A method for obtaining a rice apomixis system by using a DMP gene editing
Patent Information
- Application Number
- CN202610979474.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-02
- Publication Date
- 2026-09-08
- Estimated Expiration
- 2046-07-02
AI Technical Summary
然而,可供选择的有效DMP基因资源仍然有限,不同DMP基因在诱导孤雌生殖方面的效果存在差异
(1)进一步扩展了有效的DMP基因资源:在发明人前期已发现两个DMP基因有效的基础上,本发明首次验证了OsDMP2、OsDMP6和OsDMP14这三个此前未知的DMP家族成员,同样能够与MiMe体系有效组合,成功诱导水稻无融合生殖。这充分证明了该组合策略在DMP家族中的普遍适用性,为育种应用提供了更多可选择的基因靶点。
Smart Images

Figure CN122466003B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biotechnology and plant breeding, and is a method for obtaining a rice apomixis system using DMP gene editing. Background Technology
[0002] Utilizing heterosis is a core technology for significantly improving rice yield, stress resistance, and yield stability. However, severe phenotypic segregation occurs in the self-pollination offspring of F1 hybrid rice, directly leading to the loss of heterosis. Therefore, hybrid seed production must be carried out annually. The existing hybrid rice seed production process is cumbersome, costly, and its effectiveness is easily affected by extreme weather and geographical conditions, which significantly limits the further promotion and large-scale application of hybrid rice heterosis.
[0003] Apomixis is a form of asexual reproduction that occurs directly through seeds without the fertilization of male and female gametes. It allows hybrid offspring to fully retain the heterozygous genotype and heterosis of the parents, representing a disruptive core technology for solving the challenges of hybrid rice seed production. Current technologies in this field utilize a combination of the MiMe (Mitosis instead of Meiosis) strategy and haploid induction strategy to construct apomixis systems. The MiMe strategy simultaneously knocks out three key meiotic genes (such as OsPAIR1, OsREC8, and OsOSD1 in rice), transforming meiosis into a process similar to mitosis, producing diploid gametes with the same genotype as the parents. This solves the core problem of hybrid genotype recombination and segregation. However, the MiMe system alone cannot achieve parthenogenesis; its diploid male and female gametes, after normal fertilization, produce tetraploid offspring with severely unstable ploidy, failing to achieve stable inheritance of heterosis. Haploid induction strategies can induce female gametes to develop autonomously into mature embryos. Examples include MTL, BBM1, and BELL genes; knockout or ectopic expression of these genes can induce haploid production. Currently, apomixis systems mainly fall into two combination strategies: MiMe + ectopic expression and MiMe + gene knockout. The MiMe + ectopic expression strategy has achieved breakthrough progress, generally yielding systems with high seed setting and cloning efficiency. However, this strategy contains transgenic components, making commercial application difficult in the short term. The MiMe + gene knockout strategy, obtained by knocking out four endogenous genes, allows for the subsequent selection of non-transgenic clones. However, this strategy suffers from low seed setting and low cloning efficiency, necessitating the search for new haploid induction genes to optimize existing apomixis systems.
[0004] In rice, current techniques have only verified the haploid-inducing function of two specific members of the rice DMP gene family, OsDMP8 and OsDMP13. Existing research shows that the biological functions of different members of the DMP gene family are significantly differentiated. For example, most DMP genes in Arabidopsis are related to apoptosis, such as AtDMP1, AtDMP3, and AtDMP4 genes, which mainly regulate plant senescence; AtDMP7 gene, which mainly regulates fruit dehiscence; and AtDMP2, which regulates leaf abscission (Kasaras A, Kunze R. Expression, localisation and phylogeny of a novel family of plant-specific membrane proteins. Plant Biol (Stuttg). 2010 Sep;12 Suppl 1:140-52.). Therefore, the functions of different members within the same DMP family are not convergent; the presence of haploid-inducing function in one member does not necessarily imply that other members have the same function. In fact, Chinese patent CN120485274A also clearly points out that: "The protein DMP does not only have the function of regulating plant haploid induction. Obviously, there is no unique corresponding relationship between the function of regulating plant haploid induction and the protein DMP." "Those skilled in the art cannot directly associate the OsDMP gene with the function of regulating plant haploid induction ability, and further research is needed."
[0005] Therefore, whether other members of the rice DMP family, besides OsDMP8 and OsDMP13, have the function of synergistically constructing apomixis systems with the MiMe system, especially whether they can achieve heterosis fixation while maintaining a high seed setting rate, remains an unsolved mystery in this field. The limited availability of effective DMP gene resources severely restricts the optimization and widespread application of the "MiMe + gene knockout" apomixis system.
[0006] This invention addresses the aforementioned technological gap by focusing on the discovery of novel haploid-inducing genes to optimize existing MiMe+ gene knockout combination strategies for apomixis. While the inventors previously discovered that combining the MiMe system with the knockout of two specific OsDMP family genes (such as OsDMP8 and OsDMP13) can achieve apomixis to a certain extent (Patent No. ZL 2025 1 0976754.9), the available effective DMP gene resources remain limited, and different DMP genes exhibit varying effects in inducing parthenogenesis. Therefore, further discovery and verification of more DMP family members that can synergize with the MiMe system and efficiently induce apomixis, thereby enriching the technical solutions and improving the system's stability and applicability, is a current technical problem that needs to be solved. Summary of the Invention
[0007] This invention aims to overcome the shortcomings of existing technologies and provide a method for obtaining a rice apomixis system using DMP gene editing, which can achieve stable fixation of heterosis in rice. To achieve the above objective, this invention includes the following steps: A method for obtaining a rice apomixis system using DMP gene editing includes the following steps: Step 1: Construct expression cassettes for four target sites of rice genes OsPAIR1, OsREC8, OsOSD1, and OsDMP, specifically: the OsDMP gene is either OsDMP2, OsDMP6, or OsDMP14; the CDS sequences of the six genes OsPAIR1, OsREC8, OsOSD1, OsDMP2, OsDMP6, and OsDMP14 are shown in SEQ ID NO. 1-6; the target site sequences of the six genes OsPAIR1, OsREC8, OsOSD1, OsDMP2, OsDMP6, and OsDMP14 are shown in SEQ ID NO. 7-12. Step 2: The expression cassette is transformed into hybrid rice using Agrobacterium-mediated transformation to obtain T0 generation plants; Step 3: Select T0 generation plants in which the four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP are all homozygous knocked out, and obtain seeds through self-pollination. Step 4: Germinate the seeds obtained from self-pollination in Step 3. Use flow cytometry and genome sequencing to detect plants in which the four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP are homozygous knocked out, and screen to obtain rice plants with apomixis.
[0008] Furthermore, in step one, the specific method for obtaining the expression box is as follows: 1) Design target sequences based on the coding regions of the four genes OsPAIR1, OsREC8, OsOSD1, and OsDMP; 2) The target sequences were integrated into the SK-gRNA vectors to obtain four intermediate vectors: SG1, SG2, SG3, and SG4. 3) The four intermediate vectors SG1, SG2, SG3 and SG4 were ligated to the backbone vector pC1300-Cas9 containing CRISPR / Cas9 expression elements using the enzyme digestion and ligation method to obtain the expression cassette.
[0009] Furthermore, in step two, the Agrobacterium-mediated method utilizes the genetic transformation method mediated by Agrobacterium EHA105 strain.
[0010] Furthermore, the genetically transformed hybrid rice variety is the indica-japonica hybrid rice variety Chunyou 84.
[0011] Further, in step three, the specific steps for screening T0 generation plants in which the four genes OsPAIR1, OsREC8, OsOSD1, and OsDMP are all homozygous knocked out are as follows: First, based on the gene sequences of OsPAIR1, OsREC8, OsOSD1, and OsDMP, Hi-TOM detection primers PAIR1-Hi-F / R, REC8-Hi-F / R, OSD1-Hi-F / R, and DMP-Hi-F / R are designed. Then, the T0 generation transgenic plants are amplified. Finally, the mutation types of the four genes in all plants are detected using the Hi-TOM system, and transgenic plants in which the four genes are homozygous knocked out are screened.
[0012] Furthermore, in step four, flow cytometry and genome sequencing are used to detect plants in which the four genes OsPAIR1, OsREC8, OsOSD1, and OsDMP are homozygous knocked out, and rice plants with apomixis are screened out. The specific steps are as follows: 1) The ploidy of plants in which the four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP were homozygous knocked out was detected by flow cytometry, and plants with diploid ploidy were selected. 2) The diploid plants were tested using genome sequencing technology, and plants with fixed genotypes were selected.
[0013] The beneficial effects of this invention are: (1) Further expansion of effective DMP gene resources: Based on the inventors' previous discovery of two effective DMP genes, this invention verifies for the first time that three previously unknown DMP family members, OsDMP2, OsDMP6, and OsDMP14, can also be effectively combined with the MiMe system to successfully induce rice apomixis. This fully demonstrates the universal applicability of this combination strategy in the DMP family and provides more gene targets for breeding applications.
[0014] (2) Successful fixation of heterosis: Using the method provided in this invention, T0 generation plants with homozygous knockout of OsPAIR1, OsREC8, OsOSD1 and OsDMP2, OsDMP6 or OsDMP14 were obtained in the indica-japonica hybrid rice variety 'Chunyou 84'. The diploid plants selected from their offspring were verified by genome sequencing, and their whole genome genotype was completely consistent with the hybrid parent 'Chunyou 84', and their growth and development phenotypes were normal. This fully demonstrates that the newly discovered DMP genes (OsDMP2, OsDMP6 and OsDMP14) combined with MiMe can also effectively fix heterosis in hybrid rice.
[0015] (3) High fertility: Compared with the problem of a significant decrease in seed setting rate that is common in existing apomixis systems, the seed setting rates of the multiple independent lines obtained in this invention (such as apo-DMP2, apo-DMP6, and apo-DMP14) reached 74.41%, 64.92%, and 75.9%, respectively. Although slightly lower than the wild type (83.18%), they still remain at a high level acceptable for agricultural production and have a good agronomic trait basis.
[0016] (4) Verification of the universality of the strategy: Through successful verification on multiple OsDMP family members (DMP2, DMP6, DMP14), this invention further confirms the universality and reliability of the "MiMe + DMP" combination strategy in inducing rice apomixis, providing important technical reference and gene resources for discovering and applying homologous DMP genes in other crops and constructing efficient apomixis systems.
[0017] In summary, based on the previous discovery of two effective DMP genes, this invention further discovers three new DMP genes with the same function, overcoming the limitation of limited effective gene resources in existing technologies, enriching the technical solutions for achieving apomixis, and having important application value for the fixation and utilization of heterosis in hybrid rice and other crops. Attached Figure Description
[0018] Figure 1 It is a carrier map.
[0019] Figure 2It is a test for mutation types in transgenic plants.
[0020] Figure 3 These are data on the seed setting rate and cloning efficiency of transgenic plants.
[0021] Figure 4 This is a phenotypic diagram of a transgenic T0 plant.
[0022] Figure 5 It is a flow cytometry screening for diploids.
[0023] Figure 6 It is genome sequencing data.
[0024] Figure 7 It is a phenotypic diagram of a cloned plant. Detailed Implementation
[0025] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.
[0026] Example 1: Rice apomixis system composed of OsDMP2 and MiMe system 1. Expression Box Construction A vector was constructed to co-knock out four endogenous genes in rice: OsPAIR1, OsREC8, OsOSD1, and OsDMP2. The target sites of these four endogenous genes were then ligated into the backbone vector pC1300-Cas9, which contains CRISPR / Cas9 expression elements, to obtain the expression cassette. The specific construction method is as follows: (1) Target sequences were designed based on the coding regions of the four genes OsPAIR1, OsREC8, OsOSD1, and OsDMP2. The primers are as follows: OsPAIR1++:GGCAAAGCAACCCAGTGCACCGC (SEQ ID NO.13); OsPAIR1--:AAACGCGGTGCACTGGGTTGCTT (SEQ ID NO.14); OsREC8++: GGCACGGAGAGCCTTAGTGCCAT (SEQ ID NO.15); OsREC8--:AAACATGGCACTAAGGCTCTCCG (SEQ ID NO.16); OsOSD1++: GGCACTGCCGCCGACGAGCAACA (SEQ ID NO.17); OsOSD1--:AAACTGTTGCTCGTCGGCGGCAG (SEQ ID NO.18); OsDMP2++: GGCAAGTCGTCAGGCAGAGGCCAA (SEQ ID NO. 19); OsDMP2--:AAACTTGGCCTCTGCCTGACGACT (SEQ ID NO. 20).
[0027] (2) The backbone vector SK-gRNA was digested with enzymes: COMPONENT 50 µl REACTION SK-gRNA 2 µg 10 x Buffer Aar I 5 µl Aar I 1 µl 50 x oligonucleotide 1 µl Nuclease-free Water to 50 µl The enzyme was digested at 37°C for 5 hours, and the product was purified using a recovery kit to obtain SK-gRNA digest.
[0028] (3) Primer annealing to form double strands The synthesized primers (g++ and g-) were diluted with water to a concentration of 100 µM. 20 µL of g++ and g--g were mixed together and incubated at 100°C for 5 minutes. After incubation, the mixture was allowed to cool naturally to room temperature.
[0029] (4) The target sequence was integrated into the SK-gRNA vector to obtain four intermediate vectors: SG1, SG2, SG3 and SG4. COMPONENT 10 µl REACTION SK-gRNA cleavage 30 ng 10 x T4 ligase Buffer 1 µl T4 ligase 0.5 µl 7 µl of primer annealing product Nuclease-free Water to 10 µl Connect at 25°C for 1 hour to allow for conversion.
[0030] (5) Transformation of recombinant products: Thaw the chemocompetent cells used for cloning on ice; add 10 µl of recombinant product to 500 µl of competent cells, gently tap the tube wall to mix, and incubate on ice for 30 min; heat shock in a 42°C water bath for 45 sec, then immediately cool on ice for 2 min; add 900 µl of LB medium (without antibiotics), and incubate at 37°C for 1 h (200 rpm); centrifuge at 5,000 rpm for 1 min, resuspend 100 µl, and spread on plates corresponding to the antibiotics; incubate upside down at 37°C for 12–16 h. Positive clones were detected by colony PCR and sent to the company for sequencing. Sequencing primer T3: ATTAACCCTCACTAAAGGGA (SEQ ID NO. 21).
[0031] (6) The four intermediate vectors SG1, SG2, SG3 and SG4 were digested with enzymes: COMPONENT 50 µl REACTION SG1 1 µg 10X rCutSmart Buffer 5 µl (1X) KpnI-HF 20 units BglII 20 units Nuclease-free Water to 50 µl The enzyme was digested at 37°C for 5 hours, and the product was purified using a recovery kit to obtain SG1 digest.
[0032] COMPONENT 50 µl REACTION SG2 1 µg 10X rCutSmart Buffer 5 µl (1X) BamHI-HF 20 units NheI-HF 20 units Nuclease-free Water to 50 µl The enzyme was digested at 37°C for 5 hours, and the product was purified using a recovery kit to obtain SG2 digest.
[0033] COMPONENT 50 µl REACTION SG3 1 µg 10X rCutSmart Buffer 5 µl (1X) XbaI 20 units SalI-HF 20 units Nuclease-free Water to 50 µl The enzyme was digested at 37°C for 5 hours, and the product was purified using a recovery kit to obtain SG3 digest.
[0034] COMPONENT 50 µl REACTION SG4 1 µg 10X r3.1 Buffer 5 µl (1X) XhoI 20 units BglII 20 units Nuclease-free Water to 50 µl The enzyme was digested at 37°C for 5 hours, and the product was purified using a recovery kit to obtain SG4 digest.
[0035] (7) The vector backbone pC1300-Cas9 was digested with enzymes: COMPONENT 50 µl REACTION pC1300-Cas9 1 µg 10X rCutSmart Buffer 5 µl (1X) KpnI-HF 20 units BamHI-HF 20 units Nuclease-free Water to 50 µl The enzyme was digested at 37°C for 5 hours, and the product was purified using a recovery kit to obtain pC1300-Cas9 digest.
[0036] (8) Expression box construction: COMPONENT 10 µl REACTION pC1300-Cas9 cut 100 ng SG1 cut 8 ng SG2 cut 8 ng SG3 cut 8 ng SG4 cut 8 ng 10 x T4 ligase Buffer 1 µl T4 ligase 0.5 µl Nuclease-free Water to 10 µl Connect at 25°C for 1 hour to allow for conversion.
[0037] (9) Transformation of recombinant products: Thaw the chemocompetent cells used for cloning on ice; add 10 µl of recombinant product to 500 µl of competent cells, gently tap the tube wall to mix, and incubate on ice for 30 min; heat shock in a 42°C water bath for 45 sec, then immediately cool on ice for 2 min; add 900 µl of LB medium (without antibiotics), and incubate at 37°C for 1 h (200 rpm); centrifuge at 5,000 rpm for 1 min, resuspend 100 µl, and spread on plates corresponding to the antibiotics; incubate upside down at 37°C for 12–16 h. Positive clones were detected by colony PCR and sent to the company for sequencing. Sequencing primers pC1300-F: acactttatgcttccggctc (SEQ ID NO. 22).
[0038] 2. Genetic transformation The cloning vector sequencing was correct, and the next step was to conduct Agrobacterium-mediated transformation experiments. The indica-japonica hybrid rice variety Chunyou 84 (CY84) was transformed using the Agrobacterium EHA105 strain-mediated genetic transformation method to obtain transgenic material. The seeds were dehulled, disinfected with 75% ethanol for 1 min, the ethanol was discarded, and 2% sodium hypochlorite solution was added for disinfection for 20 min, during which time the seeds were placed on a shaker. The sodium hypochlorite solution was discarded in a clean bench, and the seeds were rinsed 4-5 times with sterile water. The seeds were then placed on sterilized filter paper to absorb excess moisture. Subsequently, the seeds were inoculated onto N6 mature embryo callus induction medium and cultured in the dark at 28℃ for approximately one month. Well-formed embryogenic callus was selected and subcultured 2-3 times. Embryogenic callus from the second subculture, 3-5 days after the second subculture, was selected for transformation.
[0039] Embryogenic callus was immersed in activated Agrobacterium tumefaciens EHA105 bacterial suspension (containing acetylsyleugenol) with the target plasmid for 30 min. The callus tissue was washed several times with sterile water, dried in a laminar flow hood to remove residual liquid, and then co-cultured at 19°C for 2-3 days. It was then transferred to selection medium supplemented with antibiotics containing selection markers for selection. Each selection process lasted 2 weeks, and after 2-3 rounds of selection, newly grown callus tissue was obtained. The newly grown callus tissue was then transferred to pre-differentiation medium and cultured for 7 days, followed by differentiation medium. It was cultured at 25°C under a 16 h / d light intensity for approximately 10 days, until green spots appeared, at which point regenerated plantlets were obtained. The differentiated transgenic seedlings had their roots cut off and were placed in rooting medium for 2-3 weeks. Then, the sealing film was removed, water was added, and the seedlings were hardened off for 1 week before transplanting.
[0040] 3. Mutation detection in transgenic T0 plants The method for screening T0 generation plants with homozygous mutations in all four genes, OsPAIR1, OsREC8, OsOSD1, and OsDMP2, is as follows: Hi-TOM detection primers were designed based on the gene sequences of OsPAIR1, OsREC8, OsOSD1, and OsDMP2. The primer sequences are as follows: PAIR1-Hi-F: ggagtgagtacggtgtgccttcttgcgcgcgagaagagtctc (SEQ ID NO. 23); PAIR1-Hi-R: gagttggatgctgagtggggagatgtagtgcgtgggtcttg (SEQ ID NO. 24); REC8-Hi-F:ggagtgagtacggtgtgcttgggttagtgaggagat (SEQ ID NO. 25); REC8-Hi-R: gagttggatgctgagtggtgcgatcggaactatggagac (SEQ ID NO. 26); OSD1-Hi-F: ggagtgagtacggtgtgctatcaggaggacgacgtcgccg (SEQ ID NO. 27); OSD1-Hi-R: gagttggatgctgagtggctcctcctcttgggtgtagc (SEQ ID NO. 28); DMP2-Hi-F: ggagtgagtacggtgtgcTCCAAGAACAATCCAGTGAT (SEQ ID NO. 29); DMP2-Hi-R: gagttggatgctgagtggCCAGCTTGCTTACCTACC (SEQ ID NO. 30).
[0041] The above four primer pairs were used to perform PCR amplification on T0 generation transgenic plants. The mutation types of the four genes in all plants were detected using the Hi-TOM system, and transgenic plants with homozygous mutations in all four genes were screened.
[0042] 4. Plant ploidy and genotype identification Flow cytometry and genome sequencing were used to analyze the progeny of materials with homozygous mutations in all four T0 genes, and plants with fixed heterosis were screened. Specifically: (1) Flow cytometry was used to identify the ploidy of progeny plants from materials with homozygous mutants of all four genes. The specific experimental procedure was as follows: Fresh rice leaves, 4-5 cm long and grown for 10 days, were cut and placed in a glass dish. 1 ml of plant lysis buffer LB01 was added, and the tissue was quickly minced vertically downwards with a blade. The lysis buffer was aspirated from the dish and filtered through a 50 µm nylon mesh into centrifuge tubes. The tube caps were labeled with the sample name. The tubes were centrifuged at 1,200 rpm for 5 min at 4°C in a benchtop refrigerated centrifuge. The centrifuge tubes were gently removed, and the supernatant was slowly aspirated. 450 µl of LB01, 25 µl of pre-chilled PI, and 25 µl of RNase A were added. The tubes were stained at 4°C in the dark for 10 min. Detection was performed using BD Accuri C6 assay. If the tissue was diploid, the peak value should be consistent with the wild-type peak.
[0043] The specific reagent formula is as follows: Lysis buffer LB01: Tris 363.4 mg, Na2EDTA 148.9 mg, Sperminetetrahydrochloride 34.8 mg, KCl 1.193 g, NaCl 233.8 mg, Triton X-100 200 µl, bring to a final volume of 200 mL, adjust pH to 7.5 with 1M HCl, and add 220 µl of β-mercaptoethanol in a fume hood. Sterilize and dispense via vacuum filtration using a 0.22 µm filter in a clean bench, and store at -20°C.
[0044] Propidium iodide (PI) stock solution (1 mg / ml): Weigh 50 mg of powder and dissolve it in 50 mL of ddH2O; sterilize and dispense the solution by filtration through a 0.22 μm filter in a clean bench and store at -20℃.
[0045] RNase stock solution (1 mg / ml): Weigh 25 mg RNase (IIA Sigma) and dissolve it in 25 ml ddH2O; sterilize and dispense by filtration using a 0.22 µm filter in a clean bench; heat at 90℃ for 15 min to inactivate DNase; store at -20℃.
[0046] (2) Genotyping of diploid plants was performed using genome sequencing technology, specifically: For the plants identified as diploid, DNA was extracted and a library constructed. Paired-end sequencing was performed using the Illumina Hiseq 2500 sequencing platform, with an average sequencing depth of 10-15 times for each sample. The raw data was first filtered using NGSQCtoolkit v2.3.3, and then aligned to a reference genome to obtain SNP data. Finally, the SNP data was compared with the wild-type Chunyou 84 genome to determine the genotype of the diploid plant. If the diploid plant exhibits fixed heterosis, its genome should theoretically have the same heterozygous genotype as Chunyou 84.
[0047] 5. Test Results We constructed an apomixis system. apo-DMP2 (abbreviation) apo-D2 () Figure 1 Nine positive lines were obtained through genetic transformation. The mutation types of four genes, OsPAIR1, OsREC8, OsOSD1, and OsDMP2, were detected using Hi-TOM detection technology. The results showed that one line (#6) had homozygous mutations in all four genes. Figure 2 This strain exhibits growth and development similar to the wild type, but its seed setting rate is slightly lower (74.41% vs 83.18%). Figure 3 4). After the seeds mature, the seeds of these lines are harvested, and the germinated seeds are used for diploid identification. Pluripotency is determined by flow cytometry, and one diploid plant is identified from eight progeny plants. Figure 3 5). Subsequently, using Hi-TOM analysis, the mutation types of four genes OsPAIR1, OsREC8, OsOSD1, and OsDMP2 in this plant were detected. The results showed that the mutation types of these four genes in this diploid plant were consistent with those of T0. Figure 2 Next, the whole genome of this diploid plant was resequencing using genome sequencing technology. The results showed that the diploid genotype was consistent with that of Chunyou 84. Figure 6 This is an apomixis clone, and its growth and development are consistent with the wild type. Figure 7 ).
[0048] Example 2: Rice apomixis system composed of OsDMP6 and MiMe system 1. Expression Box Construction The construction method is the same as in Example 1. The OsDMP6 target sequence primers are as follows: OsDMP6++: GGCATCTCTGGCTGCACGTTGTGG (SEQ ID NO.31); OsDMP6--:AAACCCACAACGTGCAGCCAGAGA (SEQ ID NO. 32).
[0049] 2. Genetic transformation The conversion method is the same as in Example 1.
[0050] 3. Mutation detection in transgenic T0 plants The detection method is the same as in Example 1. The Hi-TOM detection primer sequence for OsDMP6 is as follows: DMP6-Hi-F: ggagtgagtacggtgtgcCGGCTGTACCCGTTTCAGTT (SEQ ID NO. 33); DMP6-Hi-R:gagttggatgctgagtggCGCGTTGTCTCGTCGTCAG (SEQ ID NO. 34); 4. Plant ploidy and genotype identification The detection method is the same as in Example 1.
[0051] 5. Test Results: We constructed an apomixis system. apo-DMP6 (abbreviation) apo-D6 () Figure 1 A total of 12 positive lines were obtained through genetic transformation. The mutation types of four genes, OsPAIR1, OsREC8, OsOSD1, and OsDMP6, were detected using Hi-TOM detection technology. The results showed that one line (#9) had homozygous mutations in all four genes. Figure 2 These strains exhibited growth and development consistent with the wild type, but with a slightly lower seed setting rate (64.92% vs 83.18%). Figure 3 4). Once the seeds mature, harvest the seeds from this strain. Germinated seeds are used for diploid identification. Pluripotency is determined by flow cytometry; one diploid strain was identified among 123 progeny strains. Figure 3 5). Subsequently, using Hi-TOM analysis, the mutation types of four genes OsPAIR1, OsREC8, OsOSD1, and OsDMP6 in this plant were detected. The results showed that the mutation types of these four genes in this diploid plant were consistent with T0 ( Figure 2 Finally, the whole genome of this diploid plant was resequencing and analyzed using genome sequencing technology. The results showed that the diploid genotype was consistent with that of Chunyou 84, indicating that it was an apomixis clone. Figure 6 These cloned plants exhibited growth, development, and phenotype consistent with the wild type. Figure 7 ).
[0052] Example 3: Rice apomixis system composed of OsDMP14 and MiMe system 1. Expression Box Construction The construction method is the same as in Example 1. The OsDMP14 target sequence primers are as follows: OsDMP14++: GGCATGGTTGGGAGGTGCTTCCGG (SEQ ID NO. 35); OsDMP14--:AAACCGCGAAGCACCTCCCAACCA (SEQ ID NO. 36).
[0053] 2. Genetic transformation The conversion method is the same as in Example 1.
[0054] 3. Mutation detection in transgenic T0 plants The detection method is the same as in Example 1. The Hi-TOM detection primer sequence for OsDMP14 is as follows: DMP14-Hi-F: ggagtgagtacggtgtgcCCAGACGATGCAACCGCTAG (SEQ ID NO. 37); DMP14-Hi-R: gagttggatgctgagtggAGAGCAGGAAGCAGCAGAGT (SEQ ID NO. 38).
[0055] 4. Plant ploidy and genotype identification The detection method is the same as in Example 1.
[0056] 5. Test Results: We constructed an apomixis system. apo-DMP14 (abbreviation) apo-D14 () Figure 1 A total of 14 positive lines were obtained through genetic transformation. The mutation types of four genes, OsPAIR1, OsREC8, OsOSD1, and OsDMP14, were detected using Hi-TOM detection technology. The results showed that one line (#5) had homozygous mutations in all four genes. Figure 2 These strains exhibited growth and development consistent with the wild type, but with a slightly lower seed setting rate (75.96% vs 83.18%). Figure 3 4). Once the seeds mature, harvest the seeds from this strain. Germinated seeds are used for diploid identification. Pluripotency is determined by flow cytometry; one diploid strain was identified among 64 progeny strains. Figure 35). Subsequently, using Hi-TOM analysis, the mutation types of four genes OsPAIR1, OsREC8, OsOSD1, and OsDMP14 in this plant were detected. The results showed that the mutation types of these four genes in this diploid plant were consistent with T0 ( Figure 2 Finally, the genotype of this diploid plant was detected using genome sequencing technology. The results showed that the diploid genotype was consistent with that of Chunyou 84, indicating that it was an apomixis clone. Figure 6 These cloned plants exhibited growth, development, and phenotype consistent with the wild type. Figure 7 ).
Claims
1. A method for obtaining a rice apomixis system using DMP gene editing, characterized in that, Includes the following steps: Step 1: Construct expression cassettes for the CRISPR / Cas9 knockout of four target genes in rice: OsPAIR1, OsREC8, OsOSD1, and OsDMP. Specifically, the OsDMP gene is the OsDMP2 gene. The CDS sequences of the four genes (OsPAIR1, OsREC8, OsOSD1, and OsDMP2) are shown in SEQ ID NO. 1-4. The target sequences of the four genes (OsPAIR1, OsREC8, OsOSD1, and OsDMP2) are shown in SEQ ID NO. 7-10. Step 2: The expression cassette is transformed into hybrid rice using Agrobacterium-mediated transformation to obtain T0 generation plants; Step 3: Select T0 generation plants in which the four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP are all homozygous knocked out, and obtain seeds through self-pollination. Step 4: Germinate the seeds obtained from self-pollination in Step 3. Use flow cytometry and genome sequencing to detect plants in which the four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP are homozygous knocked out, and screen to obtain rice plants with apomixis.
2. The method according to claim 1, characterized in that, In step one, the specific method for obtaining the expression box is as follows: 1) Design target sequences based on the coding regions of the four genes OsPAIR1, OsREC8, OsOSD1, and OsDMP; 2) The target sequence was integrated into the SK-gRNA vector to obtain four intermediate vectors: SG1, SG2, SG3 and SG4. 3) The four intermediate vectors SG1, SG2, SG3 and SG4 were ligated to the backbone vector pC1300-Cas9 containing CRISPR / Cas9 expression elements using the enzyme digestion and ligation method to obtain the expression cassette.
3. The method according to claim 2, characterized in that, In step two, the Agrobacterium-mediated method utilizes the genetic transformation method mediated by Agrobacterium strain EHA105.
4. The method according to claim 3, characterized in that, The genetically transformed hybrid rice variety is Chunyou 84, an indica-japonica hybrid rice variety.
5. The method according to claim 4, characterized in that, In step three, the specific steps for screening T0 generation plants in which the four genes OsPAIR1, OsREC8, OsOSD1, and OsDMP are all homozygous knocked out are as follows: First, based on the gene sequences of OsPAIR1, OsREC8, OsOSD1, and OsDMP, Hi-TOM detection primers PAIR1-Hi-F, PAIR1-Hi-R, REC8-Hi-F, REC8-Hi-R, OSD1-Hi-F, OSD1-Hi-R, DMP-Hi-F, and DMP-Hi-R are designed. Then, the T0 generation transgenic plants are amplified. Finally, the mutation types of the four genes in all plants are detected using the Hi-TOM system, and transgenic plants in which the four genes are homozygous knocked out are screened. The sequences of the detection primers PAIR1-Hi-F, PAIR1-Hi-R, REC8-Hi-F, REC8-Hi-R, OSD1-Hi-F, OSD1-Hi-R, DMP-Hi-F, and DMP-Hi-R are shown in SEQ ID NO.23-30.
6. The method according to claim 5, characterized in that, In step four, flow cytometry and genome sequencing are used to detect plants in which the four genes OsPAIR1, OsREC8, OsOSD1, and OsDMP are homozygous knocked out, and rice plants with apomixis are screened out. The specific steps are as follows: 1) The ploidy of plants in which the four genes OsPAIR1, OsREC8, OsOSD1 and OsDMP were homozygous knocked out was detected by flow cytometry, and plants with diploid ploidy were selected. 2) The diploid plants were tested using genome sequencing technology, and plants with fixed genotypes were selected.
Citation Information
Patent Citations
Method for fixing rice heterosis by using DMP gene
CN120485274A
A method for fixing rice heterosis using DMP gene
CN120485274B
Method for inducing apomixis of plants and application
CN119020395A
Method for creating rice haploid induction line capable of efficiently fixing variation and application of rice haploid induction line
CN119020519A