Corn br1 mutants and uses
By performing specific site mutations and fea4 gene mutations in the maize br1 mutant, maize plant height and ear development were regulated, solving the problem of inaccurate plant height regulation, achieving the ideal semi-dwarf plant type, and improving maize's lodging resistance and yield.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANDONG UNIV
- Filing Date
- 2026-07-02
- Publication Date
- 2026-07-31
AI Technical Summary
Existing technologies make it difficult to precisely control the height of maize plants, leading to excessive dwarfing that inhibits vegetative growth and biomass accumulation, thus affecting yield.
We provide maize br1 mutants, and by mutating or inserting at specific sites in the ZmBr1 protein or ZmBr1 gene, combined with loss-of-function mutations in the fea4 gene, we can regulate plant height and ear development to obtain a semi-dwarf ideal plant type.
It significantly reduced plant height and ear height while maintaining normal vegetative growth and development, overcame the defects of traditional mutants, optimized maize plant and ear type, and improved lodging resistance and yield.
Smart Images

Figure CN122483166A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetics and molecular breeding, specifically relating to maize. br1 Mutants and their applications. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] As a crucial global food and feed crop, maize's yield increase plays a vital role in ensuring global food security and stabilizing the international food supply system. Plant architecture is a core agronomical trait determining maize population productivity, with plant height being a key component that directly impacts lodging resistance and light utilization efficiency. Appropriately reducing plant height can effectively improve maize's tolerance to dense planting and lodging resistance, representing an important direction in current high-yield maize breeding. However, excessive dwarfing often inhibits vegetative growth and biomass accumulation, leading to a decline in yield potential. Therefore, precise control of plant height has become a key objective in maize molecular design breeding.
[0004] Compared to loss-of-function mutations that often lead to extreme dwarfism or even growth defects, weak alleles exhibit higher breeding value in plant height regulation. Short-segmented dwarf plants (… brachytic , br The mutant is a typical short-internode dwarf mutant, characterized by shortened internode length rather than a reduction in the number of internodes, while the overall organ development of the plant is largely unaffected. Previous studies have shown that maize... br1 The dwarfing phenotype of mutants is closely related to auxin polar transport and related signaling regulation processes. Currently, regarding maize... br1 The discovery and functional analysis of weak alleles are still limited. Further elucidating their molecular mechanisms of regulating plant height and ear development has important theoretical value and breeding application prospects for maize plant architecture optimization and yield improvement. Summary of the Invention
[0005] To address at least one of the technical problems existing in the aforementioned background art, the present invention provides corn... br1 Mutants and their applications.
[0006] The present invention adopts the following technical solution: The first aspect of the present invention provides corn br1 mutant, the corn br1 The mutant is selected from any of the following: a) Mutants obtained by mutating at position 72, 78, 128 or 146 of the wild-type ZmBr1 protein; The amino acid sequence of the wild-type ZmBr1 protein is shown in SEQ ID NO. 2; b) In corn ZmBr1 A large insertion occurs after nucleotide 853 of the gene. Zmbr1 Mutants; c) as described in b) Zmbr1 Based on mutants, fea4 It is caused by a loss-of-function mutation in the gene. Zmbr1; fea4 Double mutant; the fea4 The loss-of-function mutation of the gene is a mutation at amino acid position 242 of the amino acid sequence shown in SEQ ID NO. 12.
[0007] A second aspect of the invention provides a nucleic acid molecule for encoding the maize described in the first aspect. br1 Mutant.
[0008] A third aspect of the invention provides a carrier comprising the nucleic acid molecule described in the second aspect.
[0009] In a fourth aspect, a host cell is provided, comprising the nucleic acid molecule described in the second aspect or the vector described in the third aspect.
[0010] A fifth aspect of the invention provides the corn described in the first aspect. br1 The application of mutants, nucleic acid molecules as described in the second aspect, vectors as described in the third aspect, or host cells as described in the fourth aspect in reducing plant height and / or ear height.
[0011] A sixth aspect of the invention provides the corn described in the first aspect. br1 Application of mutants in regulating maize ear type.
[0012] A seventh aspect of the invention provides the corn described in the first aspect. br1 Application of mutants in increasing the number of rows in maize ears and / or flattening inflorescence meristems.
[0013] An eighth aspect of the invention provides the corn described in the first aspect. br1 Application of mutants in the breeding of semi-dwarf maize varieties, the maize br1 Mutants include Zmbr1 G146S Mutant.
[0014] Compared with the prior art, the beneficial effects of the present invention are: The corn described in this invention br1 Mutants, mutants with mutations at positions 72, 78, 128, or 146 of the wild-type ZmBr1 protein, or mutants found in maizeZmBr1 A large insertion occurs after nucleotide 853 of the gene. Zmbr1 Mutants. Among them, the mutants at positions 72, 128, and 146 are typical weak alleles, which achieve gradual regulation of plant height by finely adjusting the strength of protein function rather than completely destroying gene function. In particular, the mutant at position 146, where glycine is mutated to serine (G146S), significantly reduces plant height and ear height while maintaining normal vegetative growth and development, exhibiting a semi-dwarf ideal plant type, overcoming the defects of traditional loss-of-function mutants such as pollination limitation and biomass reduction caused by extreme dwarfing; the mutant at position 128, where arginine is mutated to glycine (R128G), also shows a significant reduction in plant height and ear height. The loss-of-function mutants obtained in this invention Zmbr1 This invention has broad application prospects and high application value in the regulation of maize ear type. It has important practical significance for optimizing maize plant type and ear type, and has important theoretical and practical significance for maize variety improvement. Attached Figure Description
[0015] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0016] Figure 1 This diagram illustrates the structure of the ZmBr1 gene and the locations of different allelic mutants; including loss-of-function mutants. Zmbr1 The mutation location and type are represented by an inverted triangle, yielding a stop codon mutant. Zmbr1 W78* Marked with an arrow, weak allelic mutants. Zmbr1 L72F , Zmbr1 R128G , Zmbr1 G146S Use arrows to mark the components; boxes represent exons, and lines represent introns. Figure 2 To stop codon mutant Zmbr1 W78* mutant phenotype in the B73 background, Zmbr1 W78* The dwarf mutant has a significantly reduced plant height. Scale bar: 20 cm. Figure 3 for Zmbr1 L72F , Zmbr1 R128G , Zmbr1 G146S Phenotypic and plant height and ear height statistics of three weak allelic mutants, scale bar: 20 cm; (a) Zmbr1L72F , Zmbr1 R128G , Zmbr1 G146S Phenotypes of the three weak allelic mutants; (b) Zmbr1 L72F Plant height statistics compared to the wild type (WT); (c) Zmbr1 L72F Ear height statistics compared with WT; (d) Zmbr1 G146S Plant height statistics compared to WT; (e) Zmbr1 G146S Ear height statistics compared with WT; (f) Zmbr1 R128G Plant height statistics compared to WT; (g) Zmbr1 R128G Ear height statistics compared with WT; Figure 4 for Zmbr1; fea4 Double mutant strain type, meristem phenotype and statistics; (a) Zmbr1;fea4 Double mutant compared to Zmbr1 The mutant exhibited a stronger dwarfing phenotype, scale bar: 20 cm; (b) Zmbr1;fea4 The plant height of the double mutant was significantly shorter than that of the single mutant; (c) Zmbr1;fea4 The ear height of the double mutant was significantly lower than that of the single mutant; (d) the height and width of the shoot apex meristem are marked with white arrows; (e) Zmbr1;fea4 The increased meristem width in the double mutant differed from that in the single mutant and wild type; (f) Zmbr1;fea4 The meristematic height of the double mutant was reduced compared to that of the single mutant and wild type; (g) wild type, Zmbr1 mutants fea4 Single mutants and Zmbr1;fea4 Morphology of the inflorescence meristem (IM) of the double mutant, scale bar: 500 μm; (h) Immature female ears of the double mutant are more flattened compared with wild type and single mutant; scale bar: 50 cm; (i) Statistical analysis shows that Zmbr1;fea4 The number of ear rows in the double mutant was increased compared with both the wild type and the single mutant; data are presented as mean ± standard deviation, and two-tailed two-sample t-tests were performed. Detailed Implementation
[0017] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0018] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0019] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.
[0020] As described in the background section, achieving "precise control" of plant height, rather than simply reducing it, has become an important goal of current molecular design breeding of maize. Optimizing plant architecture, enhancing lodging resistance, and achieving precise control of plant height are not only significant for breaking through yield bottlenecks and achieving high and stable yields, but also have important strategic value for ensuring food security and enhancing international food supply capacity.
[0021] In recent years, with the development of functional genomics, several key genes regulating maize plant height have been identified. These genes are widely involved in hormone metabolism, signal transduction, and cell division and elongation. Notably, compared to loss-of-function mutations, which often lead to extreme dwarfing or even growth defects, weak alleles have shown greater breeding value in plant height regulation. These allelic variations typically achieve "gradual regulation" of plant height by finely adjusting gene expression levels or protein functional strength, reducing plant height while maximizing the preservation of growth vigor and yield potential. For example, some weak alleles can slightly reduce internode elongation rate, resulting in a more compact plant type without significantly affecting ear development or grain filling. This regulatory model better meets the plant type requirements of modern high-density, high-yield cultivation.
[0022] Furthermore, weak alleles exhibit good environmental adaptability and genetic stability, displaying more stable phenotypic effects under different ecological conditions, which is beneficial for their application in multi-environment breeding systems. From a molecular perspective, weak allelic variations often achieve precise regulation of downstream growth regulatory networks by modulating cis-acting elements, altering transcription factor binding capacity, or affecting protein activity. This regulatory approach avoids complete disruption of core growth pathways, enabling plants to maintain a relatively coordinated growth state at different developmental stages. Therefore, systematically identifying and functionally analyzing weak alleles regulating plant height not only helps to deepen the understanding of the molecular basis of maize plant architecture formation but also provides important genetic resources and theoretical support for breeding superior varieties that combine high yield, lodging resistance, and adaptability to dense planting. However, current understanding of maize... br1 The discovery and functional analysis of weak alleles are still limited, and there is an urgent need to develop more superior allelic variations that can be used for precise regulation of plant height.
[0023] Based on this, the present invention provides corn br1 Mutants and their applications.
[0024] A typical embodiment of the present invention provides corn br1 mutant, the corn br1 The mutant is selected from any of the following: a) Mutants obtained by mutating at position 72, 78, 128 or 146 of the wild-type ZmBr1 protein; The amino acid sequence of the wild-type ZmBr1 protein is shown in SEQ ID NO. 2; b) In corn ZmBr1 A large insertion occurs after nucleotide 853 of the gene. Zmbr1 Mutants; c) as described in b) Zmbr1 Based on mutants, fea4 It is caused by a loss-of-function mutation in the gene. Zmbr1; fea4 Double mutant; the fea4 The loss-of-function mutation of the gene is a mutation at amino acid position 242 of the amino acid sequence shown in SEQ ID NO. 12.
[0025] In this invention, the maize R2R3-MYB transcription factor The CDS nucleotide sequence is shown in SEQ ID No. 1, and its protein coding sequence is shown in SEQ ID No. 2, which is unrelated to the gene cloning method.
[0026] In some embodiments, the corn of the present invention br1 A stop codon mutant was obtained, causing premature termination of protein translation, and was named W78* ,in W78* The mutation is manifested as a change from tryptophan (W) to a stop codon (*) at position 78 of the amino acid sequence, as shown in SEQ ID No. 3, and a change from G to A at position 233 of the nucleotide sequence, as shown in SEQ ID No. 7. W78* The mutant affects plant height and ear height, exhibiting a dwarfing phenotype.
[0027] In some implementations, corn br1 A series of weak allelic mutants in maize The gene nucleotide sequence produced three different mutation types, exhibiting phenotypes of reduced plant height and ear height, in the maize... br1 The weak allelic mutants were named respectively L72F , R128G , G146S ,in L72F The mutation is manifested as the substitution of wild-type leucine (L) for phenylalanine (F) at position 72 of the amino acid sequence, as shown in SEQ ID No. 4, and the substitution of wild-type C for T at position 214 of the nucleotide sequence, as shown in SEQ ID No. 8. R128G The mutation is manifested as the wild-type arginine (R) changing to glycine (G) at position 128 of the amino acid sequence, as shown in SEQ ID No. 5, and the wild-type C changing to G at position 382 of the nucleotide sequence, as shown in SEQ ID No. 9. G146S The mutation is manifested as the substitution of wild-type glycine (G) for serine (S) at position 146 of the amino acid sequence, as shown in SEQ ID No. 6, and the substitution of wild-type G for A at position 436 of the nucleotide sequence, as shown in SEQ ID No. 10.
[0028] In some embodiments, in b), the large fragment insertion sequence is as shown in SEQ ID No. 11, specifically obtained by inserting the large fragment insertion sequence as shown in SEQ ID No. 11 after position 853 of the CDS nucleotide sequence shown in SEQ ID No. 1.
[0029] In some embodiments, in c), position 242 is mutated from glutamine (Q) to a stop codon (*), the amino acid sequence of which is shown in SEQ ID No. 13.
[0030] In some implementations, maize can be modified by one or more of the following methods: ethyl methanesulfonate (EMS) mutagenesis, gene editing, base editing, promoter editing, RNA interference, antisense inhibition, or mutant hybridization. Gene expression or protein function is reduced, disrupted, or altered to obtain the product described in this invention. Mutant. More preferably, EMS mutagenesis.
[0031] Another typical embodiment of the present invention provides a nucleic acid molecule for encoding the maize described in the present invention. br1 Mutant.
[0032] The nucleic acid molecule is selected from the group consisting of: genomic sequences, cDNA sequences, RNA sequences, or combinations thereof.
[0033] The nucleic acid molecule can be single-stranded or double-stranded.
[0034] The nucleic acid molecule may also contain additional auxiliary elements selected from the group consisting of: signal peptides, secretory peptides, tag sequences (such as 6His), nuclear localization signals, or combinations thereof.
[0035] The nucleic acid molecule also contains a promoter that is operatively linked to the ORF sequence encoding the mutant polypeptide.
[0036] The promoter is selected from the group consisting of: constitutive promoters, tissue-specific promoters, inducible promoters, or strong promoters.
[0037] A third typical embodiment of the present invention provides a carrier containing the nucleic acid molecule described in the present invention.
[0038] In some embodiments, the carrier contains corn encoding the present invention. br1 The mutant nucleic acid molecule. Preferably, the vector further includes an expression regulatory element operatively linked to the aforementioned nucleic acid molecule.
[0039] In some embodiments, the vector includes a cloning vector, an expression vector, a shuttle vector, or an integration vector.
[0040] In some embodiments, the vector may be a vector that is integrated into the genome when introduced into a host cell and replicates along with the chromosome into which it is integrated.
[0041] The vector can be of the following types: plasmid, virus, granule, bacteriophage, etc., which are well known to those skilled in the art.
[0042] In a fourth typical embodiment of the present invention, a host cell is provided containing the nucleic acid molecule or vector described in the present invention.
[0043] In some embodiments, the host cell is a eukaryotic cell, such as a yeast cell, an animal cell, or a plant cell.
[0044] In some embodiments, the host cell is a prokaryotic cell, such as Escherichia coli.
[0045] In some embodiments, the plants include angiosperms and gymnosperms.
[0046] In some embodiments, the plants include monocotyledonous plants and dicotyledonous plants.
[0047] In some embodiments, the plants include herbaceous plants and woody plants.
[0048] In some embodiments, the plants include corn, wheat, Arabidopsis thaliana, tobacco, rice, sorghum, barley, millet, soybean, tomato, potato, quinoa, lettuce, rapeseed, cabbage, strawberry, etc.
[0049] The fifth embodiment of the present invention provides the corn described in the present invention. br1 Application of mutants, nucleic acid molecules, vectors, or host cells in reducing plant height and / or ear height.
[0050] In some embodiments, the corn br1 Mutants include W78* mutants R128G mutants G146S mutants Mutant.
[0051] The sixth embodiment of the present invention provides the corn described in the present invention. br1 Application of mutants in regulating maize ear type.
[0052] In some embodiments, the corn br1 The mutant is mutant or Double mutant 。 The present invention The mutant affects plant height, ear height, and correspondingly, the size of the shoot apical meristem. This invention demonstrates through genetic analysis that… The double mutant showed increased size of shoot tips and inflorescence meristems, indicating... It regulates the development of meristematic tissue and inflorescence structure.
[0053] This is incorrect. The method for preparing the double mutant is limited and can be any conventional method in the art, including but not limited to gene editing, hybridization, backcrossing, self-pollination, or asexual reproduction. In this invention... The preparation method of double mutants includes by... and The mutants were hybridized to obtain the desired mutants.
[0054] In some embodiments, the regulation of maize ear type includes increasing the width of the shoot apical meristem and / or decreasing its height.
[0055] The seventh embodiment of the present invention provides the corn described in the present invention. br1 Application of mutants in increasing the number of rows in maize ears and / or flattening inflorescence meristems.
[0056] In some embodiments, the corn br1 The mutant is Double mutant.
[0057] The eighth embodiment of the present invention provides corn. br1 Application of mutants in the breeding of semi-dwarf maize varieties.
[0058] In some embodiments, the corn br1 Mutants include G146S Mutant.
[0059] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0060] Example 1 corn br1 Identification of different allelic mutants After the corn sprouts, take 1 cm of tender, fresh leaves and extract the leaf DNA. According to... The genome sequence of the gene Zm00001d032194 was obtained by searching the MaizeGDB database (https: / / www.maizegdb.org / ). The mutant has a large insertion at the third exon (maize). A large insertion occurs after nucleotide 853 of the gene. ), and software was used to design PCR amplification primers to distinguish between wild type, heterozygote and mutant, the sequences of which are as follows: Zmbr1-mut-F: GGGTTCTGTTTGCTTCTTAAT Zmbr1-mut-R:GCTCAATCTCCGTCACTAGTTC Zmbr1-Insertion-F:CAGTTCAGCAGGTGTTGGT Using primers Zmbr1-mut-F and Zmbr1-mut-R, those that amplify the corresponding bands are heterozygotes and wild-type, while those without corresponding bands are mutants. Using primers Zmbr1-Insertion-F and Zmbr1-mut-R, those that amplify the corresponding bands are heterozygotes and mutants, while those without corresponding bands are wild-type. Based on these bands, wild-type, heterozygotes, and mutants can be distinguished.
[0061] For corn br1 weak allelic mutants ( The PCR products obtained from PCR amplification were subjected to Sanger sequencing, and sequence analysis was performed on different sites in each plant. W78* The mutation manifests as a change from tryptophan (W) to a stop codon (*) at position 78 of the amino acid sequence, and a change from G to A at position 233 of the nucleotide sequence; L72F The mutation is manifested as a change from leucine (L) to phenylalanine (F) at position 72 of the amino acid sequence and a change from wild-type C to T at position 214 of the nucleotide sequence; R128G The mutation manifests as a change from arginine (R) to glycine (G) at position 128 of the amino acid sequence and a change from C to G at position 382 of the nucleotide sequence. G146S The mutation manifests as a change from glycine (G) to serine (S) at position 146 of the amino acid sequence and a change from G to A at position 436 of the nucleotide sequence.
[0062] right W78* , L72F R128G and G146S The primer sequences for first-generation sequencing are as follows: Zmbr1 L72F and W78* -F: CACCATGGACACGGCCG Zmbr1 L72F and W78* -R: AGTTCTGGGGCCCGTACA Zmbr1 R128G -F: GGGAAGAGCTGCCGCCT Zmbr1 R128G -R: GATCATGGCCCACTTGTT Zmbr1 G146S -F: GTTCAACCAGCTAGACCCC Zmbr1 G146S -R: TGATGACGTGCCAGTGGT Example 2 W78* Mutant phenotypic observation In this invention, W78* The mutant and wild-type maize were planted normally in the field, and their phenotypes were observed at maturity. As shown, W78* The mutant plants were significantly shorter than the wild type, and the ear height was also significantly reduced. These results indicate that... It positively regulates plant height without significantly interfering with the plant's development process.
[0063] Example 3 corn br1 Phenotypic and statistical analysis of weak allelic mutants In this invention, a randomized block design is used to incorporate corn... br1 Maize materials with different weak allelic mutants and wild-type controls were sown in the experimental field. During the growth period, normal water and fertilizer management was implemented to ensure a consistent growth environment for all materials. After the plants produced tassels, the plant height and ear height of each genotype were measured, with a sample size of no less than 10 plants per group. [Further details regarding measurements would follow.] L72F , R128G , G146S Phenotypic identification and data analysis were performed on three weak allelic mutants and wild-type plants. Data are expressed as mean ± standard deviation (mean ± sd). Significance between groups was determined using two-tailed Student's scores. t -test was used for verification. The results showed that R128G The mutant plant height and ear height were significantly lower than those of the wild type. (a), (f), and (g) in the text), and the statistical differences are extremely significant. G146S The mutant's plant height and ear height are slightly lower than those of the wild type. (a), (d), and (e)). These mutations indicate that they can regulate plant height, highlighting their potential to improve plant structure and increase yield. Compared to the wild type, L72F There was no significant difference in plant height. (a), (b), and (c) in the text). Overall, G146S The mutant exhibits a semi-dwarf phenotype with the most ideal plant structure. This phenotype overcomes the limitations of maize. br1 The pollination limitation caused by severe dwarfing due to alleles makes it a genetic locus that enhances lodging resistance, adapts to high-density planting, and increases crop yield potential.
[0064] Example 4 Genetic analysis of double mutants flattened spike 4 ( , As a semi-dwarf mutant, it exhibits a phenotype characterized by flattened female ears and significantly enlarged shoot apical and inflorescence meristems. (Source: MaizeGDB database (https: / / www.maizegdb.org / )) The gene sequence number is Zm00001d037317, and its protein coding sequence is shown in SEQ ID No. 12, where... The mutation manifests as a change from glutamine (Q) to a stop codon (*) at position 242 of the amino acid sequence, and a change from C to T at position 724 of the nucleotide sequence; through analysis of... and The mutants were hybridized to obtain double heterozygous plants. ), and then self-pollinate them to obtain segregating populations. For wild-type, and Single mutants and Genetic analysis of the double mutant showed that the double mutant exhibited a phenotype with reduced plant height and ear height. (a), (b), and (c)). Shoot apical meristem (SAM) samples were taken from 14-day-old seedlings and fixed overnight in pre-cooled FAA fixative (10% formaldehyde, 45% ethanol, 5% acetic acid). The SAMs were then dehydrated sequentially with 70%, 85%, 95%, and 100% ethanol, each treatment lasting 2 hours. Finally, they were cleared with 50% and 100% methyl salicylate, repeated three times for 2 hours each time. The cleared SAMs were imaged using an Olympus BX53 differential interferometry (DIC) microscope, and the width and height of the SAMs were measured using ImageJ software. The results showed that, compared to the wild type, The mutant SAM is wider and lower in height. (d), (e), and (f) in the analysis. The shoot apical meristem (SAM) phenotype of the double mutant revealed that the SAM width was increased, while the SAM height was... Single mutant similarity ( (d), (e), and (f) in the table). These results further illustrate their synergistic effect in regulating plant height and SAM development.
[0065] Inflorescence meristems were collected from maize plants approximately 50 days after germination. The morphology of the 3-5 mm long female ear primordia was directly imaged using a Jiangnan JSZ6S stereomicroscope. Results showed that, compared to the wild type, The inflorescence meristem of the mutant showed no significant changes. (g)). Although in wild type and No obvious phenotypic changes were observed in the inflorescence meristem (IM) of the single mutant, but Double mutant ratio Single mutants exhibit a more flattened phenotype. (g) in the middle). Due to single mutants The severe and irregular flattened phenotype is not easy to measure. The number of rows in immature female ears was analyzed in (h). The single mutant showed no significant difference in the number of ear rows compared to the wild type, while the double mutant showed no significant difference. The number of ear rows is significantly greater than that of the single mutant. ( (i)). The above results indicate that, although The single mutant did not show obvious abnormalities during IM formation, but and Genetic analysis showed that It also plays a key role in the regulation of inflorescence meristem development.
[0066] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. Corn br1 Mutant, characterized by, The corn br1 The mutant is selected from any one of: a) Mutants obtained by mutating at position 72, 78, 128 or 146 of the wild-type ZmBr1 protein; The amino acid sequence of the wild-type ZmBr1 protein is shown in SEQ ID NO. 2; b) a large fragment insertion occurs after nucleotide 853 of the maize ZmBr1 gene Zmbr1 mutant; c) as described in b) Zmbr1 Based on mutants, fea4 It is caused by a loss-of-function mutation in the gene. Zmbr1;fea4 Double mutant; the fea4 The loss-of-function mutation of the gene is a mutation at amino acid position 242 of the amino acid sequence shown in SEQ ID NO.
12.
2. The corn as described in claim 1 br1 Mutant, characterized by, In statement a), the mutant obtained by mutation at position 72, position 78, position 128, or position 146 is: The 72nd position is changed from leucine to phenylalanine. Zmbr1 L72F The mutant, whose amino acid sequence is shown in SEQ ID No. 4; The 78th position was mutated from tryptophan to a stop codon. Zmbr1 W78* The mutant, whose amino acid sequence is shown in SEQ ID No. 3; The 128th position is changed from arginine to glycine. Zmbr1 R128G The mutant, whose amino acid sequence is shown in SEQ ID No. 5; The 146th position is mutated from glycine to serine. Zmbr1 G146S The mutant, whose amino acid sequence is shown in SEQ ID No. 6; In b), the nucleotide sequence of the large inserted fragment is shown in SEQ ID No. 11; In c), position 242 is mutated from glutamine to a stop codon.
3. A nucleic acid molecule, characterized in that, The nucleic acid molecule is used to encode the maize as described in any one of claims 1-2. br1 Mutant.
4. A carrier, characterized in that, It includes the nucleic acid molecule as described in claim 3.
5. A host cell, characterized in that, It contains the nucleic acid molecule of claim 3 or the vector of claim 4.
6. The corn according to any one of claims 1-2 br1 The application of mutants, nucleic acid molecules of claim 3, vectors of claim 4, or host cells of claim 5 in reducing plant height and / or ear height.
7. The corn according to any one of claims 1-2 br1 Application of mutants in regulating maize ear type.
8. The application as described in claim 7, characterized in that, The regulation of maize ear type includes increasing the width of the shoot apical meristem and / or decreasing its height.
9. The corn according to any one of claims 1-2 br1 Application of mutants in increasing the number of rows in maize ears and / or flattening inflorescence meristems.
10. The corn according to any one of claims 1-2 br1 The application of mutants in the breeding of semi-dwarf maize varieties is characterized by, The corn br1 Mutants include Zmbr1 G146S Mutant.