Method for constructing a myocardial conditional knock-out lars2 mouse model and application thereof

Abstract

This invention provides a method for constructing a conditional Lars2 knockout mouse model of myocardial infarction and its application. The first step involves Lars2... flox / flox Mice via Myh6-Cre + / ‑ Mouse hybridization yielded Myh6-Cre + / ‑ Lars2 flox / ‑ Mice; Step 2: Myh6-Cre + / ‑ Lars2 flox / ‑ With Lars2 flox / flox Mouse hybridization yielded Myh6-Cre + / ‑ Lars2 flox / flox Myh6-Cre + / ‑ Lars2 flox / ‑ Myh6-Cre ‑ / ‑ Lars2 flox / flox Myh6-Cre ‑ / ‑ Lars2 flox / ‑ Four mouse genotypes, including Myh6-Cre ‑ / ‑ Lars2 flox / flox As the control group mice, hereinafter referred to as Lars2 fl / fl Myh6-Cre + / ‑ Lars2 flox / flox Mice with conditional Lars2 knockout in myocardium, referred to as the experimental group, are hereinafter referred to as Lars2 mice. cko Mice.

Description

Technical Field

[0001] This invention relates to a method for constructing a conditional knockout Lars2 mouse model of myocardium and its application. Background Technology

[0002] Cardiac dysfunction is a common and serious complication in the progression of metabolic diseases such as diabetes, and a significant cause of increased mortality. Numerous studies have shown that cardiomyocytes are highly dependent on energy supply, and mitochondria, as the core organ of cellular energy metabolism, are crucial for maintaining normal cardiac systolic and diastolic function due to their structural and functional stability. Under metabolic disturbances, impaired mitochondrial protein translation, decreased oxidative phosphorylation efficiency, and increased oxidative stress are considered key mechanisms driving myocardial remodeling and functional decline. Lars2, a leucyl-tRNA synthetase located in mitochondria, plays a vital role in maintaining mitochondrial protein translation, respiratory chain complex assembly, and energy metabolism homeostasis. However, systematic research on the specific function of Lars2 in myocardial tissue and its mechanism of action in metabolic-related cardiac dysfunction remains lacking. Summary of the Invention

[0003] The purpose of this invention is to solve the existing technical problems by proposing a method for constructing a conditional knockout Lars2 mouse model of myocardium and its application.

[0004] The objective of this invention is achieved through the following method: a method for constructing a conditional knockout Lars2 mouse model of myocardial infarction. Step 1: Lars2 flox / flox Mice via Myh6-Cre + / - Mouse hybridization yielded Myh6-Cre + / - Lars2 flox / - Mice; Step 2: Myh6-Cre + / - Lars2 flox / - With Lars2 flox / flox Mouse hybridization yielded Myh6-Cre + / - Lars2 flox / flox Myh6-Cre + / - Lars2 flox / - Myh6-Cre - / - Lars2 flox / flox Myh6-Cre - / - Lars2 flox / - Four mouse genotypes, including Myh6-Cre - / - Lars2 flox / flox As the control group mice, hereinafter referred to as Lars2 fl / fl Myh6-Cre + / -Lars2 flox / flox Mice with conditional Lars2 knockout in myocardium, referred to as the experimental group, are hereinafter referred to as Lars2 mice. cko Mice.

[0005] Furthermore, at 8 weeks of age, mice in both the control and experimental groups were treated with intraperitoneal injection of tamoxifen 40 mg / kg for 5 consecutive days. One week after the 5 consecutive days of injection, the mice's hearts were imaged using a small animal ultrasound imaging device to monitor the cardiac contractile function.

[0006] Furthermore, the purified Lars2 flox / + Mice were bred through mating to obtain Lars2. flox / flox Mice.

[0007] Furthermore, Cre mice were bred by mating Cre recombinase heterozygotes with wild-type C57BL / 6 mice to obtain Myh6-Cre mice. + / - Mice.

[0008] Furthermore, breeding mice produce offspring, and at 7-10 days old, 2-3 mm tails are collected from the offspring mice. The genome is extracted using a kit, and the target gene is amplified by PCR. The primers are as follows: upstream of flox: GTAGAGGTCGAGGACAGCTTATG, downstream: GCAGAGCAGTAAGAGGCAAGTG. Myh6-Cre upstream: CATGCCAATGGTTCACTCTAAGGT, downstream: TCTCTATTGTCCCAAAGTGCAGACAC PCR amplification was performed using a cyclic amplification instrument. A 1.5% agarose gel was prepared using 100 mL of 0.5×TBE solution and 1.5 g of agarose powder. 10 μL of the PCR final product was added to the agarose gel for electrophoresis at a constant voltage of 150 V for 45 min. The images were analyzed and saved using an automated gel imaging system. The mice were identified as target mice (flux: Targeted: 211 bp, WT: 144 bp) and Myh6-Cre (Targeted: 335 bp). A positive result for both flux homozygosity and Myh6-Cre positivity defined as a target mouse (Myh6-Cre). + / - Lars2 flox / flox ); mice that are homozygous for flux and negative for Myh6-Cre are considered wild-type littermates (Myh6-Cre). - / - Lars2 flox / flox ).

[0009] A conditional knockout Lars2 mouse model of myocardium is used to study the application of myocardial pathology.

[0010] The advantages of this invention are: it can obtain a stable conditional knockout Lars2 mouse model of myocardium; and it provides an application for studying Lars2 in myocardial pathology. Attached Figure Description

[0011] Figure 1 For mouse identification atlas; Figure 1 A is a schematic diagram of gene knockout mouse construction; Figure 1 B is a schematic diagram of gene knockout mouse breeding; Figure 1 C represents the sequence diagram of flux and Cre enzymes detected by PCR amplification and agarose gel electrophoresis. Figure 1 D is a diagram illustrating the successful construction of Lars2 conditional gene knockout mice at the protein level.

[0012] Figure 2 An echocardiogram of changes in mice; Figure 2 A is a schematic diagram of echocardiography in mice after tamoxifen injection; Figure 2 B represents the statistics of left ventricular ejection fraction (EF%) and left ventricular shortening fraction (FS%) in mice (n≥6).

[0013] Figure 3 This represents mouse heart-related phenotype 1.

[0014] Figure 3 A: Mouse survival curves (n=15); Figure 3 B: Statistical analysis of body weight in mice injected with tamoxifen for 16 weeks; Figure 3 C: Heart weight / body weight analysis of mice injected with tamoxifen for 16 weeks (n≥6). Figure 3 D: Analysis of heart weight / tibia length in mice injected with tamoxifen for 16 weeks (n≥6) [Lars2] fl / fl For the control group, Lars2 cko For the Lars2 knockout group, **, P<0.01] Figure 4 This represents mouse heart-related phenotype 2.

[0015] Figure 4 A: Gross image of mouse heart, HE staining (Bar=5mm), Masson staining (Bar=50μm), Sirius red staining (Bar=50μm), WGA staining (Bar=50μm); Figure 4 B: Statistical analysis of myocardial fibrosis in mice based on masson staining (n=6); Figure 4 C: Statistics of cross-sectional area of ​​mouse cardiomyocytes based on WGA staining (n=6); Figure 4 D: Relative ATP level in mouse myocardium (n=6); Figure 4E: Mouse serum ANP levels detected by ELISA kit (n=6) [Lars2] fl / fl For the control group, Lars2 cko For the Lars2 knockout group, **, P<0.01, ***, P<0.001, ****, P<0.0001] Figure 5 The effect of knocking down the lars2 gene on HL-1 cells.

[0016] A: qRT-PCR detection of knockdown efficiency of different Lars2 siRNA transfections. B: qRT-PCR detection of the effect of different Lars2 siRNA transfection concentrations on Lars2 expression. C: Western blot analysis of HL-1 cells for proteins related to fibrosis and cardiac remodeling. D: Statistical analysis of protein expression levels in each group. (si-NC is the control group, si-Lars2 is the Lars2 knockdown group, bar=X±SEM, n=3 samples per group, *, P<0.05, **, P<0.01, ***, P<0.001) Figure 6 Effects of Lars2 gene knockdown on cellular mitochondrial function and energy metabolism AB: JC-1 staining and analysis of HL-1 cells (n=6, Bar=50μm). CD: Mitosox staining and analysis of HL-1 cells (n=6, Bar=50μm). E: Mitotracker staining of HL-1 cells (n=6, Bar=1μm). F: ATP level detection of HL-1 cells (n=6). [si-Lars2 is the control group, si-Lars2 is the Lars2 knockdown group, ***, P<0.001; ****, P<0.0001] Figure 7 Changes in indices of myocardial fibrosis and remodeling in mice A: Immunoblot analysis of MyHc, COL-1, TGF-β, and ANP proteins in mice; B: Statistical comparison of related protein levels (n=6); C: mRNA levels of Lars2, MYH7, NPPA, NPPB, COL1A1, COL1A2, COL3A1, and TGF-β in mice (n=6) [Lars2] fl / fl For the control group, Lars2 cko For the Lars2 knockout group, *, P<0.05, **, P<0.01, ***, P<0.001, ****, P<0.0001] Figure 8 Changes in mitochondrial function and content in mouse myocardium A: Results of mouse myocardial mitochondrial respiratory function test; B: Statistical graph of mouse myocardial mitochondrial respiratory function test results (n=3); C: Measurement of maximum respiratory capacity of mouse myocardial mitochondria (n=3); D: Immunoblot analysis of total complex protein in mouse myocardial mitochondria; E: Statistical comparison of related protein levels (n=6) [Lars2] fl / fl For the control group, Lars2 cko For the Lars2 knockout group, *P<0.05, **P<0.01] Figure 9 Detection of mitochondrial morphology and mitochondrial dynamics-related proteins in mouse myocardium A: Transmission electron microscopy image of mouse myocardial mitochondria (Bar=0.5μm); B: Statistical analysis of the area of ​​a single mouse myocardial mitochondrial (n=6); C: Measurement of the cristae length of mouse myocardial mitochondria (n=6); D: Immunoblot analysis of mouse myocardial mitochondrial MFN1, MFN2, and DRP1 proteins; E: Statistical comparison of related protein quantities (n=6) [Lars2] fl / fl For the control group, Lars2 cko For the Lars2 knockout group, *, P<0.05, **, P<0.01, ****, P<0.0001] Figure 10 Transcriptome sequencing results.

[0017] A: Differential gene volcano plot; B: Heatmap analysis; C: GO enrichment analysis; D: KEGG enrichment analysis Figure 11 Proteomics sequencing results.

[0018] A: Differential protein volcano plot; B: Heatmap analysis; C: GO-BP enrichment analysis; D: KEGG enrichment analysis Figure 12 Mouse myocardial mitochondrial stress-related indicators A: Immunoblot analysis of mice's myocardial mitochondrial stress-related marker proteins; B: Statistical comparison of related protein levels (n=6); C: mRNA levels of mice's myocardial mitochondrial stress-related markers (n=6) [Lars2] fl / fl For the control group, Lars2 cko For the Lars2 knockout group, *, P<0.05, **, P<0.01, ****, P<0.0001] Figure 13 Mouse myocardial endoplasmic reticulum stress-related indicators A: Immunoblot analysis of endoplasmic reticulum stress-related marker proteins in mouse myocardium; B: Statistical comparison of related protein levels (n=6); C: mRNA levels of endoplasmic reticulum stress-related markers in mouse myocardium (n=6) [Lars2]fl / fl For the control group, Lars2 cko For the Lars2 knockout group, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001] Figure 14 Knocking down the lars2 gene induces mitochondrial stress in HL-1 cells. A: Western blot analysis of mitochondrial stress-related proteins in HL-1 cells. B: Statistical analysis of protein expression levels in each group (n=6). [si-NC is the control group, si-Lars2 is the Lars2 knockdown group, *, P<0.05, **P<0.01, ***, P<0.001] Figure 15 Knocking down the lars2 gene induces endoplasmic reticulum stress in HL-1 cells. A: Western blot analysis of endoplasmic reticulum stress-related proteins in HL-1 cells. B: Statistical analysis of protein expression levels in each group (n=6). [si-NC is the control group, si-Lars2 is the Lars2 knockdown group, *, P<0.05, **, P<0.01] Figure 16 Effects of Lars2 gene knockdown on ATF5 A: HL-1 cells ATF5 immunofluorescence staining (Bar=50μm); B: ATF5 immunofluorescence staining analysis of nuclear / cytoplasmic fluorescence intensity (n=3); C: HL-1 cell dual-luciferase assay results (n=3) [si-Lars2 is the control group, si-Lars2 is the Lars2 knockdown group, *, P<0.05, **, P<0.01] Detailed Implementation

[0019] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments.

[0020] Example 1, see attached document Figure 1-16 A method for constructing a conditional Lars2 knockout mouse model of myocardial infarction. Step 1: Lars2 flox / flox Mice via Myh6-Cre + / - Mouse hybridization yielded Myh6-Cre + / - Lars2 flox / - Mice; Step 2: Myh6-Cre + / - Lars2 flox / - With Lars2 flox / floxMouse hybridization yielded Myh6-Cre + / - Lars2 flox / flox Myh6-Cre + / - Lars2 flox / - Myh6-Cre - / - Lars2 flox / flox Myh6-Cre - / - Lars2 flox / - Four mouse genotypes, including Myh6-Cre - / - Lars2 flox / flox As the control group mice, hereinafter referred to as Lars2 fl / fl Myh6-Cre + / - Lars2 flox / flox Mice with conditional Lars2 knockout in myocardium, referred to as the experimental group, are hereinafter referred to as Lars2 mice. cko Mice.

[0021] A method for constructing a conditional knockout Lars2 mouse model of myocardium involves treating control and experimental mice with intraperitoneal injection of tamoxifen 40 mg / kg for 5 consecutive days at 8 weeks of age; one week after the 5 consecutive days of injection, the mouse heart is imaged using a small animal ultrasound imaging device to monitor the cardiac contractile function of the mice.

[0022] A method for constructing a conditional knockout Lars2 mouse model of myocardial infarction, using purified Lars2... flox / + Mice were bred through mating to obtain Lars2. flox / flox Mice.

[0023] A method for constructing a conditional myocardial knockout Lars2 mouse model involves breeding Cre mice by mating Cre recombinase heterozygotes with wild-type C57BL / 6 mice to obtain Myh6-Cre mice. + / - Mice.

[0024] A method for constructing a conditional knockout Lars2 mouse model of myocardial infarction: breeding mice to produce offspring, and collecting 2-3 mm tails from offspring mice at 7-10 days of age. Genomic DNA is extracted using a kit, and the target gene is amplified by PCR. The primers are as follows: upstream of flox: GTAGAGGTCGAGGACAGCTTATG, downstream: GCAGAGCAGTAAGAGGCAAGTG. Myh6-Cre upstream: CATGCCAATGGTTCACTCTAAGGT, downstream: TCTCTATTGTCCCAAAGTGCAGACAC PCR amplification was performed using a cyclic amplification instrument. A 1.5% agarose gel was prepared using 100 mL of 0.5×TBE solution and 1.5 g of agarose powder. 10 μL of the PCR final product was added to the agarose gel for electrophoresis at a constant voltage of 150 V for 45 min. The images were analyzed and saved using an automated gel imaging system. The mice were identified as target mice (flux: Targeted: 211 bp, WT: 144 bp) and Myh6-Cre (Targeted: 335 bp). A positive result for both flux homozygosity and Myh6-Cre positivity defined as a target mouse (Myh6-Cre). + / - Lars2 flox / flox ); mice that are homozygous for flux and negative for Myh6-Cre are considered wild-type littermates (Myh6-Cre). - / - Lars2 flox / flox ).

[0025] A method for establishing a conditional myocardial knockout Lars2 mouse model was developed. To assess the overall cardiac pumping function in mice, at 8 weeks of age, two groups of mice were intraperitoneally injected with tamoxifen at a dose of 40 mg / kg for 5 consecutive days. One week later, both groups of mice underwent weekly echocardiography. Left ventricular end-diastolic and end-systolic diameters were measured using M-mode echocardiography, and key indicators of cardiac function were calculated. Results showed that, compared with the control group, Lars2... cko Both ejection fraction (EF) and fractional shortening (FS) were significantly reduced in mice. Figure 2 (AB). This indicates that Lars2 gene deletion leads to severe impairment of left ventricular systolic function and decreased cardiac pumping capacity in mice.

[0026] A conditional knockout Lars2 mouse model of myocardium is used to study the application of myocardial pathology.

[0027] Mouse echocardiography (1) Animal preparation: Apply hair removal cream to the chest and upper abdomen of the mouse and wipe the area to be hair removed with a cotton swab. After 2 minutes, wipe off the hair removal cream with a damp gauze or damp paper towel. Anesthetize the mouse in an anesthesia induction box and fix the anesthetized mouse in a supine position on the animal operation platform. Insert an anesthesia mask into the mouse's mouth and nose and maintain anesthesia with isoflurane at a concentration of 1-2% and a flow rate of 0.6-1 L / min. Apply conductive paste to the electrodes on the animal platform and fix the mouse's paws to the electrode pads with tape. Ensure that the correct electrocardiogram is collected, maintain the mouse's body temperature, and check the respiratory rate for physiological assessment and monitoring during imaging. During the collection process, the mouse's heart rate needs to be maintained at 400-650 bpm. The smaller the heart rate range, the more accurate the collected data.

[0028] (2) Echocardiogram imaging procedure: Adjust the angle of the animal platform to obtain the parasternal long axis view. In the parasternal long axis section, rotate the probe 90° clockwise and adjust the Y-axis to find the largest section of the left ventricular cavity, which is the parasternal short axis section. In B-Mode, the left ventricle, right ventricle, and papillary muscles can be observed. To obtain the best M-Mode ultrasound image, place the sampling line in the center of the left ventricle and click "Start" to display the movement of the myocardial wall.

[0029] (3) Method for measuring cardiac function: Open the LV Trace tool in the M-mode data and click the measurement button in the tool box. Trace along the endocardial trajectory of the anterior wall of the left ventricle, and then trace the posterior wall of the left ventricle in the same way, for three consecutive cardiac cycles. Cardiac function parameters that can be obtained through the short-axis section of the left ventricle: Cardiac structure: thickness of the anterior wall of the left ventricle at end-diastole and end-systole, thickness of the posterior wall of the left ventricle at end-diastole and end-systole, and diameter of the left ventricle at end-diastole and end-systole. Cardiac function parameters: left ventricular area at end-diastole and end-systole, left ventricular volume at end-diastole and end-systole, ejection fraction, fractional shortening, cardiac output, stroke volume, left ventricular mass, and rate of change of area.

[0030] In vitro experiments To verify the effect of Lars2 on myocardial pathophysiology, we used HL-1 (mouse cardiomyocytes) cells as an in vitro cell model and used siRNA transfection to knock down Lars2 to explore the effect of Lars2 on myocardium.

[0031] Effects of lars2 gene knockdown on HL-1 cells (1) We first selected three Lars2 siRNAs for transfection testing and found that Lars2 siRNA-3 had the best knockdown efficiency (P<0.001, Figure 5 Therefore, Lars2 siRNA-3 (hereinafter referred to as si-Lars2) was selected for cell transfection in subsequent experiments.

[0032] (2) We set up a transfection concentration gradient experiment of si-Lars2 in HL-1 cells to determine its optimal transfection concentration in HL-1 cells. We set up transfection concentration gradient experiments of 20 nM, 30 nM, and 50 nM to transfect si-Lars2 into HL-1 cells. We used qRT-PCR technology to determine the Lars2 gene expression level in the transfected cells. We found that 30 nM was the optimal transfection concentration. Figure 5 B), and this concentration was used for transfection in subsequent experiments.

[0033] (3) The expression of related proteins was detected by Western blotting. Figure 5C). We found that compared with the control (si-NC) group, the expression of COL-1 fibrosis marker proteins was upregulated in the Lars2 knockdown (si-Lars2) group, and the difference was statistically significant (P < 0.05). The expression of TGF-β protein was increased, but not statistically significant. The expression of MyHc and ANP cardiac remodeling marker proteins was upregulated, and the difference was statistically significant (P < 0.05), suggesting that fibrosis and cardiac remodeling markers increased after Lars2 knockdown in HL-1 cells.

[0034] Assessment of mitochondrial function and energy metabolism status in HL-1 cells by knocking down Lars2 gene (1) JC-1 forms a polymer in mitochondria with normal high membrane potential and emits red fluorescence; while it exists as a monomer and emits green fluorescence when the membrane potential decreases. The ratio of red to green fluorescence intensity can intuitively reflect the relative level of mitochondrial membrane potential. Using the JC-1 fluorescent probe in combination with Hoechst nuclear staining, the experimental results showed that compared with the si-NC group, the green fluorescence intensity of JC-1 in the si-Lars2 group was significantly stronger, and the red fluorescence was correspondingly weaker. Figure 6 A) The red-green fluorescence ratio decreased significantly, and the difference was statistically significant (P < 0.0001), indicating a decrease in mitochondrial membrane potential and impaired mitochondrial function.

[0035] (2) The MitoSOX Red fluorescent probe was used to detect the level of mitochondrial-derived superoxide in cells. Using the MitoSOX Red fluorescent probe in conjunction with Hoechst nuclear staining, the results showed that the intensity of MitoSOX red fluorescence in the si-Lars2 group was significantly enhanced compared to the si-NC group. Figure 6 The difference was statistically significant (P < 0.0001), indicating increased superoxide production in mitochondria and significant mitochondrial oxidative stress.

[0036] (3) MitoTracker probes are fluorescent dyes used to specifically label the mitochondrial network structure in living cells. MitoTracker staining can reveal changes in mitochondrial morphology in si-Lars2 group cells. Figure 6 E), characterized by the disintegration of the normal tubular network structure, exhibiting widespread fragmentation and point-like distribution.

[0037] (4) The ATP levels of the two groups of cells were detected using an ATP assay kit. The results showed that the ATP levels of the si-Lars2 group were significantly lower, and the difference was statistically significant. Figure 6 F, P < 0.001).

[0038] CKO mouse genotyping The conditional knockout mice in this experiment were constructed by expressing Myosin Heavy Chain 6 (Myh6) to activate Cre enzyme activity. This enzyme then recognizes and integrates the Loxp gene sequences inserted at both ends of Lars2, primarily resulting in the formation of a new genome in the myocardium lacking the Lars2 gene sequence, thus achieving the goal of gene-specific knockout of Lars2 in the myocardium. (Diagram of gene knockout mouse construction follows.) Figure 1 A). Schematic diagram of gene knockout mouse breeding ( Figure 1 B). We used mouse tails to identify genomic DNA, employing PCR amplification and agarose gel electrophoresis to detect flux and Cre enzyme sequences. When Lars2... flox / flox Homozygous, Cre-positive mice are the target gene knockout mice: Lars2 cko Mouse (Myh6-Cre) + / - Lars2 flox / flox ); while Lars2 flox / flox Homozygous, Cre-negative mice served as the littermate control group: Lars2 fl / fl Mouse (Myh6-Cre) - / - Lars2 flox / flox () Figure 1 C, number 6 is Lars2 fl / fl The mouse, number 7, is Lars2. cko (Mouse). Further Western blotting was used to detect Lars2 protein expression in the heart, liver, lungs, kidneys, and skeletal muscle of mice, confirming the successful construction of Lars2 conditional gene knockout mice at the protein level. Figure 1 D).

[0039] To assess overall cardiac pumping function in mice, at 8 weeks of age, two groups of mice were intraperitoneally injected with tamoxifen at a dose of 40 mg / kg for 5 consecutive days. One week later, both groups of mice underwent weekly echocardiography. Left ventricular end-diastolic and end-systolic diameters were measured using M-mode echocardiography, and key indicators of cardiac function were calculated. Results showed that, compared with the control group, Lars2... cko Both ejection fraction (EF) and fractional shortening (FS) were significantly reduced in mice. Figure 2 (AB). This indicates that Lars2 gene deletion leads to severe impairment of left ventricular systolic function and decreased cardiac pumping capacity in mice.

[0040] Data on mouse heart-related phenotypes.

[0041] (1) We administered tamoxifen intraperitoneally to mice at 8 weeks of age and then monitored their survival. We found that Lars2 cko The mice began to die at 21 weeks, and all Lars2 mice... ckoThe mice died completely within 26 weeks. Figure 3 A).

[0042] (2) To reduce the bias caused by changes in mouse body weight and fat content, we used the ratio of heart mass to body weight and tibia length to assess changes in mouse heart weight. We found that, compared with the control group, Lars2 cko The heart weight / body weight (HW / BW) and heart weight / tibia length (HW / TL) ratios in mice were significantly increased, and the differences were statistically significant. Figure 3 CD (P < 0.01) indicates significant cardiac hypertrophy.

[0043] (3) Further cardiac morphological analysis revealed that Lars2, compared with the control group, cko The mouse heart showed an overall increase in volume, and HE staining revealed enlargement of the left ventricle. Masson and Sirius Red staining results showed that Lars2... cko Collagen deposition was observed in the myocardial interstitium of mice, and the difference was statistically significant. Figure 4 B, P < 0.0001), indicating a significantly aggravated degree of myocardial fibrosis. WGA staining revealed that, compared with the control group, Lars2 cko The cross-sectional area of ​​mouse cardiomyocytes was significantly increased, and the difference was statistically significant. Figure 4 C, P < 0.0001).

[0044] (4) By detecting the ATP levels in the mouse myocardium, we found that Lars2 cko The ATP content in the mouse myocardium was significantly decreased. Figure 4 D, P < 0.01), indicating impaired mitochondrial energy metabolism in mice.

[0045] (5) ELISA detection of ANP in mouse serum revealed that, compared with the control group, Lars2... cko Serum ANP levels in mice were significantly elevated, and the difference was statistically significant. Figure 4 E, P < 0.0001).

[0046] Changes in indices of myocardial fibrosis and remodeling in mice (1) We performed Western blotting experiments on myocardial fibrosis and remodeling indices in mice and found that Lars2 was significantly higher than that in the control group. cko The protein expression of both COL-1 and TGF-β in mice was increased, and the differences were statistically significant. Figure 7 AB, P<0.05). Furthermore, compared with the control group, the protein expression of both MyHc and ANP increased, and the differences were statistically significant. Figure 7AB, P<0.05).

[0047] (2) We detected the expression of Myh7, NPPA, and NPPB in myocardium using qRT-PCR. Compared with the control group, Lars2... cko The expression of mRNA in mice was significantly increased, and the difference was statistically significant. Figure 7 C, P<0.05), and at the same time, we found Lars2 cko The mRNA expression levels of COL1A1, COL1A2, COL3A1, and TGF-β in mice were significantly increased compared to the control group, and the differences were statistically significant. Figure 7 C, P<0.05).

[0048] Changes in mitochondrial function and structure in mouse myocardium (1) We used a high-resolution mitochondrial respiration assay system to detect mitochondrial respiratory function and found that Lars2... cko The activities of mitochondrial complex I (CI), complexes II and III (C II & III), and complex IV (CIV) in mice were all decreased, with the difference in complex 4 being statistically significant. Figure 8 (AB, P<0.05). Additionally, compared to the control group, we found that Lars2... cko The respiratory capacity of the mitochondrial maximum electron transport system (ETS) in mice was significantly reduced, and the difference was statistically significant. Figure 8 C, P<0.05).

[0049] (2) We lysed and quantified the isolated mitochondria to prepare protein samples and detected the content of various complexes in the mitochondria. We found that, compared with the control group, Lars2 cko The protein expression levels of complex I, complex IV, and complex V were all reduced in mice, with the difference between complex I and complex IV being statistically significant. Figure 8 D, P<0.05). The contents of complex 2 and complex 3 showed no significant change.

[0050] (3) We used transmission electron microscopy to observe mouse myocardial mitochondria and found that the control group mitochondria had regular morphology, intact structure, and clearly and densely arranged cristae, while Lars2 mitochondria... cko In mice, the mitochondria are smaller and irregular in shape; the number of mitochondrial cristae is reduced, their arrangement is disordered, with some areas showing breakage or blurring, and vacuolar structures appearing in some areas; the mitochondrial arrangement becomes loose. Figure 9 A). We statistically analyzed the area of ​​individual mitochondria and found that Lars2... cko The area of ​​a single mitochondrial in mice was reduced, and the difference was statistically significant. Figure 9 B, P<0.05). Furthermore, we quantitatively analyzed the length of the mitochondrial cristae and found that Lars2... cko The length of mitochondrial cristae in mice was shortened, and the difference was statistically significant. Figure 9 C, P<0.0001).

[0051] (4) We further examined mitochondrial dynamics-related proteins and found Lars2 cko In mice, the expression of mitochondrial fusion-related proteins MFN1 and MFN2 was downregulated, while the expression of the mitochondrial division-related protein DRP1 was upregulated, and the differences were statistically significant. Figure 9 DE, P<0.05). This result indicates that Lars2 deficiency disrupts mitochondrial ultrastructure, leading to an imbalance in mitochondrial fusion and division, thereby causing abnormal mitochondrial morphology and function.

[0052] Mouse left ventricular myocardial transcriptomics To explore the potential targets of LARS2 on mouse myocardium, we used LARS2 after 12 weeks of tamoxifen injection. cko With Lars2 fl / fl Transcriptome sequencing was performed on the left ventricular myocardium of mice.

[0053] (1) The obtained transcriptome data were standardized using DEG seq2 software and then analyzed. It was found that it was similar to Lars2. fl / fl Compared to the previous group, Lars2 cko The group contained 2923 differentially expressed genes (DEGs), of which 1456 were upregulated and 1467 were downregulated. Figure 10 A).

[0054] (2) Cluster analysis of differentially expressed genes. In the dendrogram of sample clusters ( Figure 10 B), the horizontal axis represents different groups, namely Lars2. fl / fl Group, Lars2 cko Groups. The vertical axis represents different genes. The cluster heatmap shows: relative to Lars2 fl / fl Group, Lars2 cko The significant differences in gene expression levels among the groups indicate that the gene expression trends differed after Lars2 was knocked out in mice.

[0055] (2) The differentially expressed genes were subjected to GO functional analysis. The GO database can classify all differentially expressed genes into three main categories: biological processes, molecular functions, and cellular components. The genes were sorted according to their abundance and the top 30 were displayed. Figure 10 C):

[0056] (3) KEGG metabolic pathways are divided into four categories: environmental information processing, human diseases, organic systems, and cellular physiological processes. The top thirty are selected based on the gene abundance ranking provided. Figure 10 D). KEGG and GO enrichment pathway analysis results: Differentially identified genes mainly involved mitochondrial energy metabolism, nucleotide and amino acid metabolism, ion homeostasis, and myocardial contraction-related pathways.

[0057] Mouse cardiac mitochondrial proteomics To further explore the potential targets of Lars2 in mouse myocardium, we injected Lars2 with tamoxifen for 12 weeks. cko With Lars2 fl / fl Mitochondria were extracted from the myocardium of mice, and quantitative proteomics sequencing was performed on mitochondrial proteins.

[0058] (1) The obtained proteomics data were standardized and differential analysis was performed. The results showed that, compared with Lars2, fl / fl Compared to the previous group, Lars2 cko The group contained 451 differentially expressed proteins (DEPs), of which 198 were upregulated and 253 were downregulated. Figure 11 A).

[0059] (2) Cluster analysis of differentially expressed proteins. In the dendrogram of sample clusters ( Figure 11 B), the horizontal axis represents different groups, namely Lars2. fl / fl Group, Lars2 cko Groups. The vertical axis represents different proteins. The cluster heatmap shows: relative to Lars2 fl / fl Group, Lars2 cko The significant differences in histone expression levels indicate that the protein expression trends differed after Lars2 was knocked out in mice.

[0060] (3) The differentially expressed genes were subjected to GO functional analysis. The GO database can classify all differentially expressed genes into three main categories: biological processes, molecular functions, and cellular components. Based on the abundance of the annotated genes, we selected the top thirty in the biological processes category for display. Figure 11 C).

[0061] KEGG metabolic pathways are divided into four main categories: environmental information processing, human diseases, organic systems, and cellular physiological processes. The top forty pathways are displayed based on their gene abundance as annotated. Figure 11D). Combined GO and KEGG analysis showed that Lars2 deficiency mainly disrupts mitochondrial protein translation and respiratory chain function, leading to impaired energy metabolism and further affecting myocardial contraction, metabolic regulation, and cellular stress-related pathways. These findings suggest that mitochondrial stress response may play a key role in its pathogenesis.

[0062] The effect of Lars2 deficiency on mitochondrial stress (1) Combining transcriptomic and proteomic sequencing results, we found that Lars2 deficiency in mice is closely related to the activation of ATF5-related mitochondrial stress responses. We used Western blotting to detect the expression of mitochondrial stress-related proteins in mouse myocardial protein samples ( Figure 12 A), it was found that Lars2 compared to the control group. cko Mice showed increased expression of ATF5, LONP1, CLPP, HSPA9, HSPD1, and HSPE1, with statistical significance. Figure 12 B, P<0.05). Simultaneously, we detected the mRNA levels of ATF5, LONP1, CLPP, HSPA9, HSPD1, and HSPE1 in the myocardium using qRT-PCR. We found that compared to the control group, Lars2... cko In the mouse group, the above indicators were all upregulated at mRNA levels, and this was statistically significant. Figure 12 (C, P < 0.01) (2) Sustained activation of mitochondrial stress disrupts intracellular protein homeostasis and energy metabolism balance. Considering the high functional coupling between mitochondria and the endoplasmic reticulum in maintaining cellular homeostasis, impaired mitochondrial function may interfere with the protein folding process of the endoplasmic reticulum. Therefore, we further investigated whether Lars2 deficiency is accompanied by activation of the endoplasmic reticulum stress response. We used Western blotting to detect the expression of endoplasmic reticulum stress-related proteins in mouse cardiomyocyte protein samples ( Figure 13 A), it was found that Lars2 compared to the control group. cko Mice showed increased expression of IRE1, ATF6, p-eif-2α, ATF4, and DDIT3, with statistical significance. Figure 13 B, P<0.05). Simultaneously, we detected the mRNA levels of key markers in the myocardium using qRT-PCR experiments, finding that Lars2 was significantly higher than the control group. cko In the mouse group, the above indicators were all upregulated at mRNA levels, and this was statistically significant. Figure 13 (C, P < 0.01) In vitro experiments validated the stress response induced by downregulation of Lars2 expression. Knocking down the Lars2 gene induces a stress response in HL-1 cells. (1) We detected the expression of mitochondrial stress-related proteins using Western blotting. Figure 14 A) It was found that compared with the control (si-NC) group, the expression of ATF5, LONP1, CLPP, HSPA9, HSPD1, and HSPE1 marker proteins was upregulated in the Lars2 knockdown (si-Lars2) group, and the differences were statistically significant. Figure 14 B, P < 0.05), indicating that Lars2 knockdown cells exhibit a significant mitochondrial stress response.

[0063] (2) We continued to detect the expression of endoplasmic reticulum stress-related proteins by Western blotting. Figure 15 A) It was found that compared with the control (si-NC) group, the expression of IRE1, ATF6, p-eif-2α, ATF4, and DDIT3 marker proteins in the Lars2 knockdown (si-Lars2) group was upregulated, and the differences were statistically significant. Figure 15 B, P < 0.05), indicating that Lars2 knockdown cells showed a significant endoplasmic reticulum stress response.

[0064] Lars2 knockdown promotes ATF5 nuclear translocation and enhanced transcriptional activity. To assess the effect of Lars2 knockdown on ATF5 activity, we first observed the subcellular localization of ATF5. Laser confocal fluorescence imaging showed that the fluorescence intensity of ATF5 in the cell nucleus was significantly enhanced in the Lars2 knockdown (si-Lars2) group. Figure 16 A), the nucleus / cytoplasm ratio was significantly higher than that of the control (si-NC) group. Figure 16 The results (*P<0.05) indicate that Lars2 knockdown promotes ATF5 nuclear translocation. We further co-transfected the ATF5 promoter reporter gene with siRNA-Lars2 into HL-1 cells and measured changes in ATF5 dual-luciferase activity. The results showed that, compared to the control group, the ATF5-mediated transcriptional activity in the Lars2 knockdown (si-Lars2) group was significantly enhanced by approximately 3-fold (Figure 16C, **P<0.01), indicating that Lars2 knockdown can activate ATF5 transcriptional function by promoting ATF5 nuclear translocation.

[0065] Cardiac dysfunction is a common and serious complication in the progression of metabolic diseases such as diabetes, and a significant cause of increased mortality. Numerous studies have shown that cardiomyocytes are highly dependent on energy supply, and mitochondria, as the core organ of cellular energy metabolism, are crucial for maintaining normal cardiac systolic and diastolic function through structural and functional stability. Under metabolic disturbances, impaired mitochondrial protein translation, decreased oxidative phosphorylation efficiency, and increased oxidative stress are considered key mechanisms driving myocardial remodeling and functional decline. Lars2, a mitochondrial-based leucyl-tRNA synthetase, plays a vital role in maintaining mitochondrial protein translation, respiratory chain complex assembly, and energy metabolism homeostasis.

[0066] Experimental objective: To investigate the role of Lars2 knockout in the myocardium and whether it participates in cardiac function decline and cardiac remodeling through the ATF5-related stress pathway.

[0067] Experimental methods: 1. In vivo experiments: Study the effects of Lars2 knockdown on mouse cardiomyocytes (HL-1 cells).

[0068] (1) We used Lars2 siRNA to transfect cells and set up a concentration gradient of Lars2 siRNA transfection to determine the optimal transfection concentration in order to achieve the purpose of knocking down Lars2 gene in HL-1 cells.

[0069] (2) We used Western blot to detect fibrosis markers such as COL-1 and TGF-β and myocardial remodeling markers such as MyHc and ANP in HL-1 cells after Lars2 knockdown.

[0070] (3) We performed live cell staining on Lars2 knocked-down HL-1 cells: JC-1 staining was used to detect mitochondrial membrane potential levels; MitoSOX Red staining was used to detect mitochondrial superoxide levels; and MitoTracker staining was used to label mitochondrial network structures.

[0071] (4) We measured the ATP levels in HL-1 cells with Lars2 knockout.

[0072] 2. In vitro experiments: Mechanism study of Lars2 knockdown on decreased cardiac function and cardiac remodeling.

[0073] (1) Using CRISPR-Cas9 technology, a LoxP sequence was inserted upstream and downstream of the Lars2 gene in C57BL / 6 mice to obtain heterozygous Lars2. flox / - Mice. According to Mendel's laws of inheritance: Lars2 flox / flox Mice and Myh6-Cre+ / - Mice were hybridized and bred to obtain Myh6-Cre - / - Lars2 flox / flox Wild type (Lars2) fl / fl Mice were used as the control group; Myh6-Cre + / - Lars2 flox / flox Conditional knockout of Lars2 in myocardium (Lars2) cko Mice were used as the experimental group. At 8 weeks of age, mice were intraperitoneally injected with tamoxifen at a concentration of 60 mg / kg. Cardiac function was assessed by echocardiography once a week, and serum and heart specimens were collected from the mice.

[0074] (2) HE staining, Masson staining, Sirius red staining and WGA staining were performed on paraffin sections of the heart. The ATP content of mouse myocardial tissue and serum ANP concentration were detected. Myocardial specimens were taken and Western Blot and qRT-PCR were used to detect fibrosis indicators such as COL-1 and TGF-β and myocardial remodeling indicators such as MyHc and ANP.

[0075] (3) Extract mitochondria from mouse myocardial tissue for Oxygraph-2k mitochondrial function assay and take mitochondrial transmission electron microscopy images; take mitochondrial protein samples and use Western Blot to detect the protein content of each complex in mitochondria and the protein content of mitochondrial dynamics-related proteins (MFN1, MFN2, DRP1).

[0076] (4) Transcriptome sequencing was performed on the myocardium of Lars2 knockout mice, and proteome sequencing was performed on the myocardial mitochondria of Lars2 knockout mice for joint analysis.

[0077] (5) Take myocardial specimens and use Western Blot and qRT-PCR to detect the expression level of ATF5-related stress pathway markers.

[0078] In vitro experiments validated the stress response induced by downregulation of Lars2 expression. (1) We used Western blot to detect the expression levels of ATF5-related stress pathway markers in HL-1 cells after Lars2 knockdown.

[0079] (2) We used immunofluorescence to observe the subcellular localization of ATF5 in HL-1 cells after Lars2 knockdown.

[0080] (3) We co-transfected the ATF5 promoter reporter gene and siRNA-Lars2 into HL-1 cells and measured the changes in ATF5 dual-luciferase activity.

[0081] Experimental results: In vivo experiments: (1) After Lars2 was knocked down in HL-1 cells, the expression of fibrosis markers such as COL-1 and myocardial remodeling markers such as MyHc and ANP increased significantly.

[0082] (2) After Lars2 was knocked down in HL-1 cells, the mitochondrial membrane potential decreased, the production of superoxide in mitochondria increased, and the mitochondrial morphology showed extensive fragmentation and punctate distribution.

[0083] (3) ATP levels decreased significantly after Lars2 was knocked down in HL-1 cells.

[0084] 2. In vitro experiments (1) Compared with the control group, the Lars2 knockout group showed a significant decrease in cardiac function, manifested as a decrease in EF and FS.

[0085] (2) Compared with the control group, HE staining, Masson staining, and Sirius red staining of the heart in the Lars2 knockout group showed significant cardiac fibrosis; WG staining showed an increased myocardial cross-sectional area. Compared with the control group, the ATP content of myocardial tissue in the Lars2 knockout group was significantly decreased, and the serum ANP concentration was significantly increased. Compared with the control group, the expression of fibrosis indicators such as COL-1 and TGF-β, and myocardial remodeling indicators such as MyHc and ANP in myocardial specimens were significantly increased in the Lars2 knockout group.

[0086] (3) Compared with the control group, the Lars2 knockout group had impaired mitochondrial respiratory chain function, including decreased activity and maximum electron transport capacity of complex IV, and reduced expression of complex I and IV proteins; electron microscopy showed that mitochondria were loosely arranged and disordered, cristae were destroyed and vacuolar changes were observed; the expression of mitochondrial fusion proteins MFN1 and MFN2 was significantly downregulated, and the expression of splitting protein DRP1 was significantly upregulated.

[0087] (4) Combined analysis of transcriptomics and mitochondrial proteomics revealed that differentially expressed genes and proteins were mainly enriched in processes such as mitochondrial protein processing, mitochondrial translation, and respiratory chain function, and that molecules related to energy metabolism and protein homeostasis were significantly abnormally expressed. This suggests that Lars2 deficiency can lead to impaired mitochondrial protein homeostasis and cause functional disorders.

[0088] (5) Compared with the control group, the expression of mitochondrial stress-related proteins (ATF5, LONP1, CLPP, HSPA9, HSPD1, HSPE1) and endoplasmic reticulum stress-related proteins (IRE1, ATF6, p-eIF-2α, ATF4, DDIT3) in myocardial samples of Lars2 knockout group was significantly upregulated.

[0089] 3. In vitro experiments to verify the stress response induced by Lars2 downregulation. (1) After Lars2 was knocked down in HL-1 cells, the expression of mitochondrial stress-related proteins (ATF5, LONP1, CLPP, HSPA9, HSPD1, HSPE1) and endoplasmic reticulum stress-related proteins (IRE1, ATF6, p-eIF-2α, ATF4, DDIT3) was significantly upregulated.

[0090] (2) After Lars2 was knocked down in HL-1 cells, the fluorescence intensity of ATF5 in the cell nucleus was significantly enhanced.

[0091] (3) The results of the dual-luciferase experiment showed that, compared with the control group, the ATF5-mediated transcriptional activity of the Lars2 knockdown group cells was significantly enhanced.

[0092] Experimental conclusion: This study found that Lars2 deficiency or reduced expression significantly impairs mitochondrial function in cardiomyocytes, manifested as decreased ATP production, decreased membrane potential, enhanced oxidative stress, and mitochondrial dynamics imbalance, further inducing myocardial remodeling and fibrosis, ultimately leading to cardiac dysfunction. Multiomics results indicate that the key mechanism may be closely related to impaired mitochondrial protein translation and disruption of protein homeostasis. Simultaneously, Lars2 deficiency activates the mitochondrial unfolded protein response centered on ATF5, accompanied by a synchronous enhancement of the endoplasmic reticulum stress pathway, forming a cross-organelle stress regulatory network. In vitro and in vivo experiments further confirmed the upregulation of ATF5 nuclear translocation and transcriptional activity, suggesting that ATF5-mediated stress responses may play an important role in Lars2 deficiency-related myocardial injury.

[0093] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A method for constructing a conditional Lars2 knockout mouse model of myocardial infarction, characterized in that: Step 1: Lars2 flox / flox Mice via Myh6-Cre + / - Mouse hybridization yielded Myh6-Cre + / - Lars2 flox / - Mice; Step 2: Myh6-Cre + / - Lars2 flox / - With Lars2 flox / flox Mouse hybridization yielded Myh6-Cre + / - Lars2 flox / flox Myh6-Cre + / - Lars2 flox / - Myh6-Cre - / - Lars2 flox / flox Myh6-Cre - / - Lars2 flox / - Four mouse genotypes, including Myh6-Cre - / - Lars2 flox / flox As the control group mice, hereinafter referred to as Lars2 fl / fl Myh6-Cre + / - Lars2 flox / flox Mice with conditional Lars2 knockout in myocardium, referred to as the experimental group, are hereinafter referred to as Lars2 mice. cko Mice.

2. The method for constructing a conditional knockout Lars2 mouse model of myocardium according to claim 1, characterized in that: At 8 weeks of age, mice in both the control and experimental groups were treated with intraperitoneal injection of tamoxifen 40 mg / kg for 5 consecutive days. One week after the 5-day injection, the mice's hearts were imaged using a small animal ultrasound imaging device to monitor cardiac contractile function.

3. The method for constructing a conditional knockout Lars2 mouse model of myocardium according to claim 1, characterized in that: Purified Lars2 flox / + Mice were bred through mating to obtain Lars2. flox / flox Mice.

4. The method for constructing a conditional knockout Lars2 mouse model of myocardial infarction according to claim 1, characterized in that: Cre mice were bred by mating Cre recombinase heterozygotes with wild-type C57BL / 6 mice to obtain Myh6-Cre mice. + / - Mice.

5. The method for constructing a conditional knockout Lars2 mouse model of myocardium according to claim 1, characterized in that: Breeding mice produce offspring. At 7-10 days of age, 2-3 mm tails are harvested from the offspring. The genome is extracted using a kit, and the target gene is amplified by PCR. The primers are as follows: upstream of flox: GTAGAGGTCGAGGACAGCTTATG, downstream: GCAGAGCAGTAAGAGGCAAGTG. Myh6-Cre upstream: CATGCCAATGGTTCACTCTAAGGT, downstream: TCTCTATTGTCCCAAAGTGCAGACAC PCR amplification was performed using a cyclic amplification instrument. A 1.5% agarose gel was prepared using 100 mL of 0.5×TBE solution and 1.5 g of agarose powder. 10 μL of the PCR final product was added to the agarose gel for electrophoresis at a constant voltage of 150 V for 45 min. The images were analyzed and saved using an automated gel imaging system. The mice were identified as flox (Targeted: 211 bp, WT: 144 bp) and Myh6-Cre (Targeted: 335 bp). Homozygous flux and positive Myh6-Cre results identified the target mice (Myh6-Cre). + / - Lars2 flox / flox ); mice that are homozygous for flux and negative for Myh6-Cre are considered wild-type littermates (Myh6-Cre). - / - Lars2 flox / flox ).

6. The application of a conditional knockout Lars2 mouse model of myocardium as described in claims 1-5 for the study of myocardial pathology.

Images