Shrimp immune enhancer based on orphan nuclear receptor ftz-f1l and application thereof

Abstract

This invention belongs to the field of biotechnology and discloses an immune enhancer for shrimp based on the orphan receptor Ftz-F1L and its application. This invention is the first to identify the orphan receptor Ftz-F1L in Litopenaeus vannamei and confirms that it is a key positive regulator of the NF-κB pathway, significantly enhancing the shrimp's resistance to WSSV and Vibrio parahaemolyticus. It is an ideal target for developing novel and precise immune enhancers. The immune capacity of Litopenaeus vannamei can be enhanced by promoting endogenous expression of Ftz-F1L or by exogenous addition of Ftz-F1L, with a solid scientific basis and stable and controllable effects.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a shrimp immune enhancer based on the orphan receptor Ftz-F1L and its application. Background Technology

[0002] Litopenaeus vannamei ( Litopenaeus vannamei Litopenaeus vannamei (shrimp) is the highest-yielding and most economically valuable shrimp species in my country's marine aquaculture industry. In 2024, my country's total marine aquaculture production of Litopenaeus vannamei reached 1.533 million tons, accounting for 82.5% of the total shrimp production in marine aquaculture. It plays an irreplaceable role in ensuring aquatic product supply and promoting the development of the fisheries economy. In recent years, with the rapid transformation of aquaculture towards intensive, high-density, and factory-style production, the scale of aquaculture has continued to expand, and the density of aquaculture has increased. This has led to a surge in pressure on the aquatic environment, with the accumulation of uneaten feed and excrement causing excessive ammonia nitrogen levels and an imbalance in the aquatic microecology. This has caused continuous damage to the shrimp's hepatopancreas, intestines, and immune system, resulting in a significant decrease in disease resistance and increasingly frequent disease outbreaks. This has become a core bottleneck restricting the healthy development of the industry.

[0003] Currently, the main diseases affecting Litopenaeus vannamei farming fall into two categories: viral and bacterial diseases. Among them, White Spot Syndrome Virus (WSSV) is the most serious viral pathogen, characterized by a wide host range, rapid transmission, and a mortality rate as high as 100%, capable of causing the entire pond to die within a short period. Pathogenic Vibrio parahaemolyticus and other pathogenic Vibrio species are the main bacterial pathogens, which can cause acute hepatopancreatic necrosis disease (AHPND), characterized by rapid onset and high mortality, leading to large-scale early mortality of shrimp. Furthermore, the mixed infections and persistent outbreaks of pathogens such as Decapoda Iridovirus 1 (DIV1), Taura syndrome virus (TSV), and Enterocytozoon hepatocellular carcinoma (EHP) further exacerbate the risks to shrimp farming, causing significant economic losses to farmers.

[0004] Currently, disease control in shrimp farming still relies primarily on antibiotics and chemical disinfectants. While these have direct antibacterial and bactericidal effects, long-term overuse has led to increased pathogen resistance, excessive drug residues, damage to the microecology of aquaculture water, and significant food safety risks. This contradicts the policy direction of green and healthy aquaculture and has resulted in strict restrictions on their use. Existing immune enhancers on the market mainly include polysaccharides (β-glucan, peptidoglycan), microecological preparations, vitamins, and traditional Chinese medicine preparations. These enhance immune enzyme activity through non-specific stimulation, but generally suffer from drawbacks such as unclear target sites, unclear mechanisms of action, slow onset of action, limited efficacy, cumbersome application, high cost, and unstable effects. They struggle to achieve precise, efficient, and rapid immune activation, and intervention after disease onset is often slow to take effect. RNA interference-based antiviral agents and recombinant protein / subunit vaccines are also used. RNA interference-based antiviral agents primarily knock down negatively regulating immune genes, often employing dsRNA delivery technology. However, they suffer from drawbacks such as high cost of in vitro synthesis, difficult delivery, poor stability, and difficulty in large-scale aquaculture application. Recombinant protein / subunit vaccines mostly target WSSV structural proteins (VP28, VP39), targeting only a single virus and lacking broad-spectrum disease resistance. Furthermore, their oral delivery efficiency is low, and they are easily degraded, limiting their practical effectiveness. In addition, there are methods that simply mix probiotics and proteins with feed, administering the active substances after feeding. However, this method results in rapid diffusion and degradation of the active substances, extremely low bioavailability, and inability to effectively reach target tissues to exert their effects. In other words, current immune enhancers suffer from the following drawbacks: unclear target sites, ambiguous immune regulation mechanisms, uncontrollable and unrepeatable effects; slow onset of action, poor emergency disease resistance, and inability to quickly activate the immune system after shrimp become ill; extremely low oral delivery efficiency, easy degradation and loss of active substances, and low intestinal absorption. The production process is complex, raw material costs are high, and large-scale factory production is difficult; significant safety risks exist, including antibiotic residues, chemical contamination, and drug resistance; a lack of precise targeting prevents direct activation of the NF-κB core antiviral and antibacterial pathway; and a narrow disease spectrum, with most products only effective against bacteria or viruses, failing to achieve broad-spectrum protection.

[0005] Shrimp are invertebrates lacking an adaptive immune system and rely entirely on their innate immune system to defend against pathogen invasion. Innate immunity mainly includes cellular immunity (phagocytosis, apoptosis, encapsulation) and humoral immunity (effect molecules such as antimicrobial peptides, lectins, and lysozymes). Its core regulatory pathway is the NF-κB signaling pathway, including the Toll and IMD pathways. This pathway can rapidly respond to pathogen infection and initiate the expression of downstream immune genes, forming the core defense mechanism against viruses and bacteria in shrimp. Therefore, targeting and activating the NF-κB pathway to enhance shrimp's own immunity is the ideal strategy for developing green, safe, and highly effective disease-resistant agents.

[0006] Orphan receptors (ONRs) are important members of the nuclear receptor superfamily. The Ftz-F1 family belongs to the NR5A subfamily and is highly conserved in evolution, participating in the regulation of key life processes such as cell differentiation, embryonic development, and metabolism. In invertebrates, research on Ftz-F1 family proteins has mainly focused on the regulation of molting, development, and reproduction in insects. Their immune regulatory functions and molecular mechanisms in crustaceans, especially shrimp, have not yet been systematically elucidated. Summary of the Invention

[0007] This invention aims to solve at least one of the technical problems existing in the prior art, and provides a precise immune enhancement scheme with Ftz-F1L as the core target, directly activating the NF-κB pathway to enhance the innate immunity of Litopenaeus vannamei from the source; constructing a TAT-Ftz-F1L fusion protein, utilizing TAT membrane-penetrating peptides to break through the cell membrane and intestinal barrier, significantly improving protein delivery efficiency and bioavailability; constructing an engineered Escherichia coli strain that can stably and efficiently express the TAT-Ftz-F1L fusion protein, achieving low-cost, large-scale, and standardized production; and establishing a sodium alginate-Ca... 2+ Cross-linked coating oral feeding system prevents bacterial loss, improves stability, and is suitable for use in aquaculture. Develop a green, safe, efficient, low-cost, and easy-to-use oral immune enhancer for Litopenaeus vannamei, which significantly improves shrimp's resistance to WSSV and Vibrio parahaemolyticus, and reduces mortality in aquaculture.

[0008] The first aspect of the present invention is to provide the application of the Ftz-F1L accelerator.

[0009] A second aspect of the present invention is to provide a fusion protein.

[0010] A third aspect of the present invention aims to provide biomaterials for fusion proteins with those of the second aspect of the present invention.

[0011] The fourth aspect of this invention aims to provide the application of the fusion protein of the second aspect of this invention or the biomaterial of the third aspect of this invention.

[0012] The fifth aspect of this invention aims to provide a reagent or drug.

[0013] The sixth aspect of the present invention is to provide a feed.

[0014] The seventh aspect of this invention is to provide a method for preparing feed according to the sixth aspect of this invention.

[0015] The objective of the eighth aspect of this invention is to provide a method for aquaculture.

[0016] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the invention provides the use of the Ftz-F1L accelerator in (1) or (2): (1) Application in the preparation of drugs for the treatment and / or prevention of pathogenic microorganism infections in aquatic animals; (2) Preparation of immune enhancers for aquatic animals; The amino acid sequence of the Ftz-F1L is shown in SEQ ID NO:2.

[0017] In some embodiments of the present invention, the Ftz-F1L promoter includes substances that enhance the activity of Ftz-F1L protein, substances that synthesize Ftz-F1L, substances that overexpress Ftz-F1L, or substances that enhance the expression level of Ftz-F1L.

[0018] In some embodiments of the present invention, the pathogenic microorganisms include viruses and bacteria.

[0019] In some embodiments of the present invention, the virus includes white spot syndrome virus, decapod iridoid virus 1, Taura syndrome virus, and shrimp hepatocellular carcinoma.

[0020] In some embodiments of the present invention, the bacteria include Vibrio, such as Vibrio parahaemolyticus.

[0021] In some embodiments of the present invention, the aquatic animal includes shrimp, such as Litopenaeus vannamei.

[0022] In a second aspect, the present invention provides a fusion protein comprising Ftz-F1L and a cell-penetrating peptide; the amino acid sequence of said Ftz-F1L is shown in SEQ ID NO:2.

[0023] Cell penetrating peptide (CPP): also known as "cell penetrating peptide", "protein translocation domain (PTD), "Trojan horse peptides" or "transduction peptide", refers to polypeptides that can promote the uptake of various molecules (e.g., various macromolecules including proteins or nucleic acids) by cells.

[0024] In some embodiments of the present invention, the cell-penetrating peptide is selected from TAT (YGRKKRRQRRR), HIV-TAT (GRKKRRQRRRPPQ, SEQ ID NO:51), KLA-TAT (KLAKLAKKLAKLAKGRKKRRQRRRP, SEQ ID NO:52), Penetratin (RQIKIWFQNRRMKWKK, SEQ ID NO:53), HIV-1Rev (34-50) (KQAIPVAK, SEQ ID NO:54), P22N (NAKTRRHERRRKLAIER, SEQ ID NO:55), DPV3 (RKKRRRESRKKRRRES, SEQ ID NO:56), DPV6 (GRPRESGKKRKRKRLKP, SEQ ID NO:57), Pep-1 (Ac-KETWWETWWTEWSQPKKKRKV-NH-CH2-CH2-SH, SEQ ID NO:54), and Pep-1 (Ac-KETWWETWWTEWSQPKKKRKV-NH-CH2-CH2-SH, SEQ ID NO:55). NO:58), Pep-7 (SDLWEMMMVSLACQY, SEQ ID NO:59), VP22 (DAATATRGRSAASRPTERPRAPARSASRPRRPVE, SEQ ID NO:60), R8 (RRRRRRRR, SEQ ID NO:61), transit peptide (GWTLNSAGYLLGKINLKALAALAKKIL, SEQ ID NO:62), RV24 (RRRRRRRRRGPGVTWTPQAWFQWV, SEQ ID NO:63), AIF (NYRWRCKNQN, SEQ ID NO:64), SynB3 (RRLSYSRRRF, SEQ ID NO:65) and MAP (KLALKLALKALKAALKLA, SEQ ID NO:66).

[0025] In some embodiments of the present invention, the cell-penetrating peptide is attached to the N-terminus or C-terminus of Ftz-F1L.

[0026] In some embodiments of the present invention, the amino acid sequence of the fusion protein is shown in SEQ ID NO:50.

[0027] In some embodiments of the present invention, the fusion protein further includes a tag sequence that assists in expression and / or purification.

[0028] In some embodiments of the present invention, the tag sequence is selected from at least one of the following groups: His tag, GGGS sequence, FLAG tag, HA tag, GST tag, SUMO tag.

[0029] A third aspect of the invention provides biomaterials related to the fusion protein of the second aspect of the invention, said biomaterials comprising at least one of a1)-a12): a1) A nucleic acid molecule encoding the fusion protein of the second aspect of the present invention; a2) An expression cassette containing the nucleic acid molecule described in a1); a3) A carrier containing the nucleic acid molecule described in a1); a4) A carrier containing the expression box described in a2); a5) Transgenic cell lines containing the nucleic acid molecules described in a1); a6) Transgenic cell lines containing the expression cassette described in a2); a7) A transgenic cell line containing the vector described in a3); a8) A transgenic cell line containing the vector described in a4); a9) Microorganisms containing the nucleic acid molecules described in a1); a10) Microorganisms containing the expression cassette described in a2); a11) Microorganisms containing the carrier described in a3); a12) Microorganisms containing the carrier described in a4); The transgenic cell line does not contain propagation material.

[0030] In some embodiments of the present invention, the vector may be any suitable recombinant expression vector, including plasmids for amplifying nucleic acid molecules, or viral vectors for transfecting cells, including but not limited to retroviral vectors, DNA vectors, murine leukemia virus vectors, SFG vectors, plasmids, RNA vectors, adenovirus vectors, baculovirus vectors, Epstein-Barr virus vectors, papillomavirus vectors, vaccinia virus vectors, herpes simplex virus vectors, adenovirus-associated vectors, lentiviral vectors, or any combination thereof.

[0031] In some embodiments of the present invention, the carrier is pET-32a.

[0032] In some embodiments of the invention, the nucleic acid molecule is codon-optimized for expression in mammalian cells, insect cells, yeast cells, or Escherichia coli.

[0033] In some embodiments of the present invention, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:49.

[0034] In some embodiments of the present invention, the transgenic cell line is a host cell for producing the fusion protein of the present invention, including but not limited to prokaryotic cells, fungal cells, yeast cells, or higher eukaryotic cells such as mammalian cells.

[0035] In some embodiments of the present invention, the transgenic cell lines include Escherichia coli, Bacillus subtilis, lactic acid bacteria, and yeast cells.

[0036] In some embodiments of the present invention, the transgenic cell line is a human cell, such as CHO cells (including but not limited to CHOS cells, CHO-K1 cells) and HEK293 cells (including but not limited to HEK293A, HEK293T and HEK293FS).

[0037] In some embodiments of this invention, an engineered *E. coli* strain capable of stably and efficiently expressing the TAT-Ftz-F1L fusion protein is constructed, achieving low-cost, large-scale, and standardized production. The production of the fusion protein via *E. coli* fermentation utilizes inexpensive raw materials and a simple process, making it suitable for factory-scale aquaculture.

[0038] A fourth aspect of the invention provides the use of the fusion protein of the second aspect of the invention or the biomaterial of the third aspect of the invention in any one of b1)-b3): b1) Use in the preparation of drugs for the treatment and / or prevention of pathogenic microbial infections in aquatic animals; b2) Preparation of immune enhancers for aquatic animals; b3) Prepare feed for aquatic animals.

[0039] In some embodiments of the present invention, the pathogenic microorganisms include viruses and bacteria.

[0040] In some embodiments of the present invention, the virus includes white spot syndrome virus, decapod iridoid virus 1, Taura syndrome virus, and shrimp hepatocellular carcinoma.

[0041] In some embodiments of the present invention, the bacteria include Vibrio, such as Vibrio parahaemolyticus.

[0042] In some embodiments of the present invention, the aquatic animal includes shrimp, such as Litopenaeus vannamei.

[0043] A fifth aspect of the invention provides a reagent or drug comprising the fusion protein of the first aspect of the invention.

[0044] In some embodiments of the present invention, the reagent includes an immunostimulant. This immunostimulant can regulate the NF-κB signaling pathway and modulate the expression of immune effector molecules such as antimicrobial peptides and lectins to enhance the immunity of aquatic animals.

[0045] In some embodiments of the present invention, the drug further includes pharmaceutically acceptable excipients.

[0046] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one selected from fillers, disintegrants, diluents, dispersants, excipients, stabilizers, lubricants, binders, humectants, flavoring agents, solubilizers, suspending agents, solvents, sustained-release agents, emulsifiers, absorption enhancers, surfactants, preservatives, pigments, fragrances, and solvents.

[0047] A sixth aspect of the present invention provides a feed comprising the transgenic cell line and basal diet of the second aspect of the present invention.

[0048] In some embodiments of the present invention, the feed further includes a coating material.

[0049] In some embodiments of the present invention, the coating material includes at least one of sodium alginate, chitosan, and modified starch; preferably sodium alginate.

[0050] The sodium alginate and Ca 2+ Cross-linked gels embed transgenic cell lines onto the surface of feed, improving feed stability and feed utilization. Specifically, sodium alginate is used in the process of embedding transgenic cell lines onto the surface of feed. 2+ The characteristic of forming a water-insoluble gel under the action of [the substance] allows the fusion protein expression bacteria to be coated on the surface of shrimp feed, preventing the expression bacteria (such as E. coli) on the feed surface from spreading into the water after the feed is scattered, thereby reducing the shrimp's intake rate of the fusion protein expression bacteria. In addition, sodium alginate, as a type of mannose, can effectively enhance the shrimp's ammonia nitrogen stress resistance, hypoxia resistance, and immunity. 2+ It can also effectively enhance the formation and hardening of the shrimp's shell, promoting shrimp growth. Therefore, the use of the feed of this invention will not have an adverse effect on shrimp growth and has extremely high safety.

[0051] In some embodiments of the present invention, the mass ratio of the transgenic cell line to the basal diet is 1:(10-30), such as any ratio or a range of two of 1:10, 1:15, 1:20, 1:25 or 1:30.

[0052] In some embodiments of the present invention, the mass ratio of the coating material to the basal diet is 1:(40-60), such as any ratio or a range of two of 1:40, 1:45, 1:50, 1:55 or 1:60.

[0053] Experiments have shown that oral administration of the feed provided by this invention for five consecutive days can significantly improve the immune indicators of Litopenaeus vannamei and greatly increase the survival rate after viral challenge. This feed contains no antibiotics or chemical drugs, making it safe for shrimp, water, and humans, and complies with green aquaculture policies.

[0054] A seventh aspect of the present invention provides a method for preparing feed according to the sixth aspect of the present invention, comprising the following steps: mixing a transgenic cell line, a basal diet and a coating material, and adding a cross-linking agent solution to obtain the feed.

[0055] In some embodiments of the present invention, the crosslinking agent includes CaCl2.

[0056] An eighth aspect of the present invention provides a method for aquaculture, comprising the step of treating aquatic animals with a fusion protein of the second aspect of the present invention, a reagent or drug of the fifth aspect of the present invention, or a feed of the sixth aspect of the present invention.

[0057] In some embodiments of the present invention, the processing method includes feeding.

[0058] In some embodiments of the present invention, the aquatic animal includes shrimp, such as Litopenaeus vannamei.

[0059] The beneficial effects of this invention are: This invention identifies the orphan receptor Ftz-F1L in Litopenaeus vannamei for the first time and confirms that it is a key positive regulator of the NF-κB pathway, significantly enhancing the anti-WSSV and anti-Vibrio parahaemolyticus abilities of Litopenaeus vannamei. It is an ideal target for developing novel precision immune enhancers. The anti-immunity of Litopenaeus vannamei can be enhanced by promoting endogenous expression of Ftz-F1L or by exogenous addition of Ftz-F1L, with a solid scientific basis and stable and controllable effects.

[0060] This invention provides a fusion protein (TAT-Ftz-F1L fusion protein) that links a cell-penetrating peptide to Ftz-F1L, enhancing the ability of Ftz-F1L protein to penetrate the cell membrane and intestinal barrier of Litopenaeus vannamei, significantly improving protein delivery efficiency, solving the problem of oral absorption, and achieving a bioavailability far exceeding that of traditional products. This fusion protein can activate the NF-κB pathway and enhance the anti-WSSV and anti-Vibrio activity of Litopenaeus vannamei.

[0061] This invention provides a feed that uses a coating material (such as sodium alginate) - Ca 2+ Cross-linking coating can stably express cell lines (such as *E. coli*) of the TAT-Ftz-F1L fusion protein onto the surface of the basal diet. This is an oral feeding system that prevents bacterial loss, improves stability, and is suitable for use in aquaculture. This feed is a green, safe, efficient, low-cost, and easy-to-use oral immune-enhancing feed for Litopenaeus vannamei, significantly improving the shrimp's resistance to WSSV and Vibrio parahaemolyticus, and reducing mortality in aquaculture.

[0062] The mechanism of action of the feed provided by this invention in improving the immunity of Litopenaeus vannamei (triple synergistic effect): (1) Targeted activation of immunity: After the fused cells enter the cells, they activate the NF-κB pathway and directly upregulate immune effector molecules. (2) Efficient transmembrane delivery: Cell-penetrating peptides break through the intestinal and cell membrane barriers, greatly improving protein utilization. (3) Coating and stabilizing synergistic effect: Sodium alginate reduces water loss and achieves slow release in the intestine, while also helping to enhance immunity. Attached Figure Description

[0063] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 Analysis of the nucleotide sequence of the Ftz-F1L gene and its encoded protein domains in Litopenaeus vannamei; where A is the nucleotide and amino acid sequence of the Ftz-F1L gene; B is a schematic diagram of the Ftz-F1L protein domains, with the blue area representing the ZnF_C4 domain and the green area representing the HOLI domain.

[0064] Figure 2 This study analyzed the tissue expression distribution and subcellular localization of LvFtz-F1L. A represents the expression level of LvFtz-F1L in different tissues of Litopenaeus vannamei detected by qRT-PCR; B represents the subcellular localization of LvFtz-F1L in S2 cells. Scale bar: 5 μm.

[0065] Figure 3 The expression changes of Ftz-F1L in hemocytes (A) and gills (B) of Litopenaeus vannamei after stimulation by pathogen and pathogen-associated molecular patterns are shown in the bar chart, which represents the mean ± standard deviation (mean ± SD) of three replicates. : p <0.05, : p <0.01, ns: no significant difference.

[0066] Figure 4 The effect of silencing Ftz-F1L on the expression of immune-related genes in hemolymphocytes (A) and gills (B) of Litopenaeus vannamei. : p <0.05, : p <0.01.

[0067] Figure 5 The survival rate and bacterial content of shrimp infected with Vibrio parahaemolyticus after silencing Ftz-F1L were shown. Among them, A represents the survival rate of shrimp after challenge with Vibrio parahaemolyticus; B represents the bacterial content in the muscle of shrimp after challenge with Vibrio parahaemolyticus; the bar chart represents the mean ± standard deviation of three replicate experiments. :p <0.01.

[0068] Figure 6 The survival rate and viral load of shrimp infected with WSSV after silencing Ftz-F1L are shown in Figure 1. Where A represents the survival rate of shrimp after WSSV challenge; B represents the viral load in the muscle of shrimp after WSSV challenge; the bar chart represents the mean ± standard deviation of three replicate experiments. : p <0.01.

[0069] Figure 7 The membrane penetration effect of TAT on Litopenaeus vannamei hemocytes is shown, with a scale bar of 20 μm.

[0070] Figure 8 For TAT-GFP protein cytotoxicity analysis, results are expressed as mean ± standard deviation (mean ± SD) of four replicates. ns: no significant difference.

[0071] Figure 9 SDS-PAGE analysis of the TAT-GFP and TAT-Ftz-F1L fusion protein; in the figure, lane 1: supernatant after pET-32a empty vector induction; lane 2: precipitate after pET-32a empty vector induction; lane 3: supernatant after TAT-GFP induction; lane 4: precipitate after TAT-GFP induction; lane 5: supernatant after TAT-Ftz-F1L induction; lane 6: precipitate after TAT-Ftz-F1L induction; the arrows indicate the target protein bands.

[0072] Figure 10 The results of Western Blot identification of the TAT-GFP-His and TAT-Ftz-F1L-His fusion protein.

[0073] Figure 11 The distribution of TAT-Ftz-F1L fusion eggs in the intestinal tissue of Litopenaeus vannamei after feeding is shown on a scale bar of 100 μm.

[0074] Figure 12 This is a schematic diagram of the preparation process for sodium alginate-coated engineered bacteria feed.

[0075] Figure 13 The effect of feeding the sodium alginate-coated engineered bacteria diet prepared in Example 6 on the expression of immune-related genes in the gills (A) and hemolymphocytes (B) of Litopenaeus vannamei. In the figure, ns: no significant difference. : p <0.05, : p <0.01.

[0076] Figure 14 To detect the phagocytic level and relative phagocytic activity of Litopenaeus vannamei hemolymphocytes in the TAT-GFP and TAT-Ftz-F1L groups using flow cytometry, statistical analysis was performed. Data are expressed as mean ± standard deviation (mean ± SD) of three replicate experiments. : p <0.0001.

[0077] Figure 15 The survival rate and bacterial content of shrimp infected with Vibrio parahaemolyticus after feeding with the sodium alginate-coated engineered bacteria diet prepared in Example 6 were measured. Wherein, A represents the shrimp survival rate after Vibrio parahaemolyticus challenge (TAT-Fz-F1L+VPa indicates infection with Vibrio parahaemolyticus after feeding with sodium alginate-coated engineered bacteria diet, TAT-GFP+VPa indicates infection with Vibrio parahaemolyticus after feeding with a diet containing sodium alginate gel-embedded TAT-GFP control strain, TAT-Ftz-F1L+PBS indicates infection with PBS as a challenge control after feeding with sodium alginate-coated engineered bacteria diet, TAT-GFP+P...). BS indicates that after feeding shrimp with a diet containing sodium alginate gel-embedded TAT-GFP control strain, PBS was injected as a Vibrio control; B represents the bacterial content in shrimp muscle after Vibrio parahaemolyticus challenge (PBS indicates that shrimp were fed with PBS instead of bacterial feed before Vibrio challenge, TAT-GFP indicates that shrimp were infected with Vibrio parahaemolyticus after being fed a diet containing sodium alginate gel-embedded TAT-GFP control strain, and TAT-Fz-F1L indicates that shrimp were infected with Vibrio parahaemolyticus after being fed a diet containing sodium alginate-embedded TAT-Ftz-F1L strain); the bar chart represents the mean ± standard deviation of three replicate experiments. : p <0.01.

[0078] Figure 16The survival rate and viral load of shrimp infected with WSSV after being fed the sodium alginate-coated engineered bacteria diet prepared in Example 6 were measured. Where A represents the shrimp survival rate after WSSV challenge (TAT-Fz-F1L+WSSV indicates shrimp infected with WSSV after being fed the sodium alginate-coated TAT-Ftz-F1L engineered bacteria diet; TAT-GFP+WSSV indicates shrimp infected with WSSV after being fed the sodium alginate gel-embedded TAT-GFP control engineered strain diet; TAT-Ftz-F1L+PBS indicates shrimp infected with WSSV after being fed the sodium alginate-coated TAT-Ftz-F1L engineered bacteria diet and injected with PBS as a challenge control). Shrimp, TAT-GFP+PBS indicates shrimp fed with sodium alginate gel-embedded TAT-GFP control engineered bacteria and then injected with PBS as a challenge control; B: WSSV viral load in shrimp muscle after challenge (PBS indicates shrimp fed with PBS instead of bacterial feed and then challenged with WSSV, TAT-GFP indicates shrimp infected with WSSV after being fed with sodium alginate gel-embedded TAT-GFP engineered bacteria, TAT-Fz-F1L indicates shrimp infected with WSSV after being fed with sodium alginate-coated TAT-Fz-F1L engineered bacteria); the bar chart represents the mean ± standard deviation of three replicate experiments. : p <0.01. Detailed Implementation

[0079] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0080] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0081] Terminology Explanation: Litopenaeus vannamei ( Litopenaeus vannamei Litopenaeus vannamei (also known as whiteleg shrimp) is a major farmed shrimp species worldwide. Orphan receptor Ftz-F1L: This invention identifies a novel orphan receptor in Litopenaeus vannamei, which is a positive regulator of innate immunity. NF-κB signaling pathway: a core innate immune pathway in shrimp, responsible for regulating the expression of immune effector molecules such as antimicrobial peptides and lectins. TAT membrane-penetrating peptide: a short peptide derived from HIV that can efficiently carry exogenous proteins through cell membranes and tissue barriers.

[0082] TAT-Ftz-F1L fusion protein: A recombinant fusion protein of TAT transmembrane peptide and Ftz-F1L protein, which can achieve transmembrane delivery and activate shrimp immunity. Engineered bacteria: Genetically modified Escherichia coli that can stably express the TAT-Ftz-F1L fusion protein.

[0083] Sodium alginate coating: utilizing sodium alginate-Ca 2+ Cross-linked gels encapsulate engineered bacteria on the surface of feed, improving stability and feed utilization.

[0084] This invention systematically studies the immunomodulatory function of the solitary nucleus receptor Ftz-F1L in Litopenaeus vannamei. Through a complete technical route including gene cloning, protein recombination, engineered bacterial construction, transmembrane delivery, sodium alginate coating, and oral feeding, it achieves precise activation of the shrimp's innate immunity and ultimately develops an oral immune enhancer that can be directly applied to aquaculture production. This section provides a complete description of gene function analysis, fusion protein construction and expression, transmembrane activity verification, coated feed preparation, oral immune activation effect, and disease resistance evaluation, ensuring that those skilled in the art can reproduce all the technical content without creative effort.

[0085] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0086] Example 1: Immune function and molecular mechanism of Ftz-F1L To investigate the immune function and molecular mechanism of Ftz-F1L in Litopenaeus vannamei, this study constructed the pAc5.1-Ftz-F1L recombinant plasmid and transfected it into S2 cells. The subcellular localization of the Ftz-F1L protein in the cells was observed and analyzed using laser scanning confocal microscopy. Furthermore, the antiviral and antibacterial immune responses of Ftz-F1L in shrimp were investigated using pathogen stimulation experiments. The specific experimental procedures are as follows: (1) The full-length Ftz-F1L ORF sequence of Litopenaeus vannamei was obtained by PCR amplification (nucleotide sequence as shown in SEQ ID NO: 1), and after double enzyme digestion, it was cloned and ligated into the pAc5.1-GFP expression vector, and then transformed into Escherichia coli (E. coli). Escherichia coliCloning was performed, and after PCR identification and sequencing screening, positive clones containing the pAc5.1-Ftz-F1L recombinant plasmid were obtained. Specifically, primers PvFtz-F1L-EcoRI-F (5'-GATGAATTCATCAAAATGTCGGTTGTGATGAGAACAGAC-3', SEQ ID NO:4) and PvFtz-F1L-BstBI-R (5'-CAGTTCGAATTTCCTTTTGGTGTGCAGC-3', SEQ ID NO:5) were used to clone the complete ORF sequence of PvFtz-F1L, carrying EcoRI and BstBI restriction sites at both ends, from the cDNA of Litopenaeus vannamei. After purification and recovery of the PCR product by agarose gel electrophoresis, it was double-digested with EcoRI and BstBI. Simultaneously, the empty vector pAc5.1a was also double-digested with EcoRI and BstBI. The PvFtz-F1L and pAc5.1a vectors were double-digested with enzymes and then purified and recovered by agarose gel electrophoresis. After recovery, the PvFtz-F1L DNA fragment was ligated to the pAc5.1a vector using T4 ligase. After ligation, the ligation product was transformed into *E. coli* (…). Escherichia coli The bacterial colonies were cultured overnight to obtain bacterial growth. Single bacterial colonies were picked and cultured on LB medium containing 100 μg / mL ampicillin for expansion. After expansion, 1 μL of bacterial culture was used as a template, and positive clones were identified by PCR using PvFtz-F1L-EcoRI-F and PvFtz-F1L-BstBI-R. After agarose gel electrophoresis, the PCR products were sent to a sequencing company for sequencing to confirm the correctness of the PvFtz-F1L expression reading frame.

[0087] (2) Expand the culture of pAc5.1-Ftz-F1L positive clones and extract the pAc5.1-Ftz-F1L endotoxin-free plasmid using an endotoxin-free plasmid extraction kit (OMEGA, catalog number: D6950).

[0088] (3) S2 cells (Drosophila cells) were evenly seeded into confocal culture dishes with a confluence of 60%-80%. After the cells adhered and grew well, 3 μg of pAc5.1-Ftz-F1L expression plasmid was added to 200 μL of serum-free SIM medium (Cyber-Tech (Shanghai) Biotechnology Co., Ltd., catalog number: iCell-C041-001b) and gently mixed. Then, 9 μL of Fugene transfection reagent (Promega, catalog number: E2311) was added, and the mixture was gently shaken for 30 s. The mixture was then incubated at room temperature (25 ℃) for 15 min to form a transfection complex. After that, 1.5 mL of complete culture medium was added to the above mixture and mixed well. The original SIM medium in the culture dish was discarded, and the above transfection mixture was added to the corresponding well. 36 h after transfection, the subcellular localization of the fusion protein in the cells was observed and analyzed using a laser scanning confocal microscope.

[0089] The results showed that the full-length Ftz-F1L mRNA was 2253 bp (SEQ ID NO:3), with a 5' untranslated region of 170 bp, a 3' untranslated region of 319 bp, an open reading frame of 1764 bp (SEQ ID NO:1), encoding 587 amino acids (SEQ ID NO:2), a predicted molecular weight of 63.80 kDa, and an isoelectric point of 6.563. The protein contains a ZnF_C4 DNA-binding domain and a C-terminal HOLI ligand-binding domain (…). Figure 1 Subcellular localization experiments in S2 cells showed that the fluorescence signal of the Ftz-F1L-GFP fusion protein was mainly concentrated in the nucleus, indicating that it exerts its biological function as a nuclear transcription factor. Figure 2 ).

[0090] Ftz-F1L nucleotide sequence:

[0091] Ftz-F1L amino acid sequence: MSVVMRTDSRMAAANPMVDAEVVECSSDCSPLPLPPPPVHAHPPTNGMGVDGEVVLGVSVGGCDIERISPSQVTPVSSDTLSSSPDTQPATTTLDYTSLAELPDTKEGIEELCPVCGDKVSGYHYGLLTCESCKGFFKRTVQNKKVYTCVADRSCQIDKTQRKRCPYCRFQKCLEVGMKLEAVRADRMRGGRNKFGPMYKRDRARKLQMLRQRQLSHPGILSGGARHTSSGVAITYSAPGYSSAPSSHVHIKEEIQSPFLSSSTSSPDSSPSPMAGLGGLVAASGGVGGIVASGPVAPILAGPDPSLWVTNAQSTAGGVTTGTPPAGGVGGGGGGGGGGGGRTATGGPRIPHIIRELVETVDDQEWQASLFSLLQNQTYNQCEVDLFELMCKVLDQNLFAQVDWARNSCFFKDLKVDDQMKLLQHSWSDLLILDHLHQRIHNRLQDETTLPNGQKFDLLSLALLGTTQFADRFHAILNKLVDLKFDISDFVCIKFIILLNPDCIADVRLLSDRRSVTAAHDQVRQALMEYTANVYPDDTEKYQKLMDLLPELHFLAENGEKYLYYKHINGAAPTQTLLMEMLHTKRK (SEQ ID NO:2).

[0092] Fenneropenaeus vannamei Ftz-F1L gene sequence:

[0093] To investigate the effects of PvFtz-F1L on Litopenaeus vannamei ( ) Litopenaeus vannamei The role of WSSV in immune responses to different stimuli was investigated. Healthy shrimp were divided into several groups and injected abdominally with WSSV and Vibrio parahaemolyticus, respectively. V. parahaemolyticus ), polyinosinic-polycytidylic acid (poly(I:C)), lipopolysaccharide (LPS), or phosphate-buffered saline (PBS) as a control. In virus and bacterial challenge experiments, WSSV was diluted to 10. 6 Resuspend Vibrio parahaemolyticus in PBS at 10 copies / 50 μL PBS. 5 CFU / 50 μL. Poly(I:C) and LPS, as virus and Gram-negative bacteria mimics, were diluted with PBS to 5 μg / 50 μL before injection. The above reagents were injected into the muscle of the second abdominal segment of Litopenaeus vannamei, and hemolymphocytes and gill tissues were collected from six randomly selected shrimp at 0, 4, 12, 24, 48, 72, and 96 hours post-injection. Total RNA was extracted, and cDNA was synthesized according to the previously described method for transcriptional analysis of the target gene by qRT-PCR. The results showed that Ftz-F1L expression was significantly upregulated in hemolymphocytes and gill tissues after stimulation with white spot syndrome virus, Vibrio parahaemolyticus, lipopolysaccharide, and Poly(I:C), demonstrating its direct involvement in the antiviral and antibacterial immune responses of Litopenaeus vannamei. Figure 3 ).

[0094] Example 2: Core immune function of Litopenaeus vannamei Ftz-F1L To investigate the core immune function of Ftz-F1L in Litopenaeus vannamei, this embodiment uses in vitro synthesized double-stranded RNA to silence Ftz-F1L in vivo. The specific process is as follows: 1. dsRNA synthesis (1) Using the ORF of PvFtz-F1L as a template, specific primers were designed, and the T7 promoter sequence (5'-TAATACGACTCACTATAGG-3', SEQ ID NO:6) was introduced into the 5' end of the upstream and downstream primers, respectively, to obtain dsRNA cloning primers: PvFtz-F1L-dsT7F (5'-GGATCCTAATACGACTCACTATAGGATGTACAAACGCGACCGAG-3', SEQ ID NO:7), PvFtz-F1L-dsR (5'-CTGGTCGAGGACTTTGCAC-3', SEQ ID NO:8), PvFtz-F1L-dsF (5'-ATGTACAAACGCGACCGAG-3', SEQ ID NO:9) and PvFtz-F1L-dsT7R (5'-GGATCCTAATACGACTCACTATAGGCTGGTCGAGGACTTTGCAC-3', SEQ ID NO:8). NO:10) was subjected to PCR amplification to obtain a double-stranded DNA template containing the T7 promoter and then purified.

[0095] (2) Prepare the in vitro transcription reaction system according to the instructions of the kit (Promega, P1700). Add the DNA template, 2× T7 Express Buffer, T7 Express Enzyme Mix and RNase-free water to the centrifuge tube in sequence, mix gently and centrifuge briefly to collect the reaction solution. Incubate the reaction system at 37 ℃ for 30 min.

[0096] (3) After the in vitro transcription reaction is completed, the reaction system is placed on a PCR instrument and the incubation temperature is slowly reduced from 70℃ to 25℃ over 20 min to allow the complementary sense and antisense RNA to fully pair and anneal to form double-stranded RNA. Then, 50 mM nuclease is added and digested at 37℃ for 30 min.

[0097] (4) Purification of dsRNA was performed using ethanol precipitation. An appropriate amount of anhydrous ethanol was added to the reaction system and mixed well. The RNA was precipitated under low temperature conditions, and then centrifuged at 4 °C and 12000 ×g for 10 min to collect the precipitate. After discarding the supernatant, the precipitate was washed once with 75% ethanol, centrifuged again and the supernatant was discarded. The precipitate was dried at room temperature, and an appropriate amount of RNase-free water was added to dissolve the dsRNA. The precipitate was then stored at -20 °C for later use.

[0098] The sequence of dsRNA-PvFtz-F1L is as follows: (SEQ ID NO:11).

[0099] 2. In vivo injection and efficacy verification (1) Dissolve dsRNA in physiological saline and inject it into the second abdominal segment of shrimp at a ratio of 1 μg dsRNA per g shrimp, with GFP-dsRNA as the control group.

[0100] The GFP-dsRNA sequence is as follows: ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA(SEQ ID NO:12)。

[0101] (1) Forty-eight hours after dsRNA injection, six shrimp were randomly selected from each group. Hemolymphocytes and gill tissue were collected and placed in 2 mL nuclease-free grinding tubes. 300 μL of RNA lysis buffer and grinding beads were added. The grinding tubes were then placed in a pre-cooled cryogenic grinder and ground thoroughly at a frequency of 45 Hz, a 30-second interval, and a cycle of 10 times. After grinding, 300 μL of RNA diluent was added to the grinding buffer, and the mixture was mixed by pipetting. The mixture was then allowed to stand at room temperature for 10 min. The sample lysis buffer was obtained, and total RNA was extracted using an RNA extraction kit (Promega, catalog number: LS1040). After obtaining RNA, it was reverse transcribed into cDNA according to the instructions of the PrimeScript Reverse Transcription Premix Kit (Takara, catalog number: DRR047A).

[0102] (2) Using 1 μL of cDNA as a template, real-time quantitative PCR (qRT-PCR) was performed according to the SYBR® Premix Ex Taq PCR kit (Takara, catalog number: DRR081A). The reaction system was 10 μL, containing: 1 μL cDNA template, 0.5 μL of specific primers for each immune-related gene (10 μM, corresponding primer sequences are shown in Table 1), 5 μL 2× SYBR Premix Ex Taq II (Takara, Japan), and 3 μL nuclease-free water. The reaction was performed on a LightCycler 480 instrument (Roche, Germany), with the following thermal cycling program: initial denaturation at 95 °C for 3 min; 40 cycles: 95 °C for 10 s, 60 °C for 15 s, and 72 °C for 20 s. Melting curve analysis was performed immediately after amplification, with the temperature increased from 72 °C to 95 °C at a rate of 0.5 °C / s to verify amplification specificity. ΔΔCt The relative expression level of the target gene was calculated using a method with the extension factor 1alpha (EF-1α; GenBank accession number: GU136229) gene as an internal reference.

[0103] Table 1. Primer names and primer sequences used in quantitative PCR.

[0104] (3) To assess infection with white spot syndrome virus (WSSV) or Vibrio parahaemolyticus (VPS) V. parahaemolyticus The cumulative mortality rate after injection of dsRNA-PvFtz-F1L, GFP-dsRNA (control), or PBS (negative control) was measured 48 h after the shrimp (n=50) were inoculated intramuscularly with 10 saturated PBS. 6 Copy of WSSV or 10 6CFU of Vibrio parahaemolyticus. In the WSSV challenge experiment, mortality was recorded every 6 h, and muscle tissue was collected from 6 surviving shrimp at day 3 and day 5 post-infection (dpi). In the Vibrio parahaemolyticus challenge experiment, mortality was recorded every 2 h, and gill tissue was collected from 6 surviving shrimp at 12 h and 24 h post-infection (hpi) in parallel experiments to quantify pathogen load. Total DNA was extracted from muscle (WSSV) or gill (Vibrio parahaemolyticus) samples. WSSV-targeting pathogens were detected by qPCR. ie1 Gene (wsv069; GenBank accession number: AY422228) and toxin gene of Vibrio parahaemolyticus. pirA vp (GenBank accession number: KP324996) to quantify viral and bacterial load. Using extension factors... EF-1α For internal reference.

[0105] This invention uses in vitro synthesized double-stranded RNA for in vivo silencing, and the results show that the silencing efficiency can reach over 70%. Gene expression detection results show that after silencing Ftz-F1L, the transcriptional levels of a series of immune effector molecules, including NF-κB pathway transcription factors Dorsal, C-type lectins (CTL2, CTL4, CTL6), anti-lipopolysaccharide factors (ALF1, ALF3, ALF4), aspenin (PEN4), lysozyme (Lys-IT2), and heme-like protein, in shrimp hemocytes and gill tissues were significantly downregulated. Figure 4 The results of the challenge experiment further confirmed that the survival rate of shrimp with silenced Ftz-F1L strains was significantly reduced after infection with Vibrio parahaemolyticus, and the bacterial load in muscle tissue was significantly increased. Figure 5 Following infection with white spot syndrome virus, shrimp mortality rates approached 100%, and viral copy numbers in muscle tissue increased significantly. Figure 6 The above results collectively demonstrate that Ftz-F1L is a key positive regulator of innate immunity in Litopenaeus vannamei, and can enhance the disease resistance of shrimp by activating the NF-κB signaling pathway.

[0106] Example 3: Verification of TAT membrane penetration effect and biosafety 1. Membrane penetration capability test To verify the delivery capability of the TAT membrane-penetrating peptide (nucleotide sequence TATGGAGAAAGAAGAGAAGACAGAGAAGAAGA (SEQ ID NO:47), amino acid sequence YGRKKRRQRRR (SEQ ID NO:48)), this embodiment uses TAT... GFP was co-incubated with primary hemocytes of Litopenaeus vannamei to determine their membrane-penetrating ability. The specific experimental procedure is as follows: (1) Litopenaeus vannamei blood lymphocytes were seeded into 96-well plates, with 4 replicate wells in each group. 100 μL of L15 medium (GIBCO, catalog number: 11415064) was added to each well. (2) MFF-1, HeLa cells and shrimp blood lymphocytes were cultured in 28℃ and 37℃, 5% CO2 incubators until the cells adhered or reached the expected state. (3) MFF-1, Hela cells and shrimp blood lymphocytes were co-incubated with 4 μM green fluorescent protein (GFP) and TAT-GFP. After 6 h, the protein entry was observed under a fluorescence microscope.

[0107] The results are as follows Figure 7 As shown, TAT can carry the target protein through the cell membrane and into the cell efficiently, while the ordinary GFP control group can hardly enter the cell, proving that TAT transmembrane peptide can significantly improve the protein transmembrane efficiency.

[0108] 2. Cell safety To verify the TAT membrane-penetrating peptide, this example uses a CCK-8 cytotoxicity assay to assess its cytotoxicity, as detailed below: (1) MFF-1, HeLa, and Litopenaeus vannamei blood lymphocyte culture were performed as above; (2) 4 μM TAT (purchased from Solarbio, catalog number CLP0926) was added to the experimental group, and an equal volume of PBS solution was added to the control group. Both groups were incubated for 6 h. (3) Add 10 mL of CCK-8 solution to each well and incubate in an incubator for 1 h; (4) Use an enzyme-linked immunosorbent assay (ELISA) reader to measure the absorbance of each well at a wavelength of 450 nm.

[0109] The results are as follows Figure 8 As shown, at the effective working concentration, the TAT-PvFtz-F1L fusion protein showed no significant toxicity to HeLa cells, MFF-1 cells, and primary hematopoietic cells of Litopenaeus vannamei, with cell viability remaining above 90%, demonstrating good biosafety.

[0110] Example 4 Construction of TAT-Ftz-F1L fusion protein and engineered bacteria To address the challenge of exogenous proteins penetrating the cell membrane and intestinal barrier of Litopenaeus vannamei, this embodiment fuses the TAT membrane-penetrating peptide coding sequence (SEQ ID NO:47) with the full-length coding sequence of Ftz-F1L (nucleotide sequence shown in SEQ ID NO:1) to prepare the TAT-Ftz-F1L fusion protein. Specific experiments are as follows: 1. Prokaryotic expression and purification of TAT-Ftz-F1L fusion protein (1) The TAT-Ftz-F1L gene was cloned into the pET-32a expression vector to construct the pET-32a-TAT-Ftz-F1L prokaryotic expression vector, and then transformed into Escherichia coli BL21 (DE3) competent cells; (2) Select a single colony for colony PCR and sequencing, and identify positive clones to obtain the genetically engineered bacteria that can stably express the TAT-Ftz-F1L fusion protein. (3) Inoculate the correctly sequenced single colonies into 20 mL of LB liquid medium containing ampicillin at a ratio of 1:1000, and culture overnight with shaking at 37°C and 200 rpm; (4) The next day, the overnight culture was inoculated into 1 L of LB liquid medium containing ampicillin and cultured with shaking at 37°C and 200 rpm for about 2.5 h. When the OD of the culture was... 600 When the concentration reaches 0.6-0.8, add isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.1 mM to induce protein expression, and continue to culture overnight with shaking at 16℃ and 100 rpm. (5) After induction, collect the bacterial culture, centrifuge at 5000 g for 10 min, discard the supernatant, and resuspend the bacterial cells in 30 mL PBS. Then add PMSF at a ratio of 1:100 and use a shearing breaker to initially break down the bacterial cells. The sample was kept on ice throughout the operation. (6) Pre-cool the high-pressure homogenizer and rinse it twice with 100 Pa ultrapure water. Then add the bacterial resuspension, first break it up at a low pressure of 300-450 Pa for 2-3 min, then gradually increase the pressure to 800-900 Pa and cycle it up until the bacterial solution is clear. After the disruption is complete, collect the bacterial solution into a 50 mL centrifuge tube and place it on ice for later use; (7) Centrifuge the lysate at 14000 g for 10 min at 4℃, and collect the supernatant for subsequent protein purification. Take 1 mL of Ni-NTA His-Tag Purification Agarose column material, wash it 3 times with Wash Buffer (Village, catalog number: 759177805390), mix it with the supernatant obtained from centrifugation and bind it, and incubate it in a horizontal mixer at 4℃ for 2-4 h. After binding, discard the supernatant, add 20 mL of Wash Buffer, and incubate it in a horizontal mixer at 4℃ for 5 min for washing, repeating this process 4 times. Then add 5 mL of Elution Buffer (Jiangsu Qianzhusong Biotechnology Co., Ltd., catalog number: QS05037), incubate it in a horizontal mixer at 4℃ for 30 min, and collect the eluent; (8) The eluent was transferred to an ultrafiltration centrifuge tube for concentration. After centrifugation at 3000 g for 20 min at 4 °C, pre-cooled PBS was added and centrifugation was continued. This concentration step was repeated 5 times. Finally, the purified protein was aliquoted and stored at -80 °C for later use.

[0111] 2. SDS-PAGE electrophoresis (1) Prepare 12% SDS-PAGE separating gel and 5% SDS-PAGE stacking gel in sequence, assemble the electrophoresis apparatus, and load 15 μL of protein gel into each well; (2) Connect the power supply and run the gel at 80V constant voltage for 30 min. After the sample is flattened into a straight line, adjust the voltage to 120V and run the electrophoresis for 60 min. (3) After electrophoresis, remove the polyacrylamide gel from the vertical electrophoresis glass plate and soak it in Coomassie brilliant blue staining solution for 4-5 hours. (4) Remove the polyacrylamide gel from the Coomassie brilliant blue staining solution, wash it once with ddH2O, soak it in the Coomassie brilliant blue decolorizing solution, and after overnight decolorization, take a picture with a gel imaging system.

[0112] 3. Western blot detection (1) After separating the protein by SDS-PACE electrophoresis as described above, remove the protein gel. Cut the PVDF membrane according to the size of the protein gel, immerse the PVDF membrane in methanol for 30 s to activate it, and then transfer it to pure water for washing; (2) Arrange and clamp the electrodes in the following order: negative electrode (black) - 2 layers of filter paper - protein glue - PVDF membrane - 2 layers of filter paper - positive electrode (red); (3) Place the above structure in the transfer tank, add transfer buffer, and place it in an ice box for 200mA constant current transfer for 2h. (4) After the transfer is complete, use tweezers to remove the PVDF membrane and incubate it in WB blocking solution on a horizontal shaker at 60 rpm for 1 h. (5) Wash the membrane three times with TBST buffer, 5 min each time; (6) Add the prepared TAT antibody (Beijing Solarbio Science & Technology Co., Ltd., catalog number: K108923P) incubation solution, incubate for 2 hours, and wash the membrane 3 times with TBST for 5 minutes each time; (7) Add the prepared secondary antibody incubation solution (Beyotime Biotechnology, catalog number: A0352), incubate for 1 hour, and wash the membrane 3 times with TBST for 10 minutes each time; (8) Prepare the color development solution according to the ECL kit instructions (Beijing Solarbio Science & Technology Co., Ltd., catalog number: PE0010) and perform chemiluminescence color development on the PVDF membrane.

[0113] This embodiment combines the TAT membrane-penetrating peptide coding sequence with Ftz. The full-length coding sequence of F1L was fused to construct the pET-32a-TAT-Ftz-F1L prokaryotic expression vector. After transforming the recombinant plasmid into *E. coli* BL21 (DE3) competent cells, colony PCR and sequencing confirmed the presence of a genetically engineered bacterium stably expressing the TAT-Ftz-F1L fusion protein. Optimization of induction conditions determined the optimal expression time at OD500. 600 When the pH value reached 0.6-0.8, IPTG was added to a final concentration of 0.1 mM, and the mixture was induced at low temperature (16℃, 180 rpm) for 14-16 h to achieve efficient and soluble expression of the fusion protein. SDS-PAGE analysis showed that the target protein band size was consistent with the expected approximately 85.2 kDa. Figure 9 Western blotting using anti-His tags revealed specific bands at the corresponding locations, confirming correct expression of the TAT-Ftz-F1L fusion protein. Figure 10 ).

[0114] The nucleotide sequence of the TAT-Ftz-F1L fusion protein is shown in SEQ ID NO:49, and the amino acid sequence is shown in SEQ ID NO:50.

[0115] ATG TATGGGAGAAAGAAGAGAAGACAGAGAAGAAGA

[0116] M YGRKKRRQRRR (SEQ ID NO:50), where the underlined part is TAT.

[0117] Example 5: In vivo distribution of the TAT-Ftz-F1L fusion protein This example investigates the distribution of the TAT-Ftz-F1L fusion protein in Litopenaeus vannamei after feeding. The specific experiment is as follows: (1) Feeding experiment: After preparing the shrimp feed coated with the shrimp immune enhancer according to the feed preparation process in Example 6, the shrimp were fed at a rate of 3% of their body weight per shrimp per day, with the uncoated shrimp feed serving as a control. After 5 days of continuous feeding, 9 shrimp were randomly selected from each group, and their hemolymphocytes and intestines were collected.

[0118] (2) Immunofluorescence detection steps for shrimp intestinal tissue: 1) After dewaxing the paraffin sections of shrimp intestinal tissue after feeding, wash twice with PBS buffer, then add 500 μL of 4% paraformaldehyde and fix at room temperature for 15 min. 2) After fixation, the fixative was aspirated, and the solution was gently washed three times with PBS buffer for 5 min each time. Then, 500 μL of pre-cooled 0.1% Triton X-100 was added, and the solution was permeabilized at room temperature for 10 min. After permeabilization, the solution was gently washed three times with PBS buffer for 5 min each time. 3) Block with 10% goat serum at room temperature for 1 h; 4) After blocking, discard the blocking solution and add the primary antibody Rabbit anti His-tag mAb (ABclonal, catalog number AE086) diluted 1:1000. Incubate at room temperature for 1 h or at 4°C overnight. After incubation, discard the primary antibody and wash three times with PBS buffer. Then add the secondary antibody Goat Anti-Rabbit IgG H&L (Alexa Fluor® 488) (abcam, catalog number ab150077). Incubate at room temperature in the dark for 1 h.

[0119] 5) After secondary antibody incubation, discard the secondary antibody, gently wash three times with PBS buffer, then add Hoechst 33258 nuclear dye (Beyotime Biotechnology, catalog number C1018) and incubate at room temperature for 10 min. After nucleus staining, discard the staining solution, gently wash three more times with PBS buffer, and then add anti-fluorescence quenching mounting medium for mounting. Avoid air bubbles during mounting. After mounting, air dry and temporarily store at 4℃. Finally, observe and image using an upright fluorescence microscope (Nikon Eclipse Ni-E) and a super-resolution confocal microscope (Leica TCS SP8 STED) at excitation wavelengths of 488 and 350 nm.

[0120] The results are as follows Figure 11 As shown, the TAT-Ftz-F1L fusion protein can be effectively distributed in the intestinal mucosa of shrimp, indicating that it has good in vivo delivery capabilities.

[0121] Example 6: Preparation process of sodium alginate-coated engineered bacteria feed To adapt to aquaculture production applications, this embodiment provides a sodium alginate-Ca 2+ Preparation process of oral feed for cross-linked engineered bacteria (flow diagram shown) Figure 12The engineered bacteria fermentation broth, after induction and expression, was centrifuged to collect the bacterial cells. The wet weight of the cells was aseptically resuspended in PBS. The bacterial suspension was then thoroughly mixed with shrimp feed, followed by the addition of sodium alginate powder and stirring until homogeneous. Finally, CaCl2 solution was slowly added dropwise to allow the sodium alginate to rapidly cross-link and form a stable gel coating, immobilizing the engineered bacteria on the feed surface. This encapsulation system effectively prevents the bacterial cells from diffusing and escaping in water, improves stability and shrimp feed utilization, and simultaneously achieves slow intestinal release of protein.

[0122] The specific preparation process is as follows: (1) The fermentation broth of the engineered bacteria after induction expression (obtained from step (5) of the prokaryotic expression and purification of TAT-Ftz-F1L fusion protein in Example 4) was centrifuged at 5000×g for 10 min and the bacterial cells were collected. After weighing the bacterial cell precipitate, the precipitate was resuspended in sterile PBS buffer filtered at a ratio of 1g:1mL using 0.22 μm. (2) The bacterial suspension was thoroughly mixed with the shrimp feed (purchased from Guangdong Yuehai Holdings Group Co., Ltd.) according to the ratio of bacterial sediment mass: shrimp feed mass = 50 g : 1 kg to obtain a bacterial suspension-shrimp feed mixture. (3) Add sodium alginate powder and the bacterial suspension-shrimp feed mixture from step (2) in a ratio of sodium alginate mass: shrimp feed containing bacterial suspension = 20g : 1kg and mix thoroughly. (4) After ensuring that the sodium alginate powder is evenly mixed with the shrimp feed, slowly add 0.04 mol / L CaCl2 solution dropwise multiple times according to the ratio of CaCl2 solution volume: shrimp feed mass mixed with bacterial solution and sodium alginate = 200 mL : 1 kg, stirring constantly while adding the solution to ensure even mixing. 2+ The sodium alginate powder is fully cross-linked to form a coating on the surface of the feed, thus obtaining sodium alginate-coated engineered bacteria feed. The prepared sodium alginate-coated engineered bacteria feed is stored at 4°C for later use.

[0123] Example 7: Effects of the Anti-disease Challenge Experiment Feeding and challenge procedures: (1) Take experimental Litopenaeus vannamei shrimp of similar size, good growth status and health and randomly divide them into three groups, with a total of 40 shrimp in each group.

[0124] (2) Group 1: fed with ordinary feed; Group 2 (referred to as TAT-GFP group): fed with feed containing TAT-GFP strain (the construction process of this strain is the same as in Example 4, except that the TAT-Ftz-F1L gene is replaced with the TAT-GFP gene) (the preparation process of this feed is the same as in Example 6); Group 3 (referred to as TAT-Ftz-F1L group): fed with the sodium alginate-coated engineered bacteria feed prepared in Example 6.

[0125] (3) The feed dosage was calculated based on the body weight of Litopenaeus vannamei, and the shrimp were fed twice a day, morning and evening, at a dosage of 3% of the body weight per shrimp. After 5 days of continuous feeding, some shrimp were taken, and multiple immune effector genes in the gill tissue and hemocells of the shrimp were detected by qPCR (the detection process was the same as in Example 2). The phagocytic rate of the shrimp hemocells was detected by flow cytometry. The specific operation was as follows: Hemolymph was collected using an anticoagulant solution (25 mM citric acid, 51.2 mM sodium citrate and 81.6 mM glucose). The hemocells were washed three times with 0.9% physiological saline and resuspended at a density of 2,000 cells / μL. Subsequently, the cell suspension was incubated with FITC-labeled Vibrio parahaemolyticus at a cell-bacteria ratio of 1:100 at 28°C for 1 hour. After incubation, the samples were analyzed by flow cytometry to detect FITC fluorescence (excitation wavelength 488 nm) and forward scattering (FSC). The relative phagocytic rate of shrimp hemolymphocytes in each treatment group was planned by setting thresholds for FSC and fluorescence (FL1-A) based on individual FITC-labeled bacteria and untreated hemolymphocytes.

[0126] The remaining shrimp were prepared with WSSV and Vibrio parahaemolyticus according to the method in Example 2 and challenged with the virus.

[0127] (4) Samples were taken from the WSSV group at 3 d and 5 d after challenge, and the survival rate within 7 d was recorded; samples were taken from the Vibrio parahaemolyticus group at 6 h and 12 h, and the survival rate within 24 h was recorded. Three shrimp were selected from each group during sampling, and total DNA was extracted from gills, intestines, stomach, hemolymphocytes, and muscle. Using shrimp EF-1α as the endogenous gene, samples were analyzed using WSSV. ie1 (GenBank: AY422228) and Vibrio parahaemolyticus pirA vp (GenBank: KP324996) was the target gene, and the copy number and bacterial content of WSSV in shrimp tissues after challenge were detected by real-time quantitative PCR.

[0128] The immune effect was evaluated by continuous oral feeding for 5 days, with a daily feed amount of 3% of the shrimp's body weight, divided into two feedings, morning and evening. qPCR results showed that after feeding with the sodium alginate-coated engineered bacteria feed prepared in Example 6, multiple immune effector genes in the shrimp's gill tissue and hemocells were upregulated to varying degrees, with CTL4, ALF4, and Lys-IT2 genes showing particularly significant upregulation. This indicates that oral administration can effectively activate the NF-κB pathway and enhance the body's immune level. Figure 13 Flow cytometry analysis showed that feeding shrimp with the sodium alginate-coated engineered bacteria feed prepared in Example 6 increased the phagocytic rate of hemocytes from 9.27% ​​to 13.5%, indicating a highly significant enhancement in phagocytic activity. Figure 14 ).

[0129] The results of the disease resistance and challenge experiment showed that, under Vibrio parahaemolyticus challenge conditions, the survival rate of shrimp fed with the sodium alginate-coated engineered bacteria diet prepared in Example 6 increased from 18.2% to 41.0%, and the bacterial load in muscle tissue decreased significantly by 41.4%-45.7%. Figure 15 Under white spot syndrome virus challenge conditions, the survival rate of shrimp in the feeding group increased from 8.1% to 13.9%, and the viral load in muscle tissue decreased by 42.0% and 18.3% at 3 and 5 days post-infection, respectively. Figure 16 ).

[0130] In summary, the sodium alginate-coated engineered bacterial feed provided by this invention has the following advantages: (1) Clear target and mechanism: For the first time, Ftz-F1L is used as the target to activate the NF-κB pathway, with a solid scientific basis and stable and controllable effect. (2) Fast onset of action and strong disease resistance: 5 consecutive days of oral administration can significantly improve the immune indicators of Litopenaeus vannamei and greatly improve the survival rate after viral challenge. (3) High delivery efficiency: TAT membrane-penetrating peptide solves the problem of oral absorption, and the bioavailability is far superior to traditional products. (4) Extremely low cost and easy to scale up: Produced by fermentation of Escherichia coli, the raw materials are cheap and the process is simple, which is suitable for factory farming. (5) Green, safe and residue-free: It does not contain antibiotics or chemical drugs, and is safe for shrimp, water and humans, which is in line with the green farming policy. (6) Easy to use: It can be directly mixed with feed and fed without injection or soaking, which is suitable for high-density large-scale farming. (7) Broad-spectrum disease resistance: It enhances the ability to resist WSSV and Vibrio parahaemolyticus at the same time, and has multiple uses and high cost performance. (8) It also has growth protection: it reduces oxidative stress, enhances hemocytosis, and improves shrimp health and survival rate.

[0131] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, unless otherwise specified, the embodiments of the present invention and the features thereof can be combined with each other.

Claims

1. Application of Ftz-F1L accelerator in (1) or (2): (1) Application in the preparation of drugs for the treatment and / or prevention of pathogenic microorganism infections in aquatic animals; (2) Preparation of immune enhancers for aquatic animals; The amino acid sequence of the Ftz-F1L is shown in SEQ ID NO:

2.

2. Use according to claim 1, characterized in that, The Ftz-F1L promoter includes substances that enhance the activity of Ftz-F1L protein, substances that synthesize Ftz-F1L, or substances that enhance the expression level of Ftz-F1L; and / or, the pathogenic microorganism includes viruses and bacteria.

3. A fusion protein comprising Ftz-F1L and a cell-penetrating peptide; wherein the amino acid sequence of Ftz-F1L is shown in SEQ ID NO:2; Preferably, the cell-penetrating peptide is selected from any one of TAT, KLA-TAT, Penetratin, HIV-1Rev (34-50), P22N, DPV3, DPV6, Pep-1, Pep-7, VP22, R8, transport peptide, RV24, AIF, SynB3, and MAP. Preferably, the cell-penetrating peptide is attached to the N-terminus or C-terminus of Ftz-F1L.

4. The fusion protein of claim 3, wherein, The amino acid sequence of the fusion protein is shown in SEQ ID NO:

50.

5. A biomaterial relating to the fusion protein of claim 3 or 4, said biomaterial comprising at least one of a1)-a12): a1) A nucleic acid molecule encoding the fusion protein of claim 3 or 4; a2) An expression cassette containing the nucleic acid molecule described in a1); a3) A carrier containing the nucleic acid molecule described in a1); a4) A carrier containing the expression box described in a2); a5) Transgenic cell lines containing the nucleic acid molecules described in a1); a6) Transgenic cell lines containing the expression cassette described in a2); a7) A transgenic cell line containing the vector described in a3); a8) A transgenic cell line containing the vector described in a4); a9) Microorganisms containing the nucleic acid molecules described in a1); a10) Microorganisms containing the expression cassette described in a2); a11) Microorganisms containing the carrier described in a3); a12) Microorganisms containing the carrier described in a4); The transgenic cell line does not contain propagation material.

6. The use of the fusion protein of claim 3 or 4 or the biomaterial of claim 5 in any one of b1)-b3): b1) Use in the preparation of drugs for the treatment and / or prevention of pathogenic microbial infections in aquatic animals; b2) Preparation of immune enhancers for aquatic animals; b3) Prepare feed for aquatic animals.

7. A reagent or drug comprising the fusion protein of claim 3 or 4.

8. A feed comprising the transgenic cell line and basal diet as described in claim 5; Preferably, the feed further includes a coating material; Preferably, the coating material includes at least one of sodium alginate, chitosan, and modified starch; Preferably, the mass ratio of the transgenic cell line to the basal diet is 1:(10-30). Preferably, the mass ratio of the coating material to the basal diet is 1:(40-60).

9. A method of preparing the feed of claim 8, comprising the steps of: The feed is obtained by mixing the transgenic cell line, the basal diet, and the coating material, and then adding the cross-linking agent solution.

10. A method of aquaculture, comprising the step of treating aquatic animals with the fusion protein of claim 3 or 4, the reagent or drug of claim 7, or the feed of claim 8.

Images