that... OsABCG17 It is a salt stress response gene.

[0031] Example 2: OsABCG17 Construction and genetic transformation of gene overexpression vectors This embodiment aims to obtain OsABCG17 Transgenic rice materials with gain-of-function (overexpression) genes.

[0032] 1. Gene cloning and overexpression vector construction Based on the sequence information published in the National Rice Database (https: / / ricedata.cn / gene / ), obtain OsABCG17 The complete coding sequence (CDS, SEQ ID NO.1) of the (LOC_Os07g18874) gene, described OsABCG17 The encoded amino acid sequence is shown in SEQ ID NO.2. Amplification primers carrying the vector sequence were designed in Snapgene software (Table 4), and PCR amplification was performed according to the reaction system shown in Table 5 and the reaction procedure shown in Table 6.

[0033] Table 4 Primer sequence information for qRT-PCR analysis

[0034] Table 5 PCR reaction system

[0035] Table 6 PCR Reaction Procedure

[0036] The PCR products were purified by agarose gel electrophoresis and then sequenced for verification. Products with correct sequencing were... OsABCG17 CDS fragments and classic Xba I and Sal The linearized plant overexpression vector pCambia1300 (with a hygromycin resistance selection marker) was ligated using a double enzyme digestion method. The ligation product was transformed into E. coli DH5α competent cells, plated on LB agar plates containing the appropriate antibiotics, positive clones were screened, and plasmids were extracted and sequenced to obtain the recombinant overexpression vector pCambia1300-OsABCG17.

[0037] 2. Genetic transformation The correctly constructed recombinant overexpression vector pCambia1300-OsABCG17 was transformed into competent cells of Agrobacterium tumefaciens strain GV3101.

[0038] The specific genetic transformation process is as follows: (1) Remove the husk from the rice seeds, disinfect them with alcohol for 2 minutes, disinfect them with 3% sodium hypochlorite for 15 minutes, wash them with sterile water 4-5 times, drain the water, spread them flat on sterilized filter paper and dry them. Transfer the dried seeds to the induction medium and incubate them in the dark at 30°C for 2 weeks to induce the production of callus tissue.

[0039] (2) Streak the Agrobacterium tumefaciens strain GV3101 containing the target gene on an LB agar plate containing the corresponding antibiotic, and incubate at 28°C for 2 days. Inoculate about one loopful of Agrobacterium into 100 ml of suspension medium, and incubate at 28°C and 200 rpm for 30 min on a constant temperature shaker. The concentration of Agrobacterium suspension should be about OD600 = 0.3.

[0040] (3) Collect the callus tissue into a 250 ml sterile Erlenmeyer flask, pour the prepared Agrobacterium suspension into the Erlenmeyer flask containing the callus tissue until all the callus tissue is submerged, and let stand for 10 min.

[0041] (4) Drain the bacterial solution, spread the callus on the filter paper of a sterile dish, and let it air dry for 1-2 hours.

[0042] (5) Use tweezers (or a spoon) to transfer the dried callus particles to the co-culture medium (do not move the callus after it has been transferred to the co-culture medium to reduce the contact between the medium and the callus surface and prevent the overgrowth of Agrobacterium), and seal with sealing glue.

[0043] (6) Co-cultured at 28 °C in the dark for 3 days.

[0044] (7) Transfer the co-cultured callus to a water washing cup, pour in sterile distilled water until the callus is completely submerged, cover and shake for 20-30 seconds, then discard the sterile distilled water. Repeat this water washing process 3-4 times.

[0045] (8) Drain the water from the callus tissue, transfer it to the selection medium and culture it in the dark for 20 days. Observe whether fresh, tender yellow resistant callus grows. If there is still no resistant callus, continue to transfer the culture to a plate for a second selection culture.

[0046] (9) Select small pieces of light yellow, dense, dry, and vigorous resistant callus and place them in differentiation medium. Culture them under light (28°C, 14 h light / 10 h dark) for 30-40 days. Once the differentiated seedlings are 3-5 cm tall, they can be cultured for rooting.

[0047] (10) Root culture in a light culture room for 15-20 days. After the new roots have grown sufficiently, transplant them.

[0048] The regenerated T0 generation seedlings were transplanted to a greenhouse, and overexpression was verified by qRT-PCR. OsABCG17 strains OsABCG17 Gene expression levels.

[0049] qRT-PCR detection showed ( Figure 2 Under normal growth conditions, overexpression OsABCG17 strains OsABCG17 The gene expression levels were significantly higher than those of the wild type (HZ) (named ABCG17-1# and ABCG17-2#), indicating successful overexpression.

[0050] Example 3: OsABCG17 Construction and genetic transformation of gene editing vectors This embodiment aims to obtain OsABCG17 Genetically modified rice materials with loss of gene function (gene editing).

[0051] 1. Construction of gene editing vectors Using CRISPR / Cas9 gene editing technology, targeting OsABCG17 The gene design target site (SEQ ID NO.3, CTGAGAACGCCAGGAACCCC) is shown. After linearization of the intermediate vector pYLgRNA-U3 with BsaⅠ restriction endonuclease, it was ligated to the U3 promoter and then linked to the genome-directed editing vector pYLCRSPR / Cas9-MT using a cleavage-ligation-while-ligating approach. Targeted editing was obtained through E. coli transformation, positive clone amplification culture, plasmid extraction, and sequencing identification. OsABCG17 The gene editing vector pYLgRNA-OsABCG17.

[0052] 2. Genetic transformation The correctly constructed gene-editing vector pYLgRNA-OsABCG17 was transformed into Agrobacterium tumefaciens (…). Agrobacterium tumefaciens ) competent cells of strain EHA105.

[0053] The genetic transformation process is the same as in Example 2.

[0054] The regenerated T0 generation seedlings were transplanted to a greenhouse, and the genomic DNA of the gene knockout line was extracted. The target region was amplified and sequenced to identify the mutation type.

[0055] Sequencing results showed ( Figure 3 In the abcg17-1# strain, an adenine (A) insertion occurred at the target site, resulting in a frameshift mutation; in the abcg17-2# strain, a 27-base deletion occurred near the target site, also resulting in a frameshift mutation. These mutations are expected to cause loss of function of the OsABCG17 protein.

[0056] Example 4: Evaluation of salt tolerance in transgenic rice materials This embodiment aims to evaluate the regulatory function of the OsABCG17 gene on salt tolerance in rice.

[0057] 1. Materials and Stress Management Experimental materials: Wild-type Huazhan (HZ), two OsABCG17 Overexpression lines (ABCG17-1#, ABCG17-2#), and two OsABCG17 Gene-edited mutant lines (abcg17-1#, abcg17-2#).

[0058] Select plump T1 generation seeds, disinfect and germinate them, then hydroponically culture them in 1 / 2 Hoagland nutrient solution at 28℃ / 25℃ (day / night) with 14 hours of light until they reach the two-leaf-one-heart stage (approximately 14 days). Select seedlings with uniform growth and randomly divide them into two groups: the control group continues to be cultured in normal nutrient solution; the salt stress group is treated with 1 / 2 Hoagland nutrient solution containing 140 mM NaCl. The nutrient solution is changed every 3 days.

[0059] 2. On the 4th day of treatment, the fresh weight of the seedlings was measured, and then they were placed in an 80℃ drying oven until their weight remained constant, and their dry weight was recorded. After 7 days of salt stress treatment, all seedlings were transferred to normal nutrient solution for 7 days of rehydration. After rehydration, the survival rates of overexpression, mutants, and wild-type were calculated. The materials for each treatment (HZ, ABCG17-1#, ABCG17-2#, abcg17-1#, abcg17-2#) were randomly arranged, with five replicates.

[0060] The results show that ( Figure 4 , Figure 5 , Figure 6 Under normal growth conditions, the overexpression mutant and the wild type showed the same phenotype, with no significant difference in fresh weight and dry weight, indicating that... OsABCG17 Gene overexpression or loss of function did not affect the basic growth and development of rice under normal conditions. Under 140 mM NaCl stress, growth was inhibited in all materials, showing significant differences. Compared to the wild type: the two overexpression lines (ABCG17-1#, ABCG17-2#) exhibited stronger salt-sensitivity phenotypes, with more severe leaf wilting, curling, and chlorosis; while the two gene-edited mutant lines (abcg17-1#, abcg17-2#) exhibited stronger salt tolerance phenotypes, with leaves remaining relatively unfurled and less yellowing. After 7 days of salt treatment followed by 7 days of rehydration, the overexpression lines... ABCG17-1# and ABCG17-2# The survival rate of mutants was significantly lower than that of wild-type mutants. abcg17-1# and abcg17-2# Survival rates were significantly higher in overexpression lines than in wild-type lines. ABCG17-1# and ABCG17-2# Both fresh weight and dry weight were significantly reduced compared to the wild type; the mutant abcg17-1# and abcg17-2# Both fresh weight and dry weight were significantly higher than those of the wild type.

[0061] The above results indicate that overexpression OsABCG17 The gene significantly reduced the salt tolerance of rice, while knocking out the gene significantly enhanced the salt tolerance of rice. This fully demonstrates... OsABCG17 This gene is a key gene that negatively regulates salt tolerance in rice. By creating loss-of-function mutants of this gene, the salt tolerance of rice varieties can be effectively improved.

Claims

1. A method for improving the salt tolerance of rice, characterized in that, The method includes: using gene editing technology to manipulate rice... OsABCG17 Gene knockout or loss-of-function mutations are used to improve the salt tolerance of rice; wherein, the... OsABCG17 The CDS sequence of the gene is shown in SEQ ID NO.

1. OsABCG17 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

2. The method according to claim 1, characterized in that, After knocking out the OsABCG17 gene using gene editing technology, the survival rate and biomass of rice under salt stress conditions were significantly higher than those of the wild type.

3. The method according to claim 1 or 2, characterized in that, The gene editing technology used is the CRISPR / Cas9 system.

4. The method according to claim 3, characterized in that, The nucleotide sequence of the target site used by the CRISPR / Cas9 system is shown in SEQ ID NO.

3.

5. OsABCG17 The application of genes in improving salt tolerance in rice is characterized by, The application includes using the CRISPR / Cas9 system to analyze the rice sample represented by SEQ ID NO.

1. OsABCG17 Gene knockout or loss-of-function mutations are used to improve the salt tolerance of rice.

Images