OsWCR10, a gene regulating rice starch synthesis, and its application.

Abstract

This invention discloses a starch synthesis regulatory gene, OsWCR10, its encoded protein, and its applications. The gene has the nucleotide sequence shown in SEQ ID NO: 2 and SEQ ID NO: 3, and encodes a protein as follows (a) or (b): (a) a protein composed of the amino acid sequence shown in SEQ ID NO: 1; (b) a protein derived from SEQ ID NO: 1 by substitution and / or deletion and / or addition of one or more amino acid residues, and related to the regulation of plant starch synthesis. This invention investigated the function and mechanism of the OsWCR10 gene in starch synthesis, finding that loss of function of the OsWCR10 gene leads to chalky grains, altered grain shape, decreased thousand-grain weight, increased amylose content, changes in amylopectin structure, and decreased rice eating quality, providing important theoretical value for improving rice quality.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a gene OsWCR10 that regulates rice starch synthesis and its applications. Background Technology

[0002] Rice is the staple food for more than half of the world's population. Starch is the largest storage substance in rice seeds, accounting for over 70% of the seed weight. The starch content and structure directly determine yield and eating quality. Therefore, research on the regulation of starch synthesis can help improve rice using genetic engineering techniques.

[0003] Starch is composed of amylose and amylopectin, synthesized by the synergistic catalysis of granule-bound starch synthase (GBSS), soluble starch synthase (SSS), starch branching enzyme (SBE), and debranching enzyme (DBE), respectively. The key gene for amylose synthesis is the Waxy gene, encoding GBSSⅠ. Differences in its expression level directly lead to variations in the amylose content of indica and japonica rice, thus affecting the stickiness and firmness of cooked rice. Amylopectin synthesis is catalyzed by enzymes such as SSⅠ, SSⅡa, SSⅢa, SBEⅠ, SBEⅡb, and ISA1. Mutations in any of these enzyme genes can result in endosperm exhibiting phenotypes such as powdery, glutinous, or wrinkled textures. For example, the ssIIIa mutation causes loosely arranged starch granules in rice, resulting in a powdery and opaque center in the endosperm. Mutations in ISA1 lead to glycogen accumulation in the endosperm, severely inhibiting starch synthesis and causing the grains to wrinkle and become translucent.

[0004] In addition, some transcription factors involved in starch metabolism (such as OsbZIP58, OsDof6, and OsLBD) and genes related to sugar metabolism (such as AGPlar and PHO1) also affect starch accumulation through feedback or feedforward regulation. For example, mutations in the transcription factor OsbZIP58 gene lead to chalky white seeds, decreased starch and amylose content, and altered amylopectin chain length. Therefore, discovering and cloning starch synthesis-related genes is of great significance for the targeted improvement of rice quality using molecular breeding methods. Summary of the Invention

[0005] The purpose of this invention is to provide a gene related to regulating rice starch synthesis, OsWCR10, and its encoded amino acid sequence, and to provide the application of this gene in regulating rice starch synthesis. By knocking out the OsWCR10 gene using CRISPR / Cas9 gene editing technology, mutant materials with chalky rice grains can be obtained, providing a new target gene for rice quality breeding.

[0006] The present invention provides the application of the OsWCR10 gene in regulating rice starch synthesis based on: having an amino acid sequence as shown in SEQ ID NO:1 in the sequence listing; or a protein derived from SEQ ID NO:1 by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence of SEQ ID NO:1 that is related to the regulation of starch synthesis; or having a CDS sequence as shown in SEQ ID NO:2; or having a DNA sequence as shown in SEQ ID NO:3; or a polynucleotide derived from a sequence having more than 90% homology with the DNA sequences of SEQ ID NO:2 and SEQ ID NO:3, encoding the same nucleotide sequence, and still having the function of regulating rice starch synthesis.

[0007] Specifically, this application involves targeted knockout of the OsWCR10 gene in rice (Zhonghua 11) to affect starch synthesis and cause chalky grains. The targeted knockout of the OsWCR10 gene in rice (Zhonghua 11) is achieved by targeting and knocking out the sgRNA of exon 1 of OsWCR10 using CRISPR / Cas9 technology. The target sequence is shown in SEQ ID NO:4.

[0008] Knocking out the OsWCR10 gene using the CRISPR / Cas9 gene editing technology described above yields a mutant with chalky grains. The altered expression of the OsWCR10 gene results in smaller and more irregular starch granules in the rice grains, a significant increase in amylose content, changes in amylopectin chain length distribution, altered grain shape, decreased thousand-grain weight, reduced cooked rice quality, and a chalky phenotype in the grains. These findings indicate that OsWCR10 is involved in regulating rice grain shape and quality traits. This invention provides a new genetic resource for improving rice quality. Attached Figure Description

[0009] Figure 1 The tissue expression pattern of the OsWCR10 gene;

[0010] Figure 2 Phylogenetic analysis of the OsWCR10 gene;

[0011] Figure 3 Validation of the OsWCR10 rice mutant;

[0012] Figure 4 Analysis of grain traits of the OsWCR10 mutant (A: grain thickness, B: grain width, C: grain length, D: grain length-to-width ratio, E: thousand-grain weight, F: chalkiness, G: chalky grain rate, H: amylose content).

[0013] Figure 5morphological analysis of starch granules from the OsWCR10 mutant (A: red box shows grain phenotype and cross section; B: blue box shows SEM analysis; C: yellow box shows TEM analysis).

[0014] Figure 6 Analysis of the expression levels of starch synthesis-related genes in the OsWCR10 mutant and wild-type (ZH11);

[0015] Figure 7 Analysis of amylopectin chain length in the OsWCR10 mutant;

[0016] Figure 8 Starch characteristics analysis of OsWCR10 mutant (AB: starch urea swelling, C: RVA gelatinization characteristics).

[0017] Figure 9 Analysis of the steaming and eating characteristics of OsWCR10 mutant and wild-type (ZH11) rice (A: hardness B: viscosity C: elasticity D: adhesiveness E: chewiness F: cohesiveness G: resilience H: appearance I: overall score J: mouthfeel).

[0018] Figure 10 Comparison of seed morphology between wild-type (ZH11) and OsWCR10 mutant. Detailed Implementation

[0019] The technical solution of the present invention will be described in detail below with reference to the embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional molecular biology methods. The primers used were synthesized by a biotechnology company.

[0020] Example 1: Obtaining the OsWCR10 gene and constructing a CRISPR / Cas9 editing vector

[0021] 1. Gene information and target design

[0022] OsWCR10 (LOC_Os10g41160) is located on chromosome 10 of rice, with a full-length CDS of 1020 bp (SEQ ID NO: 2), encoding a protein of unknown function composed of 340 amino acids (SEQ ID NO: 1). Using CRISPR / Cas9 technology, an sgRNA targeting exon 1 of OsWCR10 was designed, with the target sequence: GCTGATGATGTTCCACACGATGG (SEQ ID NO: 4). The synthesized target adapter was annealed and ligated into the enzyme-digested BGK03 vector to construct a recombinant editing vector. This vector was transformed into *E. coli* DH5α, and plasmids were extracted by picking spots and shaking the cells. After sequencing confirmation, the cells were transformed into *Agrobacterium* EHA105 competent cells.

[0023] 2. Genetic transformation and mutation screening

[0024] The above-mentioned editing vector was transformed into callus induced by mature embryos of rice variety Zhonghua 11 (ZH11) using Agrobacterium-mediated transformation. T0 generation regenerated plants were obtained through 50 mg / L hygromycin resistance screening, pre-differentiation, differentiation, and rooting culture, and then transplanted to a greenhouse for cultivation.

[0025] Genomic DNA was extracted from leaves of T0 generation plants. PCR detection was performed using vector primers Cas9-F: AGAACCAGACCACCCAGAAGG (SEQ ID NO:5) and Cas9-R: CACCACCAGCACAGAATAGGC (SEQ ID NO:6) to screen for positive transgenic plants. Specific primers OsWCR10-F: ACCGCCTTGGCCTCATGCTTC (SEQ ID NO:7) and OsWCR10-R: TGATGTCGTCCTGTCTGATCGGGTAG (SEQ ID NO:8) were designed upstream and downstream of the target site to amplify the target site fragment in positive plants via PCR, TA cloning, and sequencing. Functional knockout mutant lines with base deletions or insertions were screened. After self-crossing and selection, homozygous mutant lines of the T2 generation were obtained. One mutant line, CDS (SEQ ID NO:2), exhibited a frameshift mutation due to base deletion, and was named OsWCR10 (SEQ ID NO:2). Figure 1 ).

[0026] OsWCR10 gene tissue expression pattern analysis

[0027] Example 2: Detection of starch synthesis-related traits in mutant OsWCR10

[0028] 1. Analysis of OsWCR10 gene tissue expression pattern

[0029] Analysis using the RiceXPro database (https: / / ricexpro.dna.affrc.go.jp / index.html) showed that the OsWCR10 gene was specifically highly expressed in the endosperm of rice seeds. To verify the accuracy of the data, roots, stems, leaves, panicles, and seeds at 5, 10, 15, 20, 25, and 30 days after flowering of wild-type (ZH11) and mutant OsWCR10 were collected. RNA was extracted and reverse transcribed into cDNA. The relative expression levels of OsWCR10 in various tissues and organs of rice were analyzed using quantitative real-time PCR.

[0030] The primers used in quantitative real-time PCR are:

[0031] SEQ ID NO: 9: OsWCR10 Quantitative-F CGCTGTTCATCACCTTCTCC

[0032] SEQ ID NO: 10: OsWCR10 Quantitative-R CTTCTCCACCATCACCGACT

[0033] The internal reference gene used is OsUbq, and the corresponding primers are:

[0034] SEQ ID NO: 11: OsUbq quantification-F GACAACGTGAAGGCGAAGA

[0035] SEQ ID NO: 12: OsUbq Quant-R CACCAGGTGGAGTGTGGAC

[0036] The results are as follows Figure 2 As shown, the expression analysis results of each tissue are consistent with the predicted results, and the tissues are specifically highly expressed in the seed species.

[0037] Example 2: Biological information analysis of the OsWCR10 gene

[0038] Bioinformatics analysis was performed using the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). The OsWCR10 gene DNA sequence is 1469 bp in length, with a CDS sequence of 1020 bp, encoding a 340-amino acid protein of unknown function. Homologous proteins of OsWCR10 in different species were retrieved using the BLAST function in NCBI, and a evolutionary tree was constructed to explore the relationship between OsWCR10 and other higher plant homologues. The results are as follows: Figure 2 As shown, OsWCR10 is most closely related to japonica rice.

[0039] 2. Biological information analysis of the OsWCR10 gene

[0040] Bioinformatics analysis was performed using the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). The OsWCR10 gene DNA sequence is 1469 bp in length, with a CDS sequence of 1020 bp, encoding a 340-amino acid protein of unknown function. Homologous proteins of OsWCR10 in different species were retrieved using the BLAST function in NCBI, and a evolutionary tree was constructed to explore the relationship between OsWCR10 and other higher plant homologues. The results are as follows: Figure 3 As shown, OsWCR10 is most closely related to japonica rice.

[0041] 3. Grain trait analysis of WCR10 mutant

[0042] The mutant line and wild-type (ZH11) plants were planted simultaneously, and grain traits were examined after the entire growth cycle was completed. Compared with the wild-type (ZH11), the wcr10 mutant showed decreased grain thickness, grain width, and thousand-grain weight; and increased grain length, length-to-width ratio, chalkiness, chalky grain percentage, and amylose content. Figure 4 AG).

[0043] The above results indicate that the OsWCR10 gene has a certain impact on the yield and quality of rice.

[0044] 4. Morphological and structural analysis of endosperm starch granules in WCR10 mutants

[0045] The altered seed size and the presence of opaque chalky areas in the mutant plants suggest that WCR10 may regulate seed starch synthesis. Based on this, scanning electron microscopy observation of mature seeds from both the mutant and wild-type (ZH11) plants revealed that wild-type ZH11 starch granules were regular and tightly packed, while the starch granules in the opaque ventral portion of the mutant WCR10 were irregular and loosely packed. Figure 5 Transmission electron microscopy observation at early seed development (10DAF) showed that, compared with wild-type ZH11, the starch grains of mutant WCR10 had less distinct angularity and rounded edges. Figure 5 This indicates that the mutant WCR10 has abnormal starch granule development, resulting in loosely arranged starch granules and the formation of opaque endosperm.

[0046] 5. Analysis of abnormal starch granule development in WCR10 mutants

[0047] To further investigate the reasons for the abnormal starch granule development in mutant seeds, the expression levels of key genes in the starch synthesis pathway were analyzed in developing seeds. The results showed that the expression levels of key genes in the starch synthesis pathway in the early seed development stage (10DAF) mutant WCR10 were significantly lower than those in the wild-type ZH11. Figure 6 Analysis of starch content and composition in mature seeds revealed that, compared with the wild-type ZH11, the amylose content in the mutant WCR10 was significantly increased. Figure 4 H). Amylopectin chain length analysis revealed that, compared to wild-type ZH11, the mutant WCR10 showed increased chain lengths with a degree of polymerization (DP) of 6 to 12, decreased chain lengths of 13 to 22, increased chain lengths of 24 to 37, decreased chain lengths of 39 to 50, and increased chain lengths greater than 54 DP. Figure 7 The above results indicate that the OsWCR10 gene affects starch synthesis in grains.

[0048] 6. Analysis of urea solubility and gelatinization characteristics of WCR10 mutant

[0049] Because the amylose content and amylopectin structure of the WCR10 mutant are altered, the gelatinization properties of the starch are changed. Therefore, urea solubility and gelatinization properties were analyzed for the mutant WCR10 and the wild type (ZH11). The solubility results at different urea concentration gradients showed that rice flour from the mutant WCR10 was more soluble in urea solution than rice flour from the wild type (ZH11), and a highly significant difference was observed between the mutant and the wild type at a concentration of 4 M. Figure 8 AB).

[0050] Further analysis of the gelatinization characteristics of the mutant WCR10 revealed that, with increasing temperature, the viscosity of WCR10 starch increased more slowly than that of the wild type, and the viscosity value remained significantly lower than that of the wild type (ZH11). However, as the temperature decreased to 50℃, the viscosity of WCR10 gradually exceeded that of the wild type (ZH11). The highest viscosity peaks for ZH11 and WCR10 were 2084 and 1355, respectively, and the final viscosity values ​​were 2376 and 2615, respectively. Figure 8 C).

[0051] 7. Analysis of the cooked taste of WCR10 mutant

[0052] Because the altered starch content in the WCR10 mutant leads to changes in gelatinization properties, affecting the cooked and palatable quality of rice, this study investigated the textural and palatable properties of WCR10 mutant rice. Analysis of the cooked and palatable properties of the rice revealed that, compared to wild-type ZH11, the WCR10 mutant exhibited higher hardness, elasticity, adhesiveness, chewiness, cohesiveness, and resilience, while having lower viscosity. Palatable property analysis showed that, compared to wild-type ZH11, the WCR10 mutant rice had lower appearance, taste, and overall score. Figure 9 ).

[0053] In summary, the expression levels of key genes in the starch synthesis pathway were significantly downregulated during seed development in mutant WCR10, leading to abnormal starch granule development, the formation of opaque endosperm, a significant increase in amylose content, changes in amylopectin structure, and alterations in starch gelatinization properties, thereby resulting in a decline in the taste and quality of cooked rice.

[0054] The above embodiments are merely illustrative of the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention shall fall within the scope of protection of the present invention.

[0055] sequence list

[0056] <110> Guizhou Provincial Rice Research Institute

[0057] <120> A method for precise regulation of rice heading stage

[0058] <160> 12

[0059] <210> 1

[0060] <211>339

[0061] <212> PRT

[0062] <213> Rice (Oryza sativa)

[0063] <400> 1

[0064] MASSGAVALMMFHTMERELFWRLVGEHGQQPGPMRWVIALWLWLESVGHHDFVRRVAVLPAPVVLRFVDEALACLARLPRRRGVAGGAERRLAALAAAGDADPALRFLPCTNALLAEPVEGLAYFDAHRDEVMEGVSDVYRNVCRVIFDDGVAAAVAAADDDDDAEAAAFLPRDVLDALDGTPPPPPPPPMYHQYHHHAVHMAPMLPPPPPVAELNPMASPWFPVQQQEQPPPPPPQPHQQHGYIPLPEDYRSLFITFSRGYPIRQDDIINFFNSLYGPCVESVMVEKAAAGQLPVYGRVVLRCPSMIPVVLDGQQTAKYMIKGRHLWARIYVPSSKPN

[0065] <210> 2

[0066] <211> 1020

[0067] <212> CDS

[0068] <213> Rice (Oryza sativa)

[0069] <400> 2

[0070]

[0071] <210> 3

[0072] <211> 1469

[0073] <212> DNA

[0074] <213> Rice (Oryza sativa)

[0075] <400> 3

[0076]

[0077] <210> 4

[0078] <211> twenty three

[0079] <212> DNA

[0080] <213> Artificial sequence

[0081] <400> 4

[0082] GCTGATGATGTTCCACACGATGG

[0083] <210> 5

[0084] <211> twenty one

[0085] <212> DNA

[0086] <213> Artificial sequence

[0087] <400> 5

[0088] AGAACCAGACCACCCAGAAGG

[0089] <210> 6

[0090] <211> twenty one

[0091] <212> DNA

[0092] <213> Artificial sequence

[0093] <400> 6

[0094] CACCACCAGCACAGAATAGGC

[0095] <210> 7

[0096] <211> twenty one

[0097] <212> DNA

[0098] <213> Artificial sequence

[0099] <400> 7

[0100] ACCGCCTTGGCCTCATGCTTC

[0101] <210> 8

[0102] <211> 26

[0103] <212> DNA

[0104] <213> Artificial sequence

[0105] <400> 8

[0106] TGATGTCGTCCTGTCTGATCGGGTAG

[0107] <210> 9

[0108] <211> 20

[0109] <212> DNA

[0110] <213> Artificial sequence

[0111] <400> 9

[0112] CGCTGTTCATCACCTTCTCC

[0113] <210> 10

[0114] <211> 20

[0115] <212> DNA

[0116] <213> Artificial sequence

[0117] <400> 10

[0118] CTTCTCCACCATCACCGACT

[0119] <210> 11

[0120] <211> twenty one

[0121] <212> DNA

[0122] <213> Artificial sequence

[0123] <400> 11

[0124] GACAACGTGAAGGCGAAGA

[0125] <210> 12

[0126] <211> 19

[0127] <212> DNA

[0128] <213> Artificial sequence

[0129] <400> 12

[0130] CACCAGGTGGAGTGTGGAC.

Claims

1. A starch synthesis gene OsWCR10 regulating agent, characterized in that, The gene OsWCR10 has the amino acid sequence shown in SEQ ID NO: 1; or a protein derived from SEQ ID NO: 1 by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence of SEQ ID NO: 1 and related to the regulation of starch synthesis; or has the CDS sequence shown in SEQ ID NO: 2; or has the DNA sequence shown in SEQ ID NO: 3; or has DNA sequences of SEQ ID NO: 2 and SEQ ID NO: 3 with more than 90% homology and encoding the same nucleotide sequence.

2. The application of the gene OsWCR10 as described in claim 1 in regulating normal starch synthesis in rice.

3. Use according to claim 2, characterized in that: By selectively knocking out the expression of the OsWCR10 gene in rice, it was verified that knocking out the expression of this gene affects rice starch synthesis, leading to the formation of chalky seeds.

4. Use according to claim 3, characterized in that: The method described above involves targeted knockout of the OsWCR10 gene in rice Zhonghua 11 to alter its expression. Specifically, this involves targeted knockout of the first exon of the OsWCR10 gene using the CRISPR / Cas9 system, with the target sequence shown in SEQ ID NO:4.

Images