A broad-spectrum inhibitory polypeptide of the receptor binding domain of fish lymphocystis disease virus

Abstract

This invention provides a receptor-binding domain polypeptide that broadly inhibits fish lymphocystis virus (LCV), belonging to the field of immunopeptide screening and application technology. The polypeptide is derived from the RACK1 receptor-binding domain of the LCDV-VAP32 adhesion protein, and its amino acid sequence is SEQ ID NO:1. The polypeptide of this invention can be used to prepare drugs that block LCDV infection, exerting its effect by inhibiting the binding of VAP32 to the RACK1 receptor. In vitro experiments show that this polypeptide has significant concentration-dependent antiviral activity. This receptor-binding domain is highly conserved across various LCDV subtypes, indicating broad-spectrum application potential. The polypeptide of this invention has a simple structure, is easy to synthesize, and can be used to develop anti-LCDV drugs and related products.

Description

Technical Field

[0001] This invention belongs to the field of immune peptide screening application technology, specifically relating to a receptor-binding domain peptide that has broad-spectrum inhibition of the viral adhesion protein (VAP32) of fish lymphocystis disease virus (LCDV). Background Technology

[0002] Lymphocystis virus (LCDV) is the pathogen that causes lymphocystitis in fish, belonging to the genus LCDV of the family Iridoviridae. This virus has a wide host range, infecting over 140 species of marine, freshwater, and brackish water fish from more than 42 families worldwide. It mainly includes four different subtypes: LCDV-1, LCDV-2 / C, LCDV-Sa, and LCDV-4. Since its introduction to my country in the 1990s, the disease has rapidly spread to major aquaculture areas, infecting many important commercially valuable aquaculture species, including rock bream, grouper, sea bass, and turbot. Infected individuals develop typical cauliflower-like cystic lesions on their body surface, eyes, and mouth. In severe cases, internal organs are affected, resulting in loss of commercial value and increased mortality due to secondary bacterial infections, causing continuous economic losses to my country's fish farming industry. Currently, there is no effective specific treatment. Some infected fish may recover spontaneously or become latently infected. These outwardly healthy carriers continue to release the virus into the environment, becoming potential sources of infection and threatening healthy fish farming.

[0003] Viral invasion of host cells begins with the specific binding of viral adhesion proteins to receptors on the surface of host cells. This binding mediates viral adsorption onto susceptible cells, which is the primary step in viral infection. The binding ability of adhesion proteins to their receptor-binding domains directly affects viral infection efficiency and pathogenicity, making them important targets for antiviral drug development. In previous research, the inventors identified an LCDV receptor protein—activated protein kinase C receptor 1 (RACK1, XP_019964456.1)—on the gill cell (FG) membrane of turbot, and also identified a 32kDa adhesion protein (VAP32, YP_073546.1) on LCDV. They confirmed that this 32kDa adhesion protein (VAP32) is encoded by the LCDV-C open reading frame (ORF) 038 gene and can mediate LCDV invasion of host cells through specific binding to the RACK1 receptor. This discovery provides a significant breakthrough for elucidating the LCDV invasion mechanism and developing related antiviral inhibitors.

[0004] Although the interaction between the LCDV-VAP32 adhesion protein and RACK1 has been clearly established to mediate viral entry into host cells, the precise location of the functional domain on this protein that binds to RACK1 and its spatial conformation remain unclear. This lack of crucial information not only hinders a deeper understanding of the molecular mechanisms of LCDV infection but also impedes the development of antiviral invasion inhibitors based on strategies that block virus-receptor interactions. If the core peptide in the VAP32 adhesion protein that specifically binds to RACK1 can be precisely located and demonstrated to block the interaction between LCDV-VAP32 and RACK1, effectively inhibiting viral infection of host cells, it would not only provide a direct target for designing novel peptide-based anti-LCDV invasion inhibitors but also open new avenues for the development of subunit vaccines and neutralizing antibodies. Summary of the Invention

[0005] The purpose of this invention is to provide a receptor-binding domain polypeptide that broadly inhibits fish lymphocystis virus (LCDV). The provided polypeptide can inhibit LCDV infection in fish, thereby contributing to the development of novel prevention and control strategies against LCDV infection.

[0006] This invention first provides a receptor-binding domain polypeptide that broadly inhibits fish lymphocystis virus, with the amino acid sequence being lysine-phenylalanine-glycine-lysine-serine-aspartic acid (SEQ ID NO: 1), and the English abbreviation being Lys-Phe-Gly-Lys-Ser-Asp (KFGKSD).

[0007] The present invention also provides a derivative polypeptide of the receptor-binding domain polypeptide, wherein the derivative polypeptide is obtained by conservative substitution, addition or deletion of one or more amino acids in the amino acid sequence of SEQ IDNO: 1, and retains the ability to bind to RACK1.

[0008] The present invention also provides the use of the receptor-binding domain peptide in the preparation of a medicament for blocking LCDV infection.

[0009] In another aspect, the present invention provides an article for inhibiting fish lymphocystis virus infection, comprising a pharmacologically effective concentration of the above-mentioned polypeptide; Furthermore, the concentration is 5-40 μg / mL.

[0010] This invention identified the smallest core functional domain (SEQ ID NO: 1, KFGKSD) on the LCDV-VAP32 adhesion protein that specifically binds to RACK1. A rigorous screening method was employed, including systematic truncation mutation, immunoprecipitation, bimolecular fluorescence complementarity, immunofluorescence co-localization, and AlphaFold structural modeling, to cross-validate the results. In vitro experiments demonstrated that the synthetically produced KFGKSD peptide significantly inhibited LCDV infection of FG cells in a concentration-dependent manner, achieving maximum viral copy number inhibition at a concentration of 40 μg / mL. AlphaFold structural modeling further revealed the hydrogen bond interaction mechanism between lysine (K110), lysine (K113), serine (S114), and aspartic acid (D115) and lysine (K60), histidine (H64), serine (S15), and arginine (R36) of RACK1, elucidating the spatial location and mode of action of the binding domain at the structural level. Evolutionary conservation analysis showed that the binding domain sequence is completely conserved across different LCDV subtypes (LCDV-1, LCDV-2 / C, LCDV-Sa, LCDV-4), suggesting it could serve as a potential target for the development of broad-spectrum anti-LCDV peptide drugs targeting various subtypes. The peptide sequence provided by this invention is short and easy to synthesize, offering a direct core sequence and theoretical basis for the development of novel anti-LCDV peptide drugs, neutralizing antibodies, and subunit vaccines, and is of significant value for the green control of fish lymphocytic cysts. Attached Figure Description

[0011] Figure 1 Image showing the results of the first screening of the LCDV VAP32-RACK1 receptor binding domain.

[0012] In the figure: A shows the detection results of the binding of the LCDV VAP32 protein L1-1 truncated variant (1-122aa) to the receptor protein RACK1; B shows the detection results of the binding of the LCDV VAP32 protein L1-2 truncated variant (61-178aa) to the receptor protein RACK1; C shows the detection results of the binding of the LCDV VAP32 protein L1-3 truncated variant (123-240aa) to the receptor protein RACK1; D shows the detection results of the binding of the LCDV VAP32 protein L1-4 truncated variant (180-310aa) to the receptor protein RACK1; E shows the series of truncated variants of LCDV VAP32 protein L1-1 (VAP32 1-122aa), L1-2 (VAP32 61-178aa), L1-3 (VAP32 123-240aa), L1-4 ...1-122aa), L1-3 (VAP32 1-122aa), L1-4 (VAP32 1-122aa), L1-2 (VAP32 1-122aa), L1-3 (VAP32 1-122aa), L1-4 (VAP32 1-122aa), L1-2 (VAP32 1-122aa), L1-3 (VAP32 1-122aa), L1-4 (VAP32 1-122aa), L1-2 (VAP32 1-122aa Schematic diagram of 180-310aa); 3HA-RACK1 in the figure is pcDNA3.1-3HA plasmid with RACK1 receptor; 3Flag-L1-1 is pcDNA3.4-3Flag plasmid with L1-1 truncated form; HA and Flag are the names of tag proteins, and aa is amino acid.

[0013] Figure 2 Figure: Results of the second screening of the LCDV VAP32-RACK1 receptor binding domain.

[0014] In the figure: A shows the detection results of the binding of the LCDV VAP32 protein R-L2-1 truncated variant (126-310aa) to the receptor protein RACK1; B shows the detection results of the binding of the LCDV VAP32 protein R-L2-2 truncated variant (110-310aa) to the receptor protein RACK1; C shows the detection results of the binding of the LCDV VAP32 protein R-L2-3 truncated variant (94-310aa) to the receptor protein RACK1; D is a schematic diagram of the composition of the series of truncated variants of LCDV VAP32 protein R-L2-1 (VAP32 126-310aa), R-L2-2 (VAP32 110-310aa), and R-L2-3 (VAP32 94-310aa).

[0015] Figure 3 Figure: Results of the third screening of the LCDV VAP32-RACK1 receptor binding domain.

[0016] In the figure: A shows the detection results of the binding of the LCDV VAP32 protein truncated variant 110-111 (R-L3-1) to the receptor protein RACK1; B shows the detection results of the binding of the LCDV VAP32 protein truncated variant 112-113 (R-L3-2) to the receptor protein RACK1; C shows the detection results of the binding of the LCDV VAP32 protein truncated variant 114-115 (R-L3-3) to the receptor protein RACK1; D shows the detection results of the binding of the LCDV VAP32 protein truncated variant 116-117 (R-L3-4) to the receptor protein RACK1; E shows the detection results of the binding of the LCDV VAP32 protein truncated variant 118-119 (R-L3-5) to the receptor protein RACK1; F shows the series of amino acid deletion truncated variants of LCDV VAP32 protein R-L3-1 (R-L2-2) A schematic diagram showing the composition of Δ110-111aa), R-L3-2 (R-L2-2 Δ112-113aa), R-L3-3 (R-L2-2 Δ114-115aa), R-L3-4 (R-L2-2 Δ116-117aa), and R-L3-5 (R-L2-2 Δ118-119aa); "Δ" represents the specific location of the missing amino acid.

[0017] Figure 4 Figure: Validation results of the interaction between the complete VAP32 variant and the 110-115aa deletion mutant and the RACK1 receptor.

[0018] In the figure: A shows the co-immunoprecipitation (Co-IP) verification results of the interaction between the VAP32 110-115aa deletion mutant and the RACK1 receptor; B shows the Co-IP verification results of the interaction between the complete VAP32 and the RACK1 receptor; C shows the BIFC verification results of the interaction between the complete VAP32 and the 110-115aa deletion mutant and the RACK1 receptor; VC155-VAP32 is the pBiFC-VC155 plasmid containing VAP32 adhesion protein; VN173-RACK1 is the pBiFC-VN173 plasmid containing the RACK1 receptor; VC155 and VN173 are fluorescent active molecular fragments.

[0019] Figure 5 Immunofluorescence image of co-localization of FITC-KFGKSD peptide with RACK1 receptor.

[0020] Figure 1 shows: A) Immunofluorescence image of co-localization of AFITC-KFGKSD peptide and RACK1 receptor; B) Co-localization coefficient diagram of FITC-KFGKSD peptide and RACK1 receptor; C) Bar chart of Pearson coefficient and overlap coefficient of co-localization of FITC-KFGKSD peptide and RACK1 receptor; KFGKSD in the figure is the receptor-binding domain peptide provided in this patent: lysine-phenylalanine-glycine-lysine-serine-aspartic acid, abbreviated as Lys-Phe-Gly-Lys-Ser-Asp (KFGKSD).

[0021] Figure 6 : Analysis diagram of the three-dimensional structure model of VAP32 protein based on AlphaFold prediction.

[0022] In the figure: A is a three-dimensional structural model of the VAP32 protein; B is the amino acid sequence of the VAP32 protein, where the green area is the β-sheet, the yellow area is the α-helix, and the red box area is the binding domain in VAP32 that interacts with the receptor protein RACK1; C is a schematic diagram of the relative positions of the KFGKSD peptide in the VAP32 protein and the ball-and-stick model, cartoon model, and stick model.

[0023] Figure 7 : Analysis diagram of VAP32-RACK1 interaction model based on AlphaFold prediction.

[0024] In the figure: A is the overall surface model and cartoon model of the VAP32-RACK1 interaction; B is the intermolecular interaction model of VAP32 and RACK1; C is the labeling diagram of key amino acids in the VAP32-RACK1 interaction; D is the hydrogen bond connection model of VAP32 phenylalanine (PHE) at position 6, lysine (LYS) at position 110, and RACK1 lysine (LYS) at position 60; E is the hydrogen bond connection model of VAP32 lysine (LYS) at position 113, serine (SER) at position 114, and aspartic acid (ASP) at position 115, and RACK1 histidine (HIS) at position 64, serine (SER) at position 15, and arginine (ARG) at position 36; F is the hydrogen bond connection model of VAP32 asparagine (ASN) at position 160 and RACK1 glutamic acid (GLU) at position 282. G represents the hydrogen bond connection model between lysine (LYS) at position 163 of VAP32 and lysine (LYS) at position 280 of RACK1.

[0025] Figure 8 Statistical graph of the inhibitory effect of different concentrations of KFGKSD peptide on LCDV-infected FG cells (Quantitative Real-time PCR, qPCR).

[0026] Figure 9Statistical graph of the inhibitory effect of different concentrations of KFGKSD peptide on LCDV-VAP32 protein expression (Western Blot).

[0027] In the figure: A is a Western blotting diagram showing the inhibitory effect of different concentrations of KFGKSD peptide on LCDV-VAP32 protein expression; B is a semi-quantitative analysis diagram of the Western blotting diagram in A.

[0028] Figure 10 : Evolutionary conservation analysis diagram of the domain KFGKSD in different subtypes of LCDV.

[0029] In the figure: A is a comparative analysis of the amino acid sequences of KFGKSD peptides in different LCDV subtypes; B is a logo diagram of the conserved amino acid analysis of KFGKSD peptides in different LCDV subtypes; C is a diagram of the conservation of each amino acid in KFGKSD peptides in different LCDV subtypes. Detailed Implementation

[0030] This invention targets the key mechanism by which lymphocystis virus (LCDV) invades host cells, identifies the precise binding domain of its VAP32 adhesion protein that interacts with the host cell receptor RACK1, and verifies its potential as an antiviral neutralizing target.

[0031] The binding domain peptide is the 110th-115th amino acid residues of LCDV-VAP32, exposed on the surface of the three-dimensional structure of the VAP32 protein. The lysine at position 110, the phenylalanine at position 111, and the aspartic acid at position 115 are located at the ends of the 4th and 5th helices of the VAP32 protein. This structural feature is conducive to RACK1 binding.

[0032] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.

[0033] Example 1: Identification of key binding domains for the interaction between LCDV-VAP32 and receptor RACK1 1. Construction of LCDV-VAP32 mutant and RACK1 receptor eukaryotic plasmid Based on the ORF038 sequence of LCDV-C (GenBank accession number YP_073546.1) and the RACK1 receptor sequence (GenBank accession number XM_020108897.1), specific primers carrying homologous arms were designed using Primer 6.0 and SnapGene 4.3.7 software (Table 1), and were synthesized by a biotechnology company.

[0034] The following fragments were amplified by PCR: First round of screening: L1-1 (VAP32 1-122aa), L1-2 (VAP32 61-178aa), L1-3 (VAP32 123-240aa), L1-4 (VAP32 180-310aa) Second round of screening: R-L2-1 (VAP32 126-310aa), R-L2-2 (VAP32 110-310aa), R-L2-3 (VAP32 94-310aa) The third round of screening: R-L3-1 (R-L2-2 Δ110-111aa), R-L3-2 (R-L2-2 Δ112-113aa), R-L3-3 (R-L2-2 Δ114-115aa), R-L3-4 (R-L2-2 Δ116-117aa), R-L3-5 (R-L2-2 Δ118-119aa), where "Δ" indicates missing.

[0035] Validation: LCDV VAP32 (Δ110-115aa) and LCDV-VAP32 full-length gene fragments.

[0036] After amplification, the amplified products were subjected to agarose gel electrophoresis, gel extraction, and purification. They were then cloned into the corresponding pcDNA3.4-3Flag-C and pBiFCVN155 vectors using a homologous recombination kit. The full-length turbot RACK1 gene fragment was amplified as described above and cloned into the corresponding pcDNA3.1-3HA-N and pBiFCVC173 vectors.

[0037] The recombinant plasmid was transformed into Escherichia coli DH5α, plated on LB agar plates containing the appropriate antibiotics, and incubated overnight at 37°C inverted. Colonies were picked for sequencing verification. Positive bacteria with correct sequencing were expanded and cultured. Plasmids were extracted using an endotoxin-free plasmid extraction kit, and their purity and concentration were determined. After aliquoting, the plasmids were stored at -80°C for later use.

[0038] Table 1: Primer Details Table pcDNA3.4-3Flag-L1-1-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGTCTGTCATAGGATTTACTCTAC]]> pcDNA3.4-3Flag-L1-1-R <![CDATA[ TGCTGGATATCTGCAGAATTC ACAATAATTTTCAGCTACAACATC]]> pcDNA3.4-3Flag-L1-2-F <![CDATA[ TAGTCCAGTGTGGTGGAATTCATG ATTTCTAAAAAAGATTGTAATATAG]]> pcDNA3.4-3Flag-L1-2-R <![CDATA[ TGCTGGATATCTGCAGAATTC ATTCACTCTATTAATACATTTACA]]> pcDNA3.4-3Flag-L1-3-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGCAACCGAGTAAAAATAAT]]> pcDNA3.4-3Flag-L1-3-R <![CDATA[ TGCTGGATATCTGCAGAATTC CGATACATCTTTAATAGACACATC]]> pcDNA3.4-3Flag-L1-4-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGCCCCTTTATCAAAAAATAAA]]> pcDNA3.4-3Flag-LⅠ-4-R <![CDATA[ TGCTGGATATCTGCAGAATTC AAAAGTCAAATAAAATATTAAATC<!-- 4 --> ]]> pcDNA3.4-3Flag-R-L2-1-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGAGTAAAAATAATCTAGCACGTGCAT]]> pcDNA3.4-3Flag-R-L2-2-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGAAATTTGGTAAGTCAGATGTTGTAG]]> pcDNA3.4-3Flag-R-L2-3-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGGATTTAAATAAATTAGATACCTCAA]]> pcDNA3.4-3Flag-R-L2-1 / 2 / 3-R <![CDATA[ TGCTGGATATCTGCAGAATTC AAAAGTCAAATAAAATATTAAATC]]> pcDNA3.4-3Flag-R-L3-1-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGGGTAAGTCAGATGTTGTAGCTG]]> pcDNA3.4-3Flag-R-L3-2-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGAAATTTTCAGATGTTGTAGCTGAAAAT]]> pcDNA3.4-3Flag-R-L3-3-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGAAATTTGGTAAGGTTGTAGCTGAAAATTATTGTATG]]> pcDNA3.4-3Flag-R-L3-4-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGAAATTTGGTAAGTCAGATGCTGAAAATTATTGTATGCAA]]> pcDNA3.4-3Flag-R-L3-5-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGAAATTTGGTAAGTCAGATGTTGTAAATTATTGTATGCAACCGAG]]> pcDNA3.4-3Flag-R-L3-1 / 2 / 3 / 4 / 5-R <![CDATA[ TGCTGGATATCTGCAGAATTC AAAAGTCAAATAAAATATTAAATC]]> pcDNA3.4-3Flag-VAP32Δ110-115-F1 <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGTCTGTCATAGGATTTACTCTAC]]> pcDNA3.4-3Flag-VAP32Δ110-115-R1 ATTTTCAGCTACAACATCAAAGTAATTCATAACTTGATTT pcDNA3.4-3Flag-VAP32Δ110-115-F2 It should be noted that there may be some inaccuracies in the above translation due to the complexity and potential ambiguity of the original text. It is recommended to double-check with relevant experts or in the context of the specific patent content for more accurate understanding. ATGAATTACTTTGATGTTGTAGCTGAAAATTATTGTATGC pcDNA3.4-3Flag-VAP32Δ110-115-R2 <![CDATA[ TGCTGGATATCTGCAGAATTC AAAAGTCAAATAAAATATTAAATC]]> pcDNA3.4-3Flag-VAP32-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGTCTGTCATAGGATTTACTCTAC]]> pcDNA3.4-3Flag-VAP32-R <![CDATA[ TGCTGGATATCTGCAGAATTC AAAAGTCAAATAAAATATTAAATC]]> pBiFC-VC155-VAP32Δ110-115-F1 <![CDATA[ CCGAGATCTCTCGAGGTACC ATGTCTGTCATAGGATTTACTCTAC]]> pBiFC-VC155-VAP32Δ110-115-R1 ATTTTCAGCTACAACATCAAAGTAATTCATAACTTGATTT pBiFC-VC155-VAP32Δ110-115-F2 ATGAATTACTTTGATGTTGTAGCTGAAAATTATTGTATGC pBiFC-VC155-VAP32Δ110-115-R2 <![CDATA[ TTGCACGCCGGACGGGTACC AAAAGTCAAATAAAATATTAAATC]]> pBiFC-VC155-VAP32-F <![CDATA[ CCGAGATCTCTCGAGGTACC ATGTCTGTCATAGGATTTACTCTAC]]> pBiFC-VC155-VAP32-R <![CDATA[ TTGCACGCCGGACGGGTACC AAAAGTCAAATAAAATATTAAATC]]> pcDNA3.1-3HA-RACK1-F <![CDATA[ GGATCCACTAGTCCAGTGTGGTGGAATTCT ATGACCGAGCAGATGACAGTGAG]]> pcDNA3.1-3HA-RACK1-R <![CDATA[ GCCACTGTGCTGGATATCTGCAGAATTCCA TTATCGAGTTCCAATTGTGACTTGC]]> pBiFC-VN173-RACK1-F <![CDATA[ AAGACGATGACGACAAGCTT ATGACCGAGCAGATGACAGTGAG]]> pBiFC-VN173-RACK1-R <![CDATA[ GAATTCGCGGCCGCAAGCTT TCGAGTTCCAATTGTGACTTGC]]> Note: Homologous arms in primers are used underline Mark it.

[0039] 2. Identification of LCDV-VAP32 binding domain to receptor RACK1 via co-immunoprecipitation (Co-IP) ① HEK293T cells were seeded in 6 cm culture dishes. When the cell confluence reached approximately 60%, the following cell types were co-transfected: pcDNA3.4-3Flag-L1-1 / 2 / 3 / 4 + pcDNA3.1-3HA-RACK1, pcDNA3.4-3Flag-L1-1 / 2 / 3 / 4 + pcDNA3.1-3HA-C, pcDNA3.4-3Flag-C + pcDNA3.1-3HA-RACK1, pcDNA3.4-3Flag-R-L2-1 / 2 / 3 + pcDNA3.1-3HA-RACK1, pcDNA3.4-3Flag-R-L2-1 / 2 / 3 + pcDNA3.1-3HA-C, and pcDNA3.4-3Flag-R-L3-1 / 2 / 3 / 4 / 5 + pcDNA3.1-3HA-RACK1. The plasmid combinations were: pcDNA3.4-3Flag-R-L3-1 / 2 / 3 / 4 / 5 + pcDNA3.1-3HA-C, pcDNA3.4-3Flag-VAP32Δ110-115 + pcDNA3.1-3HA-RACK1, pcDNA3.4-3Flag-VAP32Δ110-115 + pcDNA3.1-3HA-C, pcDNA3.4-3Flag-VAP32 + pcDNA3.1-3HA-RACK1, and pcDNA3.4-3Flag-VAP32 + pcDNA3.1-3HA-C, with each plasmid used in a dose of 2500 ng.

[0040] ② 24 h after transfection, remove the culture medium, wash the cells twice with pre-cooled PBS, scrape the cells off with a cell scraper, collect them into a pre-cooled 1.5 mL EP tube, and collect the cell pellet by low-speed centrifugation.

[0041] ③ Add 400 μL of NP-40 lysis buffer containing 1 mM P benzyl sulfonyl fluoride (PMSF), repeatedly blow and then place on a rotary apparatus at 4 °C for lysis for 30 minutes.

[0042] ④ 14000 × g Centrifuge for 20 minutes to collect the supernatant, add 40 μL of 2×SDS loading buffer (final concentration 1×) and denature at 100 °C for 10 minutes as the input sample. Add 10 μL of pretreated Anti-Flag magnetic beads to the remaining supernatant and incubate at 4 °C for 2 h on a rotary instrument.

[0043] ⑤ After washing the magnetic beads 6 times with pre-cooled NP-40 lysis buffer, add 80 μL of 1×SDS loading buffer and denature at 100 °C for 10 minutes to obtain the IP sample.

[0044] ⑥ Western blot was performed on the whole cell protein lysis buffer (Input) sample and the immunoprecipitation (IP) sample using Flag rabbit monoclonal antibody and HA rabbit monoclonal antibody as the primary antibodies.

[0045] Results: The first round of screening showed an interaction between RACK1 and VAP32 1-178aa ( Figure 1 The second round of screening results showed that RACK1 interacts with 94-310aa and 110-310aa of VAP32, but not with 126-310aa, indicating that the binding domain is located between 110-126aa. Figure 2 The third round of screening involved constructing mutants with deletions of every two amino acids starting from 110aa. The results showed that when 110-115aa (KFGKSD) was deleted, the interaction between RACK1 and VAP32 completely disappeared, while the interaction still existed when 116-117aa and 118-119aa were deleted, indicating that the binding domain is 110-115aa. Figure 3 ).

[0046] To verify the accuracy of the screening results, Flag tag plasmids for VAP32 wild-type and 110-115aa deletion variants were constructed and subjected to immunoprecipitation experiments with HA-RACK1. The results showed that RACK1 interacted with the wild-type variant but not with the deletion variant, confirming that the interaction domain between VAP32 and RACK1 is... 110 KFGKSD 115 ( Figure 4 ).

[0047] 3. Verification of bimolecular fluorescence complementation (BiFC) between LCDV-VAP32 and the receptor RACK1 binding domain ① HEK293T cells were seeded into 24-well cell culture plates with sterile coverslips. When the cell confluence reached about 40%, the cells were co-transfected with the following plasmid combinations: pBiFC-VC155-VAP32Δ110-115 + pBiFC-VN173-RACK1, pBiFC-VC155-VAP32 + pBiFC-VN173-RACK1, and pBiFC-VC155-VAP32 + pBiFC-VN173-C. The amount of each plasmid used was 2500 ng.

[0048] ② 24 h after transfection, remove the culture medium, wash 3 times with PBS, add 4% paraformaldehyde to fix at room temperature for 15 minutes, and wash 3 times with PBS.

[0049] ③ Add Hoechst 33342 and incubate at room temperature for 15 minutes, then wash 3 times with PBS.

[0050] ④ Seal sterile coverslips onto a glass slide with an anti-fluorescence quenching attenuator, and observe and photograph them under a laser confocal microscope.

[0051] To verify the screening results, VC155 eukaryotic plasmids of wild-type VAP32 and 110-115aa deletion variants were constructed, and bimolecular fluorescence complementation experiments were performed with the VN173 eukaryotic plasmid of RACK1. The results showed positive yellow fluorescence between RACK1 and the wild-type plasmid, but no positive fluorescence between RACK1 and the deletion variant. These results further verified that the interaction binding domain between VAP32 and RACK1 is... 110 KFGKSD 115 ( Figure 4 ).

[0052] Example 2: In vitro binding verification and localization analysis of the KFGKSD domain ① The synthesized KFGKSD peptide (1 mg / mL) was mixed with an equal concentration of fluorescein isothiocyanate (FITC) solution and placed on a rotary mixer for incubation overnight at 4 ℃ in the dark.

[0053] ② Inject the mixture into a HisTrap HP chromatography column and equilibrate with Binding buffer to remove free FITC.

[0054] ③ After eluting FITC-KFGKSD with Elution buffer, dialyze in PBS at 4 °C for 24 h, changing the dialysate every 4-6 h. Finally, adjust the FITC-KFGKSD concentration to 1 mg / mL with PBS containing 1% BSA.

[0055] ④ FG cells were seeded in 24-well cell culture plates containing sterile coverslips. When the cell confluence reached 40-60%, the cells were washed three times with PBS.

[0056] ⑤ Add 200 μL FITC-KFGKSD, incubate at 4 ℃ in the dark for 1 h, then wash 3 times with PBS. Add 4% paraformaldehyde, fix at room temperature for 15 minutes, remove the paraformaldehyde, and wash 3 times with PBS.

[0057] ⑥ Add immunostaining blocking solution containing 0.3% Triton X-100, block and permeate at room temperature for 1 h. Discard the blocking solution, add RACK1 rabbit polyclonal antibody (1:500 dilution), and incubate at room temperature for 1 h.

[0058] ⑦ Remove excess antibody, wash 3 times with PBS, add Alexa Fluor 649-labeled goat anti-rabbit IgG diluted 1:1000, and incubate at room temperature for 1 h.

[0059] ⑧ Discard excess antibody, soak in PBS 3 times, add Hoechst 33342 (1:1000 dilution), and incubate at room temperature for 15 minutes.

[0060] ⑨ Discard Hoechst 33342, soak in PBS 3 times, carefully remove sterile coverslips from the well plate and seal them onto a glass slide with an anti-fluorescence quenching attenuator. Observe and photograph with a laser confocal microscope, and analyze the co-localization using ImageJ software.

[0061] The results showed that a large amount of FITC-KFGKSD green fluorescence signal appeared on the cell membrane and in the cytoplasm of real FG cells, accompanied by a widely distributed red RACK1 signal. After superposition, a large amount of yellow colocalization signal appeared on the cell membrane and in the cytoplasm. Figure 5 ImageJ software analysis showed that the Pearson correlation coefficient between KFGKSD and RACK1 co-localization was > 0.6, proving the direct binding of KFGKSD and RACK1. Figure 5 ).

[0062] Example 3: Analysis of the structural characteristics of the combined domain KFGKSD and its interaction mode with RACK1 Based on the LCDV-VAP32 sequence (YP_073546.1) and the receptor RACK1 sequence (XP_019964456.1), three-dimensional models of the protein monomer and complex were constructed using the online server AlphaFold (https: / / alphafoldserver.com / ). The structural features of the binding domain and the VAP32-RACK1 interaction interface were visualized and analyzed using UCSF ChimeraX software.

[0063] For the first time, an LCDV-VAP32 protein model was constructed using the artificial intelligence AlphaFold. It consists of 5 folds, 17 helices, and a disordered region; binding domain... 110 KFGKSD 115 The surface of the VAP32 protein's three-dimensional structure is exposed, with lysine at position 110, phenylalanine at position 111, and aspartic acid at position 115 located at the ends of the 4th and 5th helices of the VAP32 protein. This structural feature facilitates receptor binding. Figure 6 ).

[0064] A VAP32-RACK1 interaction model was constructed using AlphaFold. The results showed that the main interaction mode was RACK1 partially enclosing the micro-indentation on the side of LCDV-VAP32. Analysis of the interaction interface revealed that 110-115aa all participated in the interaction, consistent with the results of the selected interaction domains. Among them, lysine (Lys) 110, lysine (Lys) 113, serine (Ser) 114, and aspartic acid (Asp) 115 of VAP32 formed hydrogen bonds with lysine (Lys) 60, histidine (His) 64, serine (Ser) 15, and arginine (Arg) 36 of RACK1, respectively. Figure 7 The interaction mechanism between the two was explained from a structural perspective.

[0065] Example 4: Evaluation of the antiviral potential and neutralization application of peptide KFGKSD ① FG cells were seeded in 6-well culture plates and cultured. When the cell confluence reached more than 80%, the culture medium was discarded and the cells were washed three times with PBS.

[0066] ② Add the synthetic peptide KFGKSD to the MEM maintenance medium to make the final concentrations 5, 10, 20, 40, 80, and 160 μg / mL. Use MEM maintenance medium without synthetic peptide as a blank control. Incubate at 4 ℃ for 1 h and wash three times with PBS.

[0067] ③ Add LCDV with a multiplicity of infection (MOI) of 1, use serum-free MEM medium as a blank control, incubate at 22 ℃ for 1 h, wash 3 times with PBS, and then add freshly prepared MEM maintenance medium.

[0068] ④ 48 h after infection, a portion of cells from each treatment group were washed once with PBS. After being scraped off with a cell scraper, the cells were divided into two aliquots. DNA was extracted from one aliquot using a marine animal tissue genomic DNA extraction kit, and the LCDV copy number was detected by qPCR. The other aliquot was resuspended in 100 μL of NP-40 lysis buffer for the preparation of total cell protein, and the relative expression level of LCDV VAP32 was detected by Western blot.

[0069] The results showed that the copy number of LCDV decreased significantly with increasing peptide concentration, with no significant difference among the 40, 80, and 160 μg / mL treatment groups. Figure 8 As peptide concentration increased, LCDV-VAP32 protein levels decreased significantly, with no significant differences between the 40 and 160 μg / mL treatment groups and between the 80 and 160 μg / mL treatment groups. Figure 9The above results indicate that the peptide KFGKSD can significantly inhibit LCDV infection in a concentration-dependent manner, achieving the maximum inhibitory effect at 40 μg / mL, suggesting its promising application in the prevention and treatment of LCDV.

[0070] Example 5: Evolutionary conservation analysis of the domain KFGKSD in different LCDV subtypes VAP32 homologous protein sequences of different LCDV isoforms were downloaded from the NCBI database, including LCDV-1 (NP_078745.1), LCDV-2 (BCB67432.1), LCDV-C (YP_073546.1), LCDV-Sa (YP_009342142.1), and LCDV-4 (YP_010087899.1). A phylogenetic tree was constructed from 1000 guided replicates using the neighbor-joining method in MEGA.X software. The tree was then uploaded to the iTOL online server (https: / / itol.embl.de / ) for editing and enhancement. Multiple sequence alignment of the VAP32 homologous protein amino acid sequences was performed using Jalview software, and the sequence surrounding the KFGKSD binding domain was extracted and placed at the end of the corresponding phylogenetic branch. A logo diagram of amino acid frequencies of different subtypes of LCDV KFGKSD binding domains generated using the WebLogo 3 online server (http: / / weblogo.threeplusone.com / ).

[0071] The results show the binding domain 110 KFGKSD 115 Completely conserved across all LCDV subtypes, with 100% sequence consistency. Figure 10 This indicates its potential application as a broad-spectrum anti-LCDV subtype peptide drug.

[0072] Those skilled in the art will understand that modifications, additions, and substitutions to the above embodiments are possible within the scope of protection of this invention, and none of them exceed the scope of protection claimed by this invention.

Claims

1. A receptor-binding domain polypeptide that broadly inhibits fish lymphocystis virus, characterized in that, The amino acid sequence of the polypeptide is SEQ ID NO:

1.

2. The derivative of the receptor-binding domain polypeptide according to claim 1, characterized in that, The derivative is a polypeptide obtained by conservative substitution, addition or deletion of one or more amino acids in the amino acid sequence of the polypeptide with the amino acid sequence SEQ ID NO:

1.

3. The use of the receptor-binding domain peptide of claim 1 in the preparation of a medicament for blocking LCDV infection.

4. Use of the derivative of claim 2 in the preparation of a medicament for blocking LCDV infection.

5. A product for inhibiting fish lymphocystis virus infection, characterized in that, The product contains a pharmacologically effective concentration of the receptor-binding domain polypeptide of claim 1.

6. The article of claim 5, characterized in that, In the product, the concentration of the receptor-binding domain polypeptide with the amino acid sequence SEQ ID NO: 1 is 5-40 μg / mL.

7. The article of claim 5, characterized in that, The product also contains a derivative of a receptor-binding domain polypeptide with the amino acid sequence SEQ ID NO: 1.

Images